Datasets:

farleyknight

/

big_patent_5_percent

like 0

throughout the following description specific details are set forth in order to provide a more thorough understanding of the invention . however , the invention may be practiced without these particulars . in other instances , well known elements have not been shown or described in detail to avoid unnecessarily obscuring the present invention . accordingly , the specification and drawings are to be regarded in an illustrative , rather than a restrictive , sense . the invention in one embodiment is directed to implantable medical devices with a flexible thin film calcium phosphate bio - compatible and bio - resorbable coating that has the ability to act as a high capacity drug carrier . such cap coatings have no side - effects during coating dissolution into body fluids , and can be designed with a high level of control of coating dissolution rate and microstructure , which also determine the drug retention and release characteristics . of all the types of implantable medical devices that exist , the coronary stents utilized in balloon angioplasty procedures provide a useful model for testing the effectiveness of sol - gel deposited thin flexible cap coatings on such stents due to the fact that such stents are designed to be flexible . the use of such stents in the examples below should not , however , be considered as limiting the application of the cap coatings described only to stents . the invention has broad application to virtually any type of body implantable device . we have determined unexpectedly that the intrinsic brittle behaviour of cap ceases to limit the system strain capability if the strongly bonded coating is sol - gel deposited and is thinner than approximately 0 . 001 mm . experiments involving repeated contraction / expansion of such thin cap sol - gel coated stents reveal that there is no separation of the coating from the stent , nor visible damage to the coating , if the coating is thinner than about 0 . 001 mm and is strongly bonded to the substrate ( the tensile bond strength should be larger than about 40 mpa , as measured in model strength experiments according to astm c - 633 standard ). in addition , we have discovered that if the novel sol - gel process for deposition of calcium phosphates , in particular hydroxyapatite ( ha ) synthesis ( as previously disclosed in our u . s . pat . no . 6 , 426 , 114 b1 , jul . 30 , 2002 , “ sol - gel calcium phosphate ceramic coatings and method of making same ”, by t . troczynski and d . liu ) is used , the resulting thin flexible coating has controlled porosity which may be utilized to retain drugs within the coating , and release the drugs at a controlled rate . the invention pertains to a sol - gel ( sg ) process for synthesis of calcium phosphate , in particular , hydroxyapatite ( ha ), thin film coatings on implantable medical devices . the process allows the ha to be obtained in a controlled crystallized form , at a relatively low temperatures , i . e . starting at ≈ 350 ° c . this is an unexpectedly low crystallization temperature for ha sol - gel synthesis . the process provides excellent chemical and physical homogeneity , and bonding strength of ha coatings to substrates . the low process temperature avoids substrate metal degradation due to thermally - induced phase transformation , microstructure deterioration , or oxidation . disclosed herein is a method wherein uniform films of hydroxyapatite by the electro - phoretic deposition ( epd ) method ( epd - ha ) are deposited on complex stent surface , and there is no need to pursue sintering in excess of 500 ° c . to achieve substantial structural integrity of the film and its high bonding strength to the metallic substrate . in this method , the first step is the well - known epd of the ha film , for example as disclosed in u . s . pat . no . 5 , 258 , 044 , using suspension of sub - micrometer particles of ha in water . this film is dried and then heat treated at 500 ° c . for 10 - 60 minutes to initiate sintering of ha . the film is still too weak and too poorly bonded for practical use as a coating on stent or other medical device or implant , but is sufficiently strong to survive the subsequent processing step comprising impregnation by aero - sol - gel ha droplets . the droplets penetrate porosity of the previously deposited epd - ha , strongly aided by the capillary suction . thus , majority of the pores of the epd - ha film are penetrated by the sol - gel precursor of ha , all the way to the metallic substrate . this composite film can be now dried and sintered at a relatively low temperature or 400 - 500 ° c ., due to the very high activity of the sol - gel component of the film . the sol - gel film bonds the particles of ha deposited by epd , and bonds well to the metallic substrate during the heat treatment thus , both the film uniformity ( due to epd process ) and low - temperature sinterability ( due to sol - gel process ) have been achieved . this novel and inventive hybrid technology for uniform ha coatings on stents has the ability to produce films in thickness range from about 1 micron to above 100 microns , with porosity in the range from about 10 vol % to about 70 vol %. such porous thick ha films are excellent carriers for drugs loaded through impregnation into open porosity of the film . details of such hybrid process , and its several variants , for preparation of ha films on stents , are given in the examples below . problems with drug delivery in vivo are frequently related to the toxicity of the carrier agent , the generally low loading capacity for drugs , and the aim to control drug delivery resulting in self - regulated , timed release . with the exception of colloidal carrier systems , which support relatively high loading capacity for drugs , most organic systems deliver inadequate levels of bioactive drugs . sol - gel films heat - treated at relatively low temperatures closely resemble the properties of colloidal films , in terms of accessible surface area and porosity size . the sol - gel process according to the invention allows the calcium phosphate to be obtained in a crystallized form , at relatively low temperature , i . e . approximately 350 - 500 ° c . variation of the heat treatment temperature and time provides for control of coating crystallinity ( i . e . a more amorphous , more easily resorbable coating can be processed at lower temperatures ) as well as coating porosity ( higher porosity and smaller average pore size at lower temperatures ). variation of ca / p ratio in the sol - gel precursor mix allows one to obtain various calcium phosphate phases , for example , hydroxyapatite , dicalcium phosphate , tricalcium phosphate or tetracalcium phosphate . the invention in one embodiment is directed to a sol - gel process for preparing calcium phosphate , such as hydroxyapatite , which comprises : ( a ) hydrolysing a phosphor precursor in a water or alcohol based medium ; ( b ) adding a calcium salt precursor to the medium after the phosphite has been hydrolysed to obtain a calcium phosphate gel such as a hydroxyapatite gel ; ( c ) depositing the gel on the surface of an implantable medical device ; and ( d ) calcining the calcium phosphate , such as hydroxyapatite , at a suitable elevated temperature and for pre - determined time to achieve desired crystallinity , bonding and porosity characteristics for the coating on the device . the deposition of the gel can be done by any number of methods , such as aero - sol deposition , dip - coating , spin - coating , electrophoretic deposition . in a preferred embodiment , the phosphor precursor can be an alkyl phosphite and the alkyl phosphite can be triethyl phosphite . further the calcium precursor can be a water - soluble calcium salt and the water soluble calcium salt can be calcium nitrate . the crystallized calcium phosphate can be calcined at a temperature of at about 350 ° c . or higher . the metallic implantable medical device can be stainless steel , cobalt alloy , a titanium substrate or other metallic alloy substrate . we have discovered that if certain specific characteristics of the calcium phosphate coatings are maintained , the coatings become highly flexible while maintaining their chemistry , high bio - compatibility , and bio - resorbability . the most important characteristics are ( a ) coating thickness , and ( b ) the strength of the coating bonding to the metallic substrate . we have repeatedly demonstrated ( refer to the examples below ) that if cap coating thickness is maintained below about 0 . 001 mm , and its bonding strength to the metallic substrate is above approximately 40 mpa , the substrate - coating system retains the strain capabilities of the substrate alone , i . e . the system maintains its integrity during deformation . furthermore , we have discovered that thicker cap coatings deposited discontinuously on metallic substrate , i . e . in the form of separate “ islands ” and “ patches ” approximately 1 - 100 μm in diameter , retain high resistance against substrate deformation . our experiments have shown that stents coated with such 1 - 100 μm patches , about 1 - 10 μm thick , can be crimped and then expanded without damage to the patches of ceramic . these patches can be deposited on the substrate through a variety of methods discussed above , such as bm - ha , ecd - ha , cpc - ha ( all at room or near - room temperature ), or epd - ha , sg - ha and combinations thereof ( these two techniques including heat treatment at elevated temperatures ). these coating deposition techniques are illustrated in the following examples . the discontinuous cap film coated medical implant may have some fraction of an area of the metallic substrate exposed to living tissue , which may again lead to the adverse tissue reaction described above . this problem can be avoided by combining discontinuous cap films with a continuous bio - compatible and non - thrombogenic polymer . thus , a composite cap - polymer coating on medical implant is the result . furthermore , a thin (& lt ; 0 . 001 mm ) continuous cap coating can be combined with a thicker discontinuous cap coating . the effects of this process ( described in detail in the examples ) are shown in the representative fig1 and 2 . fig1 a illustrates stainless steel ( 316l ) stent coated with discontinuous asg - ha thin film ; fig1 b is a magnification of the sector of ( a ) indicated by the rectangle . fig2 a illustrates a stainless steel ( 316l ) stent coated with discontinuous asg - ha thin film and crimped , with no damage to the coating . fig2 b is the same stent after expansion , showing no damage to the coating . our discovery of flexible continuous / discontinuous cap films or cap / polymer films opens up a range of new applications of highly biocompatible cap coatings for medical implants , particularly , but not limited to those that require deformation capability such as coronary stents . a sol - gel ( sg ) process provides superior chemical and physical homogeneity of the final ceramic product compared to other routes , such as solid - state synthesis , wet precipitation , or hydrothermal formation . the sg process allows the desired ceramic phase , e . g . thin film cap coating , to be synthesized at temperatures much lower than some of the alternate processes . in the sg coating process substrate metal degradation due to thermally induced phase transformations and microstructure modification or oxidation , is avoided . sg widens green - shaping capability , for example , and it is a very convenient method for deposition of thin ceramic coatings . sol - gel deposition of ha ( sg - ha ) films at elevated temperatures ( 350 - 500 ° c .) was disclosed previously in u . s . pat . no . 6 , 426 , 114 b1 . sol - gel ( sg ) processing of ha allows molecular - level mixing of the calcium and phosphor precursors , which improves the chemical homogeneity of the resulting calcium phosphate . the crystallinity of the calcium phosphate phase can be enhanced by appropriate use of water treatment during processing . variation of ca / p ratio in the sol - gel precursor mix allows one to obtain any of a number of calcium phosphate phases , for example , hydroxyapatite , dicalcium phosphate , tricalcium phosphate or tetracalcium phosphate . the versatility of the sg method provides an opportunity to form thin film coatings , either continuous or discontinuous , in a rather simple process of dip - coating , spin - coating or aero - sol deposition . a high degree of ha crystallinity is frequently required for longer - term bioactive applications , because partially crystalline , or amorphous calcium phosphate , such as ha , coatings are rapidly resorbed by living tissue . for the presently disclosed application of thin ha films on implantable medical devices , control of crystallinity of the ha coating is possible through variation of the time / temperature history during processing . this allows control of the coating resorption rate and thus rate of release of the drugs impregnated into microporosity of the coating . ceramics produced by sol - gel processing can be designed to include high fraction of pores , with well - defined ( narrowly distributed ) pore size . this is a consequence of the chemical route to the final oxide ceramic produced through sg . only a small fraction of the original precursor mass is finally converted to the ceramic oxide , the remaining fraction being released during heat treatment , usually in the form of gas , is usually as a combination of water and carbon dioxide . thus , the released gases leave behind a large fraction of porosity , up to 90 % in some instances , depending on the drying conditions and heat treatment time and temperature . these pores can be as small as several nm in diameter , again depending on the drying conditions and heat treatment time and temperature . effectively , the accessible surface area of such sol - gel derived oxide ceramics can reach several hundred square meters per gram of the oxide , making it an excellent absorbent of gas or liquid substances , or solutions . for example , the average pore size in sol - gel ha treated at relatively low temperature of 400 ° c . is about 5 nm in diameter , with 90 % of pore diameters falling within the range of 1 - 30 nm . this unique porosity characteristic is widely utilized to produce desiccants , filters and membranes of sol - gel derived ceramic . in this respect sol - gel derived ceramic oxides have a great advantage over polymers , which are in general difficult to process to possess high porosity and high accessible surface area . in the present invention , we utilize this unique property of sol - gel derived cap coatings on medical implants , especially stents , possessing high accessible surface area to make it a high - capacity drug carrier . in the text of this application , it is understood that when appropriate , the term “ calcium phosphate ” ( cap ) is used generically and includes minerals such as hydroxyapatite , dicalcium phosphate , tricalcium phosphate , tetracalcium phosphate and amorphous or partially amorphous calcium phosphate . studies on the sol - gel route to thin film calcium phosphate coatings on implantable medical devices , particularly stents , performed by the inventors have led to an unexpected break - through in process development . the method according to the invention has produced cap coatings after heat treatment in air , starting at about 350 ° c . we have unexpectedly discovered that the film is highly flexible if it is thinner than about 0 . 001 mm , thereby allowing damage - free manipulation of a cap coated deformable implantable medical device , for example the contraction and expansion of a cap coated stent . preferably , the coating has a thickness between about 0 . 0001 and 0 . 001 mm . furthermore , in this application , we have discovered that the film can accept drugs into its fine porosity , thereby allowing it to address the adverse phenomena related to common medically implanted devices , i . e . the restenosis that occurs after placement of a coronary stent in a blood vessel . the calcium phosphate coating according to the invention has been deposited on stents and other metallic surfaces using variety of techniques , including dip - coating , spin - coating , aero - sol deposition electrophoretic deposition . the coatings were deposited on stents made of 316l stainless steel and tubes , and on other metallic substrates including cobalt - iron alloy and titanium . to demonstrate the feasibility of the unique processing concepts outlined above , the following examples are described below for stainless steel substrate and coronary stents . the procedures outlined below can be applied to other implantable medical devices . in the first stage of the process , phosphite sol was hydrolysed in a water - ethanol mixture ( a concentration of 3m ) in a sealed beaker until the phosphite was completely hydrolysed ( which is easily recognized by loss of a characteristic phosphite odour ), at ambient environment . a ca salt ( 2m ) was then dissolved in anhydrous ethanol , and the solution was then rapidly added into the hydrolysed phosphite sol . the sol was left at ambient environment for 8 hours , followed by drying in an oven at 60 ° c . as a result of this process , a white gel was obtained . for the sol containing ca / p ratio required to produce ha , the gel showed a pure ( single phase ) apatitic structure with a ca / p ratio of 1 . 666 , identical to stoichiometric ha , after calcining at a temperature as low as 350 ° c . varying the ca / p ratio allows other calcium phosphates , such as dicalcium phosphate ( ca / p = 1 ) or tricalcium phosphate ( ca / p = 1 . 5 ), to be obtained . a coating produced using this process , and applied to 316 ss substrate , showed adhesive strength of about 40 mpa after curing at a temperature & lt ; 450 ° c . the coating was crack - free and porous . in another variant of the process , a pure water - based environment was used . the aqueous - based sols were prepared in the same manner as described above in example 1 for the ethanol - based system . a higher rate of hydrolysis of the phosphite sol was observed . the mixed sol was dried while stirring . after 8 hours aging , a white gel appeared . for the sol containing a ca / p ratio required to produce ha an apatitic structure with ca / p ratio of 1 . 663 , close to stoichiometric ha , resulted after calcining the gel at a temperature of 350 ° c . both the ethanol - based and aqueous - based gels showed essentially the same apatitic structure at relatively low temperatures . this invention provides a method of synthesizing the ha ceramics via an aqueous - based sol - gel process . a cap coating was deposited on the surfaces of a group of electropolished stainless steel stents through aerosol - gel processing . the stents were first treated in 2 . 4 n phosphoric acid solution for 10 minutes at 70 ° c . to clean the surface and produce microroughness for increased bonding of the coating . the treated stents were ultrasonically cleaned and dried . the cap sol was prepared by ( a ) hydrolysing a phosphor precursor ( phosphite ); ( b ) adding a calcium salt precursor to the medium after the phosphite has been hydrolysed to obtain a calcium phosphate sol such as a hydroxyapatite sol . the sol was atomized into ˜ 4 μm large particles using ultrasonically assisted atomizer , and the resulting aerosol fed into a coating chamber . this specific deposition technique is referred to as aero - sol - gels ( asg ) deposition and the resulting hydroxyapatite film as asg - ha . the clean stent was inserted into the coating chamber filled with flowing cap aerosol - gel for a period of 30 seconds , while maintaining the aerosol flow at 0 . 1 liter / min and chamber temperature at 50 ° c . the temperature of the coating chamber affects the deposition mode of the coating , producing a uniform , film like coverage of the surface as evidenced by sem . the coating was dried at 60 ° c . and heat treated at 450 ° c . for 15 min to crystallize cap to form hydroxyapatite thin film . the procedure produces a thin coating covering uniformly the surface of the stent . the thickness of the coating is measured using ellipsometry in the range of 50 - 150 nm . the subsequent sem studies on the crimped and expanded coated stents show no evidence of cracking or delamination of the coating . this proves the reliability of the uniform , thin continuous cap coating during the deployment and implantation of the stent into the coronary artery . cap coating has been deposited on the surface of an electropolished stainless steel stents through aerosol - gel processing ( asg ), as described in example 3 . the chamber temperature was maintained at 25 ° c . the coating was dried at 60 ° c . and heat treated at 450 ° c . for 15 min to crystallize cap to form hydroxyapatite thin film . the procedure explained above produces a coating comprising of isolated island of approximately 2 - 6 μm in size and 0 . 1 - 2 μm in thickness , scattered uniformly on the surface of the stent , and covering about 70 % of the surface of the stent , as shown in fig1 a and 1b . subsequent sem studies on the crimped and expanded coated stents showed no evidence of cracking or delamination of the coating , as shown in fig2 a and 2b . this proves the reliability of the discontinuous cap coating of variable thickness during the deployment and implantation of the stent into the coronary artery . stainless steel metallic substrates ( 316l ) were coated with a 0 . 6 - 0 . 8 μm thin layer of apatite ( asg - ha ) as described in example 3 . one group of samples was annealed at 400 ° c . for 20 min to achieve crystalline sg - ha ( c ) film and another group at 375 ° c . for 60 min to achieve amorphous sg - ha ( a ) film . these films were used as nucleation site for precipitation of bm - ha film . the sg - ha coated samples were immersed into “ simulated body fluid ” ( sbf ) of ionic composition ( in units of mmol / l ) 142 na + , 5 . 0 k + , 2 . 5 c 2 + , 1 . 5 mg 2 + , 103 cl − , 25 hco 3 − , 1 . 4 hpo 4 2 − , and 0 . 5 so 4 2 − . the sbf was buffered at ph 7 . 4 with tris ( hydroxymethyl )- aminomethane and hcl . this in - vitro static deposition ( i . e . the sbf was not renewed during the deposition period ) at ˜ 24 ° c . produced good quality , dense 3 - 5 μm thick bm - ha film deposits on flat sg - ha substrates . the crystalline sg - ha ( c ) film is coated with dense bm - ha , whereas amorphous sg - ha ( a ) film is coated with porous bm - ha . the properties of the underlying sg - ha surface modification film can be used to vary the properties , e . g . porosity , of the nucleated and deposited top bm - ha film for drug encapsulation . stainless steel metallic stents ( 316l ) were coated with − 0 . 1 μm thin cap coatings as described in example 3 . an inorganic colloidal slurry containing calcium phosphate precursor ca ( oh ) 2 and calcium phosphate salt monocalcium phosphate anhydrate , was ball milled in ethanol . the two starting inorganic ingredients had particle size 0 . 3 - 2 μm and 0 . 5 - 4 μm , respectively . the initial ca / p ratio in the slurry was kept at 1 . 5 . as dissolution and precipitation are the principal mechanisms for apatite development in such system , 5 wt % of submicron , crystalline hydroxyapatite powder was used as seeds for heterogeneous nucleation of cpc - ha . the thin cap film surface - modified sample was dip coated in the ethanol suspension of the precursors . after single dip coating , an approximately 10 μm thick layer of porous precursor powder mixture developed on the substrate due to rapid evaporation of ethanol . due to the colloidal nature of the precursors slurry , this film develops sufficient structural integrity ( i . e . strength and hardness ) to accept the next processing step . in this step , the film is exposed to sodium phosphate water - based solution ( 0 . 25 m ), which is allowed to soak into the open pores of the film , and then placed in an incubator at 37 ° c ., 100 % relative humidity , for 24 h . during incubation , the colloidal precursors react with the phosphate liquid and precipitate ha . in order to assess the possibility of using this double - coating route for controlled drug release , amethopterin ( sigma chemicals , usa ) was employed as a model drug , in an amount of 5 % based on solid phase content of cpc - ha precursors . the drug was mixed with the colloidal suspension of the precursors , before dip coating was performed . during incubation period , 20 μm thick cpc - ha coating precipitated encapsulating the drug molecules within the nanopores of the crystallizing ha . after encapsulation , a drug release study was conducted by immersion of the substrates into 20 ml of phosphate buffer saline ( pbs , ph = 7 . 4 ) at constant ratio of ( cpc coating weight )/( volume of pbs ) of 1 mg / ml . a reference sample coated with hydrogel film was also tested for drug release kinetics . the hydrogel film was prepared by dipping the cpc - ha layer containing the drug into a polymer solution containing 3 % polyvinyl alcohol . after drying , the weight gain of the ˜ 20 mg cpc - ha layer due to the additional hydrogel coating was ˜ 0 . 5 mg , corresponding to the content of polymer film in the cpc - ha matrix of about 2 . 5 %. the samples of pbs liquid with released drug were periodically taken out ( i . e . entire liquid was emptied ) and refilled with the same amount of 20 ml of pbs . the drug concentration in the supernatant was determined via an uv - visible spectroscopy . although a burst effect was detected for both coatings over the initial period of about 8 h , a slower release is evident for the sample post - coated with hydrogel . a linear relationship was obtained between the amount of drug released and ( time ) 1 / 2 for the release time greater than 8 h . the stent was submerged into water - based , diluted suspension of sub - micron particles of hydroxyapatite , containing approximately 2 wt % of ha in the suspension . dc voltage of 5v was applied to the stent , for times varying from 5 seconds , to 10 minutes . as the particles of ha naturally attain positive charge in such solution , they are attracted to the stent surface which is also a negative electrode ( cathode ) in this system . the buildup of ha particles attracted to the stent ( cathode ) allows to produce an extremely uniformly coated surface , thickness of the coating varying as a function of time of application of voltage . the film uniformity is the biggest advantage of such electro - phoretic deposition ( epd ) processing , which is difficult to reproduce using other methods such as sol - gel processing . for the short time of 10 sec ., the epd - ha coating thickness is about 1 micrometer . this type of epd - ha coating on 316l stainless steel stent is illustrated in fig3 . for the longer times of several minutes , the coating thickness may exceed 10 micrometers . thus , in this epd process , a controlled thickness , uniform ha film may be produced . the as deposited film constitutes loosely bonded particles of ha , of porosity generally in excess of 50 vol %. in order to increase structural integrity and bonding strength to the substrate of such epd film , heat treatment is necessary at temperatures at least 500 ° c ., for times at least 10 minutes . the heat treatment of epd films proceeds at higher temperatures and longer times than sol - gel films , because ha particles deposited in the epd process are less reactive than those deposited in the sol - gel process . the goal of such heat treatment is to increase interparticle bonding , while providing sufficient residual porosity to maintain low stiffness and flexibility of the film , and to provide room for drug impregnation . the need for higher temperature and longer times heat treatment of epd films is a disadvantage , as the heat treatment process may adversely affect properties of the metallic substrate of the stent . the ha was deposited on a 316l stainless steel stent surface through epd process as described in the example 7 . the uniformly deposited epd film was heat treated at 500 ° c . for 10 minutes to achieve minimal structural integrity of the film , sufficient to survive handling and preventing re - fluxing of the film upon contact with liquid medium . such epd - coated stent was exposed to droplets of sol in the aero - sol - gel process described in example 3 . the sol droplets have penetrated open porosity of the epd film , and , by capillary attraction , located themselves mostly within negative curvature of the necks between epd deposited ha particles . such composite coating was heat treated again at 500 ° c . for 10 minutes . now the active sol - gel component of the coating allowed achieving high structural integrity of the film , while epd component of the coating allowed achieving high uniformity of coverage by the film . a uniform , porous ha film was achieved in this novel combined process . the electrochemical deposition ( ecd ) of hydroxyapatite ha has been conducted in the mixed aqueous solution of ca ( no 3 ) 2 4h 2 o and nh 4 — h 2 po 4 . in this process ha is deposited on the cathodic ( negatively biased ) surface of stent or implant by the following reaction : 10ca 2 + + 6po 4 3 − + 2oh → ca 10 ( po 4 ) 6 ( oh ) 2 ecd was conducted in the mixed aqueous solution of 0 . 02329 m ca ( no 3 ) 2 4h 2 o and 0 . 04347 m nh 4 h 2 po 4 . the stainless steel specimen , i . e . stent , was the cathode , and platinum was used as the anode . the ph was controlled at 4 . 0 with the addition of sodium hydroxide . the environment temperature was controlled at 40 ° c .± 1 ° c . the coating morphology deposited at low current density ( 1 ma / cm 2 ) was a thin uniform porous structure , 1 - 2 micrometers thick for deposition time of 0 . 5 - 1 minute , as illustrated in fig4 . the ha was deposited on a 316l stainless steel stent surface through asg - ha process as described in the example 4 . the discontinuous network of ha patches left some of the stent surface uncoated . 5v dc bias voltage was applied to such pre - coated stent , and the stent submerged into suspension of submicron ha particles . the uncoated metallic surface of the stent preferentially attracted ha particles leading to preferential electrophoretic deposition ( epd ) of ha in these areas , to build the coating about 1 micrometer thick in about 10 seconds . the coated stent was heat treated at 500 c for 10 minutes . the epd - ha coated areas show increased porosity as compared to asg - ha coated areas , suitable for impregnation with drug carrying liquid . such composite engineered ha coating shows unique properties regarding mechanical performance and drug release properties . the ha was deposited on a 316l stainless steel stent surface through asg - ha process as described in the example 3 , followed by the process of ecd - ha deposition as described in example 9 , but on top of the already heat treated asg - ha . such composite engineered coating allowed to achieve substantially higher bonding strength ( as compared to ecd - ha deposited directly on metallic surface ), and capability of drug encapsulation during deposition of ecd - ha on top of asg - ha . the ha was deposited on two 316l stainless steel stents surface through asg - ha process as described in the example 4 . the coated stents were evaluated in the standard thromboresistance test in dogs . minimal thrombosis with a grade of 1 ( defined as thrombus found at one location only ) was observed in one out of two test sites . in the second test site , no thrombosis ( grade 0 ) was observed . the process for coating of calcium phosphate , in particular ha , bioactive ceramics , on implantable medical devices disclosed herein offers the following advantages in comparison to other processes and other coating materials on implantable medical devices : ( 1 ) the coating process , including cap sol synthesis , can be completed in ambient environment ( i . e . air ), in less than 24 hours . ( 2 ) the thin (& lt ; 0 . 001 mm ) adhesive cap coatings exhibit sufficient flexibility to survive substantial strain , e . g . during crimping and expanding of a coated stent , without coating damage or spallation ( 3 ) porous cap coatings can be produced , with controlled amount and size of the pores , which allows design flexibility in choice and absorption / release characteristics for the drug impregnated into the coating ( 4 ) the synthesis requires low temperature (˜ 350 ° c .) and short time (& lt ; 1 hour ) of calcination for formation of high quality , highly adhesive cap coating . low temperature calcination of the novel cap coatings on metals permits thermal treatment in an air environment without the risk of metal oxidation and possible property degradation due to microstructural deterioration or phase transformations . it will be clear for the person skilled in the art of sol - gel processing that coating deposition parameters , such as time , the flow rate of the aerosol , temperature of the coating chamber or the concentration of the sol - gel solution can be customized for different implantable medical device materials and applications producing various degree of coverage on the surface . similar manipulation and optimization of process parameters may be applied to other coating methods disclosed , i . e . dip - and spin - coating and electrophoresis , biomimetic coating , electrochemical deposition coating , calcium phosphate cement coating , electrophoretic deposition coating , as well as coating porosity distribution and ratio of the inorganic phase ( cap ) to organic phase ( biodegradable polymer ). these parameters were optimized for the particular cap coatings on the implantable medical devices described in the foregoing examples . it is well known that crystallinity and microporosity of hydroxyapatite directly affects its dissolution rate in body fluids . different heat treatment regimes and temperatures can be adopted to produce various degrees of crystallinity and microporosity to control the degradation of the coating into the body environment . this advantage is of a great importance where drug delivery capabilities are added to the implantable medical device surface coated with sol - gel derived cap . similar deposition process can be applied to coating other metallic surfaces , such as ti substrates or other alloys , such as cobalt - chromium - nickel - molybdenum - iron . a thin uniform thin ha coating is obtained . the results of this experiment provide basic evidence of the feasibility of the as described coating on implantable medical devices composed of non - metallic materials such as polymers . the nature of the process for cap coatings deposition according to the invention is such that it can be easily incorporated into the current production practice of metallic implantable medical devices . the water - based liquid precursors to cap ceramic coatings , simple deposition technique ( e . g . dipping or spin - coating or aerosol deposition or electrophoretic deposition , and others ) and low - temperature heat treatment in air make the process not unlike simple painting - curing operation which can be commercialized with relatively small effort . as will be apparent to those skilled in the art in the light of the foregoing disclosure , many alterations and modifications are possible in the practice of this invention without departing from the scope thereof . accordingly , the scope of the invention is to be construed in accordance with the substance defined by the following claims .

this invention relates to novel calcium phosphate - coated implantable medical devices and processes of making same . the calcium - phosphate coatings are designed to minimize the immune response to the implant and can be used to store and release a medicinally active agent in a controlled manner . such coatings can be applied to any implantable medical devices and are useful for a number of medical procedures including balloon angioplasty in cardiovascular stenting , ureteral stenting and catheterisation . the calcium phosphate coatings can be applied to a substrate as one or more coatings by a sol - gel deposition process , an aerosol - gel deposition process , a biomimetic deposition process , a calcium phosphate cement deposition process , an electro - phoretic deposition process or an electrochemical deposition process . the coating can contain and elude a drug in an engineered manner .

preferred embodiments of the invention are illustrated and described in connection with a stapler for applying staples to an exterior wound or incision across a layer of skin , although the invention is not limited to such a surgical stapler . the embodiment of the stapler illustrated in fig1 - 9 comprises as depicted in fig1 a rear housing portion 10 and a front housing portion 11 . the front housing portion 11 is mounted to the rear housing position for rotation of the front housing portion about its longitudinal axis . the mechanism 12 for actuating the stapler is contained in the rear housing portion 11 . a slide 13 which advances a driver 15 is guided in the front housing portion 10 for longitudinal displacement but is prevented from rotating . the slide 13 comprises a forwardly projecting flexible tongue 14 which also cooperates with the driver 15 , as described more fully below . the driver 15 comprises an elongated rigid strip of material which is displaceable in its longitudinal direction in a channel or duct 16 . the strip has a central recess 17 ( fig4 ) at the forward end of which is disposed a bent - up section 18 having an enlarged head . a leaf spring 19 extends in the channel 16 substantially parallel to the driver 15 . the leaf spring 19 has an inclined surface 20 ( fig2 ) and is provided with a central slot 21 ( fig4 ) closed on all sides which extends forwardly and rearwardly of the region of the inclined surface 20 . the enlarged head of the bent section 18 of the driver 15 protrudes through the slot 21 and is pressed against the upper side of the leaf spring 19 . the forward end of the leaf spring 19 is bent downwardly to form the anvil surface 22 . the rear end of leaf spring 19 is fixed to the front housing portion 11 . when the driver 15 is in its retracted position , as depicted in fig2 the bent section 18 is positioned at the base of the inclined surface 20 . due to the inherent tension in the front region of the leaf spring 19 , the leaf spring positions itself in the channel 16 as depicted in fig2 . since the height of the channel 16 is greater than the height of the anvil 22 , there is a clearance between the anvil 22 in its retracted position and the lower region 16 &# 39 ; at the front of the channel 16 . a staple magazine 26 ( fig1 and 6 ) extends parallel to the channel 16 in the front housing portion 11 . staples 24 are arranged in the magazine standing upright side by side and extending along the feed passage of the magazine parallel to the channel 16 . a helical spring 25 braced against the housing contacts the rearmost staple and urges the rearmost staple and with it the entire stack of staples forward under constant tension . the forward section 26 &# 39 ; of the staple magazine 26 is curved upwardly at an angle of 90 ° and opens into the channel 16 . the staples are urged into the curved section 26 &# 39 ; of the magazine and extend along the arc of the curve as depicted in fig6 with the forwardmost staple 24 &# 39 ; being disposed lying flat in the channel 16 . the lower region 16 &# 39 ; in the forward portion of the channel 16 in which the leaf spring 19 can move vertically is of greater width than the region above it . the height of the wider , lower channel portion 16 &# 39 ; is only slightly greater than the thickness of the staples 24 so that channel portion 16 &# 39 ; forms a guide channel for the advance of the forwardmost staple 24 &# 39 ; and for the driver 15 . this guide channel is defined by the lower guide face 16a , the two upper guide faces 16b , ( fig6 ), and by the lateral guide faces 16c ( fig4 ). the staples 24 , whose undeformed configuration is depicted in broken lines by the staple 24 &# 39 ; in fig5 have arcuate side portions 24a connected via a straight leg region 24b to a central base or crown portion 24c . the straight leg regions 24b extend obliquely outwardly from the base portion to the side portions 24a . the base portion 24c is semicircular with the circumference of the semicircle facing in the direction of the side portions . the base portion is engaged by the anvil surface 22 during forward motion of the staple . in order to insure centering of the staple 24 , the anvil surface 22 is provided with a vertical slot 22 &# 39 ;. in the arcuate section 26 &# 39 ; of the staple magazine 26 , the side portions 24a of adjacent staples 24 are spaced apart while the straight leg regions 24b are in contact with adjacent leg regions due to the difference in radii of the curves for the upper and lower surfaces of the arcuate section 26 &# 39 ;. thus , the force of the spring 25 can be transmitted through the staples in the arcuate section 26 &# 39 ; to the forwardmost staple 24 &# 39 ;. at the opening 27 ( fig5 ) of the magazine 26 into the channel 16 , the underside of the upper guide face 16b is embossed ( not shown ) to hold the forwardmost staple 24 &# 39 ; in a well - defined position . as the driver 15 is advanced from retracted position shown in fig2 ; its front end abuts the forwardmost staple 24 &# 39 ; and pushes it forward in the channel section 16 &# 39 ;. at the same time , the bent section 18 moves along the inclined surface 20 of the leaf spring 19 so that the anvil surface 22 at the forward end of the leaf spring is brought from its retracted position into the operative position shown in fig3 . the staple designated 24 &# 34 ; in fig3 and 4 is now situated between the forward end of driver 15 and the anvil surface 22 in a position in which the tips of the staple side portions protrude slightly forwardly from the instrument . as the driver 15 is advanced further , the staple side portions emerge from the front end of the instrument , with staple 24 &# 34 ; being deformed and closed to the solid line configuration depicted in fig5 in which the base 24c of the staple has been bent flat on the inner side of the anvil surface 22 . to obtain as long a guide path as possible during deformation of staple 24 &# 34 ;, the guide faces 16a , 16b and 16c extend into projections 28 which define the exit gap of channel 16 out of the housing and which protrude slightly beyond the anvil surface 22 . as soon as the driver 15 has carried the forwardmost staple 24 &# 39 ; away from the opening 27 of the magazine into the channel , the opening 27 is closed by the driver so that the next staple cannot be advanced into the channel 16 . the next staple can only be advanced into the channel after the driver 15 has returned to its retracted position where it is clear of the opening 27 . fig7 - 9 illustrate control of the driver 15 by the slide 13 . slide 13 , which is supported to the front housing portion 11 for longitudinal displacement but is prevented from rotating , comprises at its forward end a forwardly projecting , flexible tongue 14 which is vertically springloaded . a laterally projecting guide wing or cam surface 30 is disposed at the end of the tongue 14 and cooperates with a control cam 31 fixed to the housing portion 11 . when the slide 13 is advanced by the actuating mechanism 12 , its front face strikes driver 15 , pushing it in the direction of the tool tip . a bevel formed on wing 30 causes wing 30 to abut on a rearward bevel of the control cam 31 . the tongue 14 then flexes upwardly and wing 30 slides on the upper cam surface 32 . if the slide 13 is retracted before its forward end position is reached corresponding to the operating position of the driver , the wing 30 slides back on to the upper cam surface 32 , which maintains the slide and correspondingly the driver in the advanced position they assumed . only after the slide 13 reaches the position shown in fig8 and the wing 30 has gone beyond the front end of the control cam 31 is the stamping operating completed and staple 24 &# 34 ; closed . as the slide 13 is thereafter being moved back , the rear surface of the wing 30 , which is inclined , contacts the correspondingly inclined forward surface of the control cam 31 . as a result , the tongue 14 is forced downward , and a projection of the tongue 14 enters into the slot 17 of the driver 15 . as the slide 13 is further retracted , the wing 30 is pulled beneath the control cam 31 , and the driver 15 is drawn rearward . referring to fig7 after the wing 30 has passed along the underside of the control cam 31 , the tongue 14 springs upward , releasing the driver 15 at its starting position . until the driver 15 is pulled back to its starting position , it does not clear the opening 27 of the staple magazine 26 into the channel 16 . fig1 depicts an embodiment in which a counting mechanism 33 is secured to the front housing portion 11 . the counting mechanism is stepped by movement of the tongue 14 of the slide 13 . the counting mechanism 33 comprises a hollow cylinder 34 fixed in the housing portion 11 in which is rotatably mounted a cylinder 35 having ratchet teeth 36 disposed about the periphery of the lower end thereof . a projection 37 disposed at the front end of tongue 14 engages the teeth 36 when the wing 30 is raised by the guide cam 31 during a feed movement . in this manner the cylinder 35 is rotated towards the forward end of the instrument by a predetermined angle with each feed movement of the driver 15 . the top of the cylinder 35 is provided with a mark and the periphery of the hollow cylinder 34 is provided with a scale so that the mark indicates on the scale the number of staples 24 remaining in the magazine 26 . at the rear end of the front housing portion 11 is disposed a cylindrical bushing 40 ( fig1 ) in which slide 13 is coaxially mounted . the cylindrical bushing 40 can be removed from the rear housing portion 10 so that the magazine can be loaded with staples . the rear end of the slide 13 is coupled to a part 39 slidably movable along a track 42 in the interior of the rear housing portion 10 . the sliding part 39 includes a sleeve 43 disposed about a shank 44 of the slide 13 which is bounded on both sides by flanges . the sliding part 39 is provided with a rack 45 having teeth or serrations which are engaged by corresponding serrations on a toothed disc segment 46 . the toothed disc segment 46 forms one lever arm of a two - armed lever which pivots about a pivot pin 47 in the housing portion 10 . the other lever arm 48 is engaged by a pin 49 disposed in a transverse slot 50 of a trigger lever 51 . the trigger 51 is guided in a recess 52 of the handle 53 extending approximately parallel to channel 16 , and is urged outwardly of the handle by a spring 54 . trigger 51 is dimensioned so that it can be actuated with the index finger when the handle 53 is gripped . the trigger , upon being pushed into the handle 53 , causes the lever 46 , 48 to be pivoted about the pivot pin 47 so that the sliding part 39 is advanced forwardly , and with it slide 13 . near the end position of the lever 46 , 48 where it extends almost at right angles with the slide 13 , leverage is the greatest , and corresponds to the stamping action of the driver . thus , for a constant actuating force , the maximum force applied to the driver occurs during stamping . an actuating mechanism 12 &# 39 ; similar to mechanism 12 of fig1 is illustrated in fig1 and 12 . fig1 depicts the retracted position of the slide 13 and fig1 its advanced position . spring 54 urges the trigger 51 out of the handle 53 and at the same time brings the sliding part 39 , and with it the slide 13 , into the retracted position . in the embodiment of fig1 the transverse slot 50 of the trigger 51 has an angular shape , while in the embodiment of fig1 and 12 , the transverse slot 50 is straight . certain changes and modifications of the embodiments of the invention disclosed herein will be readily apparent to those skilled in the art . it is the applicants &# 39 ; intention to cover by their claims all those changes and modifications which could be made to the embodiments of the invention herein chosen for the purpose of disclosure without department from the spirit and scope of the invention .

a stapler , particularly for suturing skin wounds or incisions , is disclosed which comprises a channel in which a driver is advanced by a slide in the direction of an anvil surface . a staple magazine which extends substantially parallel with the driver includes a curved section which opens into the channel to deliver staples into the channel for engagement by the driver . during forward displacement of the driver , a projection on the driver presses a leaf spring to which the anvil surface is connected . the anvil surface at the forward end of the leaf spring is thereby brought into its operating position and is automatically moved back into its retracted position upon release of the spring after the driver is retracted . the curved section in the staple magazine enables the stapler to have a slim profile which does not obscure the working area during a stapling operation . after completion of a stapling operation , the anvil surface is automatically retracted from a closed , implanted staple .

embodiments of the present invention provide ngcs with integrated spiral structured porous sheets decorated with surface channels and electrospun fibers . such ngcs provide superior mechanical strength compared to ngcs in the prior art , along with integrated multiple channels , stable aligned fibrous layers , good inter - cell communication , and high surface / volume ratios within the ngcs . chambers at the distal and proximal ends of the ngc provide additional space for fitting nerve stumps in order to reduce the tension at the suture line between the ngc and the nerve stump . a dense outer fibrous tube on the outside of the spiral structured porous sheet can prevent the infiltration of scar tissue while the regeneration process takes place . one embodiment of the ngc of the present invention comprises a three - dimensional ( 3 - d ) spiral structured porous sheet having two chambers at the ends thereof . the spiral structure includes a highly porous polycaprolactone ( pcl ) sheet , which may be formed as a spiral - wound sheet using known methods and decorated with surface channels on a surface of the spiral wound sheet , coated with a thin layer of aligned electrospun fibers on the surface channels , and a dense randomly - oriented fibrous tube on the outside of the ngc . other bioresorbable materials known for use in the biomedical arts may be used in place of pcl for the sheet and fibers ( e . g ., collagen / pcl blends for the fibers ). other embodiments of the present invention provide a process for fabricating an implantable ngc , such as the embodiment of an ngc described above , which can be used as a medical device for facilitating the repair and regeneration of nerve tissues . several features of ngcs according to embodiments of the present invention are discussed herein below . 1 . three - dimensional ( 3 - d ) integrated spiral structured porous sheet with proximal and distal reserved chambers collagen tubes , which have been approved by the fda , lack sufficient mechanical strength to support nerve regeneration . as for multi - channel ngcs , the major drawback is that cells / axons in each channel do not interact well with those in the other channels , which adversely affects nerve regeneration and would affect nerve function recovery even if the nerve gap were bridged . in comparison , the integrated spiral structure makes the ngc of the present invention superior to those in the prior art in that mechanical properties are greatly improved and favorable for inter - cellular interaction and neural myelination . this is important for nerve regeneration because of the time required for nerve regeneration to bridge large nerve gaps . further , a ngc should have enough mechanical strength to provide structural support to the nerve during regeneration . also , the proximal and distal chambers in the ends of the ngc provide an optimal initial environment for nerve ingrowth . these chambers can prevent stress from accruing when the nerve tissue is sutured with the conduit in an end - to - end fashion . moreover , the increased surface / volume ratio and the highly porous intermediate layers of the pcl sheet are preferred for cell attachment and nutrient transportation during nerve regeneration . 2 . decorated surface channels on the spiral porous sheet with additional electrospun aligned fibers and and an outer fibrous tube electrospinning is an approach for polymer biomaterial processing that provides an opportunity to control morphology , porosity and composition of an ngc using relatively unsophisticated equipment . unlike conventional fiber spinning processes that produce fibers with diameters in the micrometer range , electrospinning is capable of producing fibers in the nanometer diameter range , which are typically deposited in the form of nonwoven fabrics . nanofibers provide a connection between the nanoscale and the macroscale world , since , although their diameters are in the nanometer range , the fibers are very long , sometimes having lengths of the order of kilometers . a major problem of all hollow tubes is misdirection of cellular migration : since transected axons produce axon sprouts proceeding in a distal direction , a neuroma is always formed which consists of minifascicles proceeding in an abnormal manner , proliferating schwann cells ( scs ), fibroblasts and capillaries . if there is a directional factor of any kind ( e . g ., an artificial nerve tube which usually provides no endoneurial structure ), the neuroma proceeds in the desired direction . this phenomenon has been called “ neuromateous neurotization ”. in consequence , only a few dispersed axons are able to enter the right fascicle and endoneurial tube in the distal nerve stump once they have reached the end of the conduit in the interior of the ngc . one successful tissue engineering strategy for nerve repair is to create aligned features on the conduit to provide guidance for cell migration and directional axonal regeneration across the glial scar and lesion site in both central nervous system and peripheral nervous system injuries . such features may include aligned surface channels and electrospun fiber - based conduits for nerve repair , according to embodiments of the present invention . consequently , the construction of a spiral structure conduit with highly aligned surface channels and nano - fibers is very helpful for nerve proliferation and neurite extension . meanwhile , the intricate aligned structure can also influence the growth and distribution of seeded scs , which further directs the longitudinal extension of the neural axons . further , there is a wide range of polymers available that are suitable for deposition on the spiral sheet to meet the individualized specifications for the ngc ( e . g ., collagen / pcl copolymer nanofibers , rather than pure pcl sheets ). fibers spun along the outside of the ngc not only assist in stabilizing the spiral structure , but also inhibit infiltration of scar tissue through the inter - connective pores . by increasing the mechanical strength of the ngc , the risk of structural failure can be minimized , promoting more uniform and natural regeneration of nerve tissue . in order to solve the conflict between optimizing the mechanical properties of the ngc and maximizing its length , many techniques may be used to reinforce the ngc . in a method according to an embodiment of the present invention , a spiral conduit ( e . g ., a spiral structured porous sheet ) is placed onto a rotator and a nanofiber is spun in random orientations along the spiral structure to form an outer fibrous tube . the thickness of the outer fibrous tube can be controlled . this dense layer of randomly - oriented fibers deposited on the outside of the spiral conduit can improve the mechanical properties of the entire structure , and meanwhile provide a stable structural support during nerve regeneration . in a method according to an embodiment of the present invention , depositing the outside layer of fibers on the spiral conduit is the final and separate step of fabricating the ngc , so it is practical to modify the polymers used to form the fibers before the electrospinning step . the outer fibrous tube can be made from polymers that are different from that of the spiral sheet or the aligned fibers . in another aspect , the process of the present invention is tunable in that the sizes of the spiral conduit are controllable , and both the length and the outside diameter are dependent on the size of the spiral - wound sheet . therefore , in order to fabricate a spiral conduit with a particular size , ( e . g ., a length larger than 15 mm , which is the maximum length of nerve regeneration achieved with silicone tubes in rats ), it is only necessary to cut a polymer sheet to the appropriate size . fig1 is a schematic illustration in cutaway view of a nerve guidance conduit ( ngc ) 10 according to an embodiment of the present invention bridging the stumps 12 , 14 of damaged nerve 16 . the stumps 12 , 14 are received in reserved chambers 18 , 20 at the proximal and distal ends 22 , 24 of the ngc 10 , and held in place with sutures 26 , 28 , or by other means known in the art . the reserved chambers 18 , 20 allow the nerve stumps 12 , 14 to be placed in the ngc 10 and sutured without tension by housing the nerve stumps 12 , 14 in place with an optimal grip . fig2 is a schematic cross - sectional view of the ngc 10 showing that the ngc 10 includes an outer fibrous tube 30 surrounding one or more spiral wound sheets 32 the fibrous tube 30 includes a dense structure of randomly oriented polymer fibers ( not shown ). the spiral wound sheets 32 define a lumen 34 inside the ngc 10 . the lumen 34 is bounded by an inner surface 36 of the spiral wound sheets 32 . the ngc 10 further includes an integrated guidance spiral 38 having a plurality of surface channels 40 . the guidance spiral 38 is are composed of multiple layers ( e . g ., layers 42 , 44 ), and together define a spiral guidance channel 46 within the lumen 34 . in some embodiments of the present invention , the surface channels 40 are arranged such that they are substantially parallel to each other and to a longitudinal axis ( not shown ) of the ngc 10 . the layers 42 , 44 may be extensions of the spiral - wound sheets 32 , or may be formed separately therefrom , then integrated with the spiral - wound sheets 32 . the plurality of surface channels 40 increases the surface area of the guidance spiral 38 that is available for cell migration and may reduce the length of time needed for nerve regeneration . additionally , the integrated layers 42 , 44 may reduce the wear and tear that can occur in ngcs known in the art . such wear and tear is often observed with single lumen tubular ngcs . in some embodiments of the present invention , a highly aligned orientation of electrospun nanofibers ( not shown ) are provided as coats on the surface channels 40 , and on both layers 42 , 44 of the spiral sheet 38 , and dense randomly - oriented fibers are provided on an outer surface 48 of the ngc 10 , which greatly improves the mechanical properties of the ngc 10 , as discussed above . in some embodiments , the aligned fibers are substantially parallel to each other . in some embodiments , the aligned fibers are substantially parallel to a longitudinal axis of the ngc 10 . the presence of aligned fibers ensures that all areas of the regenerating axon will come into contact with aligned fibers . the ngc 10 is tunable such that its size can be varied in a controlled fashion depending on how it is to be used . the length and the outer diameter of the ngc 10 are dependent on the size of guidance spiral 38 . an ngc 10 according to the present invention may have any length , thus enabling it to be used to repair long gaps in the axon for the repair or regeneration of peripheral nerves . fig3 and 4 are scanning electromicrograph ( sem ) images a first side and a second side opposite the first side of a portion of a porous polymeric sheet 50 of a type that may be used to fabricate the spiral - wound sheets 32 or guidance spiral 38 of an ngc of the same type as ngc 10 , before the application of electrospun nanofibers . interconnected pores ( e . g ., pores 52 ) are present throughout the polymeric sheet 50 . fig5 is an sem image of a porous polymeric sheet 54 of the same type as polymeric sheet 50 , showing aligned nanofibers 56 that have been deposited on the polymeric sheet 54 by electrospinning . fig6 is an sem image of a porous polymeric sheet 58 of the same type as polymeric sheets 50 , 54 showing randomly - distributed nanofibers 60 that have been deposited on the polymeric sheet 58 by electrospinning . fig7 - 9 are stereomicroscopic images of an ngc 62 according to an embodiment of the present invention . ngc 62 is of the same general type as the ngc 10 discussed with respect to fig1 and 2 . fig7 is an image of the intact ngc 62 showing its outer fibrous tube 64 . fig8 is an image of the interior of the ngc 62 after it has been cut lengthwise , showing an interior surface 66 of the outer fibrous tube 64 , the guidance spiral 66 , and the reserved chambers 68 , 70 . fig9 is an end view of the ngc 62 showing the outer spiral wall 64 , the guidance spiral 66 and the channels 72 of the guidance spiral 66 . fig1 is a sem image of a portion of polymer sheet 74 , which is of a type for making an ngc according to an embodiment of the present invention , showing the substantially parallel alignment of channels 76 , which are separated by ridges 78 . in a method of fabricating an ngc according to an embodiment of the present invention , a polycaprolactone ( pcl ) sheet was fabricated using a combination of the solvent evaporation method and the salt - leaching method . an 8 % ( w / v ) pcl solution was poured onto a glass petri dish , and acupuncture needles having a diameter of 150 μm were placed on top of the pcl solution to form multi - channels having widths of about 180 μm . the dish was moved to a hood to let it air dry . after an hour , the resulting pcl sheet was immersed into deionized water so that the salt was dissolved , producing pores in the pcl sheet . the needles were also removed , having formed multi - channels on the pcl sheet with widths of about 180 μm . after 30 minutes , the pcl sheet was taken out and dried on a paper towel . subsequently , 2 hours later , the fully dried pcl sheet was cut into a rectangular shape having dimensions of about 12 mm by 10 . 5 mm to bridge a 10 mm nerve gap in an animal study . referring to fig1 , in an exemplary embodiment of the method , the cut pcl sheet 80 had opposite longer edges 82 , 84 ( i . e ., the 12 mm edges ), and opposite shorter edges 86 , 88 ( i . e ., the 10 . 5 mm edges ). it may be noted that the channels 90 are substantially parallel to the longer edges 82 , 84 . two rectangular areas 92 , 94 were cut out from the opposite corners 96 , 98 of the edge 82 , such that edge 82 was then shorter than edge 84 . pcl aligned nanofibers were spun on the cut pcl sheet 80 using a conductible rotation disk method known in the art . a 16 % ( w / v ) solution of pcl in 1 , 1 , 1 , 3 , 3 , 3 hexafluoroisopropanol ( hfip ) ( oakwood products , inc ) was prepared for electrospinning . aligned fibers were deposited on the 12 mm × 10 . 5 mm pcl sheet longitudinally on the edge of the rotating disk such that the fibers were substantially parallel to channels 90 . the fibers were deposited such that they would be substantially longer than the cut pcl sheet 80 . the sheet was carefully removed from the disk to ensure the fibers deposited remained aligned . the excess lengths of fiber ( i . e ., the portions of the fibers that extended beyond the edges of the cut pcl sheet 80 were collected and folded onto the back of the cut pcl sheet 80 . turning back to fig1 , the cut pcl sheet 80 with the aligned nanofibers thereon was then wound in a spiral fashion from the edge 82 to the edge 84 , such that the edge 82 was in the interior of the resulting spiral ngc and the channels 90 were substantially parallel to a longitudinal axis of the spiral ngc . in the spiral ngc , the cutaway areas 92 , 94 become reserved chambers ( e . g . reserved chambers 68 , 70 of spiral ngc 64 of fig7 - 9 , or reserved chambers 18 , 20 of spiral ngc 10 of fig1 ). random nanofibers were then spun onto the outside of the spiral ngc to form an outer fibrous tube on the spiral ngc . the thickness of the outer fibrous tube was approximately 150 μm . the outer fibrous tube is intended to secure the entire spiral structure , enhance the mechanical strength , and prevent tissue infiltration during nerve regeneration . the resulting spiral ngc with its outer fibrous tube was 1 . 8 mm in diameter and 12 mm in length , suitable for bridging a 10 mm nerve gap . fig1 is a plot of stress versus strain for several ngcs fabricated according to a method of the present invention : an outer fiber tube comprising a dense layer of randomly - oriented nanofibers ; the outer fiber tube with a spiral sheet therein , and the outer fiber tube with the spiral sheet and aligned nanofibers (“ af ”). the following tensile properties were measured : young &# 39 ; s modulus , percent elongation to failure , and tensile strength of the different ngcs . the young &# 39 ; s modulus , calculated through the stress - strain curve shown fig1 , ranged between 0 . 262 - 0 . 7625 mpa . all three of the ngcs yielded a young &# 39 ; s modulus that can stand force stretching and be applicable for in vivo use . the values reported for the outer fibrous tube and the other ngcs all in a useful range for use in nerve regeneration and repair . high tensile strength will provide a mechanically strong ngc that can be sutured well during coaptation of the nerve stump and ngc , and preserve the suture after surgery . the measured physical properties of the ngcs of fig1 are summarized in table 1 , below . the measured porosity values for the outer fibrous tube ( hereinafter , ngc - t ), outer fibrous tube + spiral ( hereinafter , ngc - t - s ), and outer fibrous tube + spiral + af ( hereinafter , ngc - t - s - af ) were respectively 71 . 98 ± 1 . 22 %, 75 . 01 ± 2 . 69 %, and 78 . 41 ± 3 . 64 %. the differences in porosities for these three types of ngcs are not statistically significant ( p & lt ; 0 . 05 ). schwann cells were adopted as the model for evaluation of cellular response on the fiber - based spiral ngcs . at day 4 , ngc - t - s - af showed significantly greater cell proliferation than ngc - t and ngc - t - s . the cell numbers for each type of ngc are shown in fig1 . the degrees of cell proliferation for the ngc - t and ngc - t - s are significantly lower ( p & lt ; 0 . 05 ) than for the ngc - t - s - af . the ngcs were tested in a 10 mm sprague dawley ( sd ) rat sciatic nerve defect to evaluate the effect of nanofibers on peripheral nerve regeneration through porous spiral ngcs . the sciatic nerve of each rat was cut , then bridged with one of the ngcs . one group received an autograft rather than a ngc . one group received no grafts . all rats were in good condition during the survival weeks . there were no obvious signs of systemic or regional inflammation and surgical complications after implantation the recovery of motor function was assessed based on the walking track evaluation referring to fig1 , normal sciatic functional index ( sfi ) value of − 9 . 4 ± 1 . 4 was measured from all healthy rats ( n = 30 ) before surgery . all experimental animals had decreased sfi of values between − 85 . 6 and − 94 . 5 ( n = 30 ) by week 2 after surgery . during the initial 4 weeks , there was no significant improvement in any of the groups . at 6 weeks after surgery , the overall sfi reached the levels between − 72 . 2 and − 91 . 7 , which was equivalent to an improvement of 2 . 8 - 13 . 4 index points from week 2 . each group &# 39 ; s 6 - week sfi value was recorded as follows : autograft (− 72 . 2 ± 6 . 6 ), t - s - af (− 81 . 5 ± 3 . 2 ), t - s (− 88 . 4 ± 4 . 9 ), and t (− 91 . 7 ± 4 . 2 ). the autograft sfi revealed a significant difference ( p & lt ; 0 . 05 ) as compared to the t - s and t groups . the sfi in the t - s - af group was significantly higher than for the t groups ( p & lt ; 0 . 05 ). functional recovery was further evaluated with electrophysiological assessment to determine whether functional recovery occurred through the ngcs . six weeks post - surgery , compound muscle action potentials ( cmap ) were evoked by stimulation at the surgical limbs and recorded from gastrocnemius muscle following by measurements of amplitude and nerve conduction velocity ( ncv ). signals were absent and no muscle contractions were observed in the non - grafted group . referring to fig1 , for the amplitude measurements , each group &# 39 ; s value was recorded as follows : autograft ( 5 . 25 ± 1 . 51 mv ), t - s - af ( 4 . 96 ± 1 . 58 mv ), t - s ( 3 . 6 ± 1 . 39 mv ), and t ( 2 . 0 ± 0 . 64 my ). significant differences in amplitude were observed in the t group as compared to the autograft and t - s - af groups ( p & lt ; 0 . 05 ). however , the difference between the autograft , t - s - af , and t - s groups ( p & gt ; 0 . 05 ) was not statistically significant . similar results were found in ncv measurement : autograft ( 31 . 57 ± 4 . 13 m / s ), t - s - af ( 26 . 47 ± 6 . 87 m / s ), t - s ( 18 . 28 ± 4 . 16 m / s ), and t ( 13 . 3 ± 5 . 65 m / s ) ( see fig1 ). significant differences in ncv were observed in the autograft group as compared to the t - s and t groups ( p & lt ; 0 . 05 ). the ncv result in the t group also showed a significant difference as compared to autograft and t - s - af groups ( p & lt ; 0 . 05 ). however , there were no significant differences when the ncv values of the autograft group were compared to those of the t - s - af group , which may indicate that nanofibers can accelerate the level of muscle reinnervation as well as autograft . after 6 weeks post - surgery , the distal nerve segment from each group was explored and carefully isolated from the surrounding tissues . a pinch reflex test was performed distally . a reflex movement of the back muscles indicates that the sensory fibers are positively regenerated through the ngcs , while no movement was considered as lack of sensory fibers in the ngcs . the results are presented in table 2 , below . further histological evaluations of nerve regeneration behavior with ngcs were investigated under a light microscope . the results clearly demonstrated the potential of the ngcs of the present invention to house a large number of supportive cells , both with and without nanofibers to enhance the surface area of the channel . the ngcs possessed durable mechanical strength to support the entire regeneration process . low magnifications of micrographs showed that neural tissues , including myelinated axons and myelin sheath , were all successfully presented among the groups . angiogenesis occurred through which new blood vessels were formed during the nerve regeneration process . normal axons were nearly all surrounded by uniform thicknesses of myelin sheaths and presented large fiber diameters . nevertheless , the studied groups presented premature morphologies ( i . e ., diverse nerve fiber sizes and thinner myelin sheaths ). quantitative analysis of the total occupied neural tissue coverage in the ngcs compared to those of normal rat nerves ( 70 . 57 ± 3 . 81 %) further confirmed the above findings . referring to fig1 , each group &# 39 ; s value was recorded as follow : autograft ( 29 . 29 ± 4 . 61 %), t - s - af ( 26 . 52 ± 3 . 77 %), t - s ( 17 . 37 ± 2 . 97 %), and t ( 5 . 88 ± 1 . 43 %). no significant differences were found among autograft and t - s - af groups . however , the area occupied by neural tissue in t - s group showed significantly lower values than the autograft , and t - s - af groups . high significance was observed in the t group as compared to the other groups ( p & lt ; 0 . 01 ). finally , it should be noted that the cross - sectional micrograph of t group was covered with a large white area . that implied the single lumen repair limited the nerve regeneration . when severe nerve injury occurs , the muscle is denervated and the balance of muscle metabolism could be shifted from protein synthesis toward protein degradation . as a consequence , the target muscle presents a decreased muscle cell size , muscle weight loss , hyperplasia of connective tissues , and new blood vessel formation . to evaluate the reinnervation of the gastrocnemius muscle , masson trichrome staining was applied to the section followed by measurements of muscle weight ratio , diameter of muscle fibers , and muscle fiber coverage per cross section . referring to fig1 , for comparisons of muscle weight ratio , each group &# 39 ; s value was recorded as follows : autograft ( 39 . 73 ± 4 . 19 %), t - s - af ( 25 . 64 ± 3 . 01 %), t - s ( 22 . 31 ± 2 . 18 %), and t ( 19 . 2 ± 2 . 03 %). the muscle weight ratio of the autograft group was greater than that of the other groups by a statistically significant amount ( p & lt ; 0 . 05 ). however , there were no significant differences between the t - s - af and t - s groups ( p & gt ; 0 . 05 ). the t group revealed a significant lower ratio than the t - s - af group . referring to fig1 , for comparisons of muscle fiber diameter , each group &# 39 ; s value was recorded as follows : autograft ( 34 . 62 ± 1 . 05 μm ), t - s - af ( 31 . 81 ± 2 . 18 μm ), t - s ( 25 . 5 ± 6 μm ), and t ( 21 . 56 ± 2 . 98 μm ). although the autograft group showed a significant difference from the t - s and t groups , it was not significantly higher than the t - s - af group . also , there were no significant differences between the t - s and t groups ( p & gt ; 0 . 05 ). further findings showed that the value for the t group was significantly lower than that for the autograft , and t - s - af groups . referring to fig2 , for comparisons of muscle fiber coverage , each group &# 39 ; s value was recorded as follows : autograft ( 96 . 84 ± 4 . 1 %), t - s - af ( 93 . 72 ± 4 . 63 %), t - s ( 86 . 99 ± 10 . 31 %), and t ( 58 . 42 ± 4 . 69 %). there were no significant differences between the values for the autograft , t - s - af , and t - s groups ( p & gt ; 0 . 05 ); however , they were all significantly greater than the value for the t group ( p & lt ; 0 . 05 ). from qualitative analyses and histological observations discussed above , spiral ngcs of the present invention , with or without nanofibers , revealed the potential to prevent muscle atrophy as well as the effect of autograft . both the surface channels and the aligned fibers provide good topographical cues for nerve regeneration , and thus allow muscle reinnervation faster than single lumen ngcs , thus suggesting that the surface channels and nanofibers further assisted ngc structures in promoting nerve regeneration . it should be understood that the embodiments described herein are merely exemplary in nature and that a person skilled in the art may make many variations and modifications thereto without departing from the scope of the present invention . all such variations and modifications , including those discussed above , are intended to be included within the scope of the invention , as defined by the appended claims .

a nerve guidance conduit includes a spiral structured porous sheet decorated with channels on its surface and electrospun nanofibers in a parallel alignment with the channels and an outer tubular structure including randomly - oriented nanofibers . such a structure provides augmented surface areas for providing directional guidance and augmented surfaces for enhancing and peripheral nerve regeneration . the structure also has the mechanical and nutrient transport requirements required over long regeneration periods . to prepare a nerve guidance conduit , porous polymer sheet is prepared by a solvent casting method while using a template of thin rods to form parallel channels on a surface of the sheet . aligned nanofibers are deposited on the sheet parallel to the channels . the polymer sheet is then wound to form a spiral structure . a dense layer of randomly - oriented nanofibers may be deposited on the outside of the spiral .

referring now to the drawings , and particularly to fig1 and 2 , a portion of the back end of a furniture seat base is illustrated generally at 10 . the seat base 10 comprises spring band assemblies 15 , only one of which is shown , extending in parallel relationship between the front rail ( not shown ) and back rail 16 of the base frame . each assembly 15 includes a normally arced sinuous spring band 20 of standard loop size ; i . e ., a seven - eighths ( 2 / 3 ) inch interval between linear segments 25 and semi - circular segments 26 of the band . each band 20 is connected to the back frame rail 16 by a first form of rail connector 30 embodying features of the invention . the rail connector 30 is fabricated of eleven ( 11 ) gauge wire , similar to standard helicals . it comprises a section 35 of three coils tightly wound on an axis transverse to that of the band 20 and the axis of expansion and contraction of the connector 30 . extending from the coil section 35 , at their uppermost extremity , tangent to the arc of the coils and in opposite directions , are a rail - attachment leg 38 and a spring - attachment leg 39 . the rail - attachment leg 38 terminates in a transversely disposed anchor section 40 which seats in a conventional &# 34 ; g &# 34 ; clip 41 , while the spring - attachment leg 39 seats on and grips the spring band 20 . the spring attachment leg 39 is inclined slightly upwardly from the horizontal , in contrast to the rail - attachment leg 38 , and includes an upwardly formed shoulder 45 and a terminal hook 46 . the shoulder is formed approximately mid - way between the hook 46 and tangency with the coil 35 , seven - eighths ( 2 / 3 ) inches each way in the case where the band 20 is regular sinuous . as seen best in fig1 the downwardly opening hook 46 is designed to seat over the penultimate linear segment 25b in the spring band 20 , while the ultimate linear segment 25a seats against the shoulder 45 . the result is to lock the end of the band 20 and the connector 30 together . in operation , the attachment - arm 39 reaching up into the band 20 sets up a torsioning effect in the back of the band . the arm 39 is spring loaded upwardly by the strength of the coil section 35 and produces dynamic uplift . at the same time the coil section 35 permits of longitudinal expansion - contraction of the connector 30 . the coil section 35 and rail - attachment leg 38 extending outwardly of the band 20 end amplify the leverage induced torque . in an alternative construction of the first form of the invention , as seen in fig3 the rail connector 130 is attached to the rail 116 through a gang bore 142 . the rail - attachment leg 138 of the connector has a shorter anchor section 140 which can pass through the bore 142 from front to back of the rail 116 and then seats against the back of the rail to lock the connector 130 to the rail . the spring - attachment leg 139 in this form of the connector is much shorter and has an upwardly formed hook 146 at its inner end . the hook 146 is so formed that when it seats upwardly , onto the ultimate linear segment 125a of the spring band 120 , it cannot slip off during seat base operation . the connector 130 provides both dynamic uplift and resilient expansion - contraction at the band end . it does not induce torsion or leverage amplification . the connector 130 can also be connected to the ultimate linear segment 125a of the band 120 by a conventional vle clip , as seen at 150 in fig4 . as such , the single spring attachment leg 139 obtains a wider purchase area on the band 120 end . the effect is to enhance lateral stability of the spring band assembly . turning now to fig5 a modified coil section for a connector otherwise identical to that hereinbefore discussed is illustrated at 235 . as illustrated , the coil section 235 is tightly wound in five ( 5 ) coils on an axis longitudinally aligned with the sinuous spring band span ( not shown ). this form of the connector 130 produces the same salutary effects , the dynamic uplift being produced by a torquing expansion - contraction of the coil section 235 in contrast to the loop compression - expansion of the coil section 35 , however . fig6 and 7 illustrate a portion of a furniture seat base 310 comprising spring band assemblies 315 ( only one shown ) in which a second form of spring band 320 connector is illustrated at 330 . the connector 330 uses a cantilever principle to provide dynamic uplift to the band 320 at the back rail 316 . the rail connector 330 is fabricated of spring steel wire of relatively heavy gauge ; i . e ., eight ( 8 ) gauge or heavier . as best illustrated in fig7 it includes a pair of identical connector arms 331 extending parallel to each other between the rail 316 and the band 320 . as seen once again in fig6 each connector arm 331 includes a generally v - shaped body 335 made up of a rail - attachment leg 338 and a spring - attachment leg 339 . the legs 338 are vertically oriented and preferably four ( 4 ) inches long . the legs 338 are joined at their upper ends by a base leg 340 which seats in a conventional eks clip 341 stapled to the top of the rail 316 . curving upwardly and inwardly from the lower end of each rail - attachment leg 338 is a corresponding spring - attachment leg 339 . the spring - attachment legs 339 are approximately eight ( 8 ) inches long . formed on the free ends of the legs 339 are attachment hooks 346 identical to the hooks 146 hereinbefore discussed . the connector 330 is a variation of the second form of the invention wherein the hooks 346 receive and seat on the ultimate linear segment 325a of the spring band 320 . in operation the legs 338 are braced against the rail 316 with the spring - attachment legs 339 extending inwardly and upwardly therefrom to the hooks 346 . in unloaded position the hooks are disposed approximately one ( 1 ) inch above the level of the eks clip 341 . the connector 330 thus is effective to dynamically urge the spring band 320 end upwardly when a subject is seated . at the same time longitudinal resilient expansion - contraction can and does take place in the connector 330 , enhancing seat base softness . fig8 illustrates a sinuous spring band assembly 415 which incorporates a connector 430 identical to the connector 330 hereinbefore discussed . in the spring band assembly 415 the connector hooks 446 are seated on a linear segment 425f of the band 420 which is sixth from the end of the band ; i . e ., the ultimate linear segment 425a . the linear segment 425a is connected to the rail by a swing anchor connector clip 460 such as illustrated in fig1 of the aforementioned u . s . pat . no . 3 , 790 , 149 . the base of the clip 460 is seated , together with the base leg 440 of the connector 430 , in the conventional eks clip stapled to the top of the rail 416 . the spring band 420 immediately inwardly of its ultimate linear segment 425a , at the penultimate linear segment , is bent upwardly for the length of one semi - circular band segment 426a and then bent back into the normal arc of the band . this creates a torsion inducing moment arm configuration in the end of the band as illustrated at fig1 in the aforementioned u . s . pat . no . 3 , 525 , 514 . in operation of this spring band assembly 415 the connector 430 performs the same functions as previously ascribed to the connector 330 . further , however , its dynamic uplift is effected inwardly of the band end . this uplift , coupled with the torsion inducing band 420 configuration and the articulate connection provided by the clip 460 produces a highly sophisticated and luxurious seat base . fig9 illustrates a sinuous spring band assembly 515 which also incorporates a connector 530 identical to the connector 330 hereinbefore discussed . in the assembly 515 the sinuous band 520 is a de - arced band , however ; i . e ., it has very little inherent upward resilience . in this assembly the connector 530 pre - loads the band 520 upwardly at the fourth linear segment 525d from the ultimate linear segment 525a . the ultimate linear segment 525a is seated in the eks clip 540 on the rail 516 , together with the base leg 540 of the connector 530 . the connector leg 539 thus preloads the band 520 upwardly with the seat base 10 in its relaxed state as a subject is seated and rises , the connector provides a dynamic uplift which would otherwise not be present . all of the connectors hereinbefore discussed are also used to connect other forms of seat base support means to the frame rails . as will readily be understood , wire grids such as manufactured under the trademark perma - mesh by flexolators , inc ., chord - rubber webbing such as manufactured by the pirelli , s . p . a ., of italy , and flat steel bands , for example , do not have stored upward resilience in the sense that arced sinuous spring bands do . when connected to the back frame rail by connectors embodying the inventions disclosed herein , however , they are provided with a dynamic uplift adjacent the back rail . in this sense they are similar to a de - arced sinuous spring band . while several embodiments described herein are at present considered to be preferred , it is understood that various modifications and improvements may be made therein , and it is intended to cover in the appended claims all such modification and improvements as fall within the true spirit and scope of the invention .

a rail connector and improvement in seat base support assembly . the connector takes two basic forms . in the first a pre - stressed , close wound coil , disposed either transversely or longitudinally of the connector , is effective to continuously bias the seat base support means upwardly . in the second a cantilevered , curved spring arm serves the same purpose . the connector may be configured to reach into the body of a sinuous spring band , for example , and define a torque arm in the band , at the back rail . all forms are applicable to wire mesh , chord rubber webbing , flat steel bands and sinuous , both arced and dearced .

exemplary embodiments of the presently disclosed damage resistant anvil assembly will now be described in detail with reference to the drawings in which like reference numerals designate identical or corresponding elements in each of the several views . in this description , the term “ proximal ” is used generally to refer to that portion of the stapler that is closer to a clinician , while the term “ distal ” is used generally to refer to that portion of the stapler that is farther from the clinician . in addition , the term “ endoscopic ” is used generally to refer to procedures performed through a small incision or a cannula inserted into a patient &# 39 ; s body including endoscopic , laparoscopic , and arthroscopic procedures . finally , the term clinician is used generally to refer to medical personnel including doctors , nurses , and support personnel . the presently disclosed anvil assembly includes an anvil head assembly , an anvil shaft , and a stabilizing collet . in embodiments , the stabilizing collet may be formed of a substantially rigid material . alternately , other materials of construction that provide support to the anvil shaft are envisioned . the anvil shaft includes a plurality of flexible legs that flex outwardly in response to insertion of a trocar of a surgical stapling device into the anvil shaft to releasably couple the anvil shaft to the trocar . the collet is received within a longitudinal bore defined by the flexible legs of the anvil shaft at a location to support the flexible legs and minimize the likelihood of damage to the anvil shaft caused by engagement of the anvil shaft with a grasper . the collet is also positioned in a location not to interfere with flexing of the legs during coupling of the anvil shaft to the trocar of the stapling device . fig1 illustrates a manually powered surgical stapler 10 including a stapling device 12 supporting an exemplary embodiment of anvil assembly 100 . the stapling device 12 includes a handle assembly 14 , a body portion 16 that extends distally from the handle portion 14 , and a shell assembly 18 that supports a staple cartridge 20 . the staple cartridge 20 supports a plurality of staples ( not shown ) that are arranged in an annular configuration within the shell assembly 18 . the stapling device 12 also includes a trocar 22 that extends from the distal end of the body portion 16 through the shell assembly 18 . the trocar 22 is configured to releasably engage the anvil assembly 100 as described in further detail below . for a more detailed description of a suitable stapling device , see u . s . pat . nos . 7 , 234 , 624 , 7 , 364 , 060 and 7 , 857 , 187 (“ the incorporated patents ”) which are incorporated herein by reference in their entirety . referring also to fig2 - 4 , the anvil assembly 100 includes an anvil head assembly 102 and an anvil shaft 104 . although not specifically described in this application , the anvil head assembly 102 can be pivotally or fixedly attached to the anvil shaft 104 . examples of pivotally attached anvil head assemblies are described in the incorporated patents . the anvil head assembly 102 includes a housing 106 that supports an anvil plate 108 ( fig2 ) and a cut ring assembly 110 . the housing 106 has a smoothly curved distal surface 112 that facilitates atraumatic entry of the anvil assembly 100 into and through a body orifice or lumen . a proximal side of the housing 106 defines a cavity ( not shown ) that is configured to receive the anvil plate 108 and the cut ring assembly 110 . for a more detailed description of the components of the anvil head assembly 102 , see the incorporated patents . the anvil shaft 104 includes a longitudinal body portion 116 that includes a tubular portion 118 and a plurality of flexible legs 120 that extend proximally from the tubular portion 118 . each of the flexible legs 120 has a semi - cylindrical configuration such that the legs 120 cooperate to define a longitudinal bore 122 ( fig3 ) that is dimensioned to receive the trocar 22 of the stapling device 12 ( fig1 ) when the anvil assembly 100 is secured to the stapling device 12 . the bore 122 extends from the proximal end of the flexible legs 120 at least partially into the tubular portion 118 of the anvil shaft 104 . in embodiments , the anvil shaft 104 may include a plurality of splines 126 positioned about the anvil shaft 104 . as is known in the art , the splines 126 mate with recesses ( not shown ) defined within the shell assembly 16 fig2 ) of the surgical stapling device 12 to properly orient the staple cartridge 20 in relation to the anvil plate 108 of the anvil assembly 100 when the anvil assembly 100 and the shell assembly 18 are approximated . the anvil shaft 104 may also include one or more stabilization rings 130 ( only one is shown ) positioned about the anvil shaft 104 at a position to engage the shell assembly 16 when the anvil assembly 100 and the shell assembly 18 are approximated to provide added stability to the anvil assembly 100 . for a more detailed description of an anvil assembly including a stabilization ring , see u . s . pat . no . 8 , 424 , 535 which is incorporated herein by reference in its entirety . although the splines 126 and the stabilization ring 130 are shown to be formed integrally with the anvil shaft 104 , it is contemplated the either or both could be formed separately from the anvil shaft 104 and secured to the anvil shaft 104 using any known fastening technique including welding , crimping gluing or the like . referring to fig4 and 5 , each of the flexible legs 120 of the anvil shaft 104 defines a longitudinal channel 134 with an adjacent leg 120 . each longitudinal channel 134 includes an enlarged cutout or hole 136 formed at the distal end of the longitudinal channel 134 . the holes 136 are configured to secure a collet 150 within the longitudinal bore 122 of the anvil shaft 104 . in embodiments , the hole 136 is substantially circular although other configurations are envisioned . one or more of the flexible legs 120 may also include a bore 140 which is configured to receive a suture or the like ( not shown ). the suture can be used to allow a clinician to retrieve or position the anvil assembly 100 from or within a surgical site . the proximal end of each of the flexible legs 120 has an inner surface that defines a recess 160 ( fig7 ) such that the recesses 160 collectively define an annular recess 160 a ( fig9 ). the annular recess 160 a facilitates releasable engagement of the anvil assembly 100 to the stapling device 12 . referring also to fig6 , the collet 150 may be substantially rigid and is positioned within the longitudinal bore 122 defined by the anvil shaft 104 . the collet 150 is substantially cylindrical and defines a longitudinal bore 152 ( fig7 ) that is dimensioned to receive the trocar 22 ( fig1 ). a distal portion 154 of the collet 150 includes a plurality of cantilevered fingers 156 . each of the fingers 156 includes a protrusion 158 that is dimensioned and configured to be received in a respective one of the holes 136 ( fig5 ) formed in the anvil shaft 104 as described in further detail below . referring to fig7 - 9 , in order to assemble the collet 150 within the anvil shaft 104 , the distal end of the collet 150 is inserted into the proximal end of the longitudinal bore 122 of the anvil shaft 104 and slid distally in the direction indicated by arrow “ a ” in fig7 and 8 . the collet 150 is positioned to align the protrusions 158 with the longitudinal channels 134 positioned between the flexible legs 120 . when the protrusions 158 engage an inner wall of the flexible legs 120 , the fingers 156 are deflected inwardly in the direction indicated by arrow “ b ” in fig8 to facilitate passage of the collet 150 through the longitudinal bore 122 . when the protrusions 158 are moved into alignment with the holes 136 , the fingers 156 spring outwardly in the direction indicated by arrow “ c ” in fig9 to move the protrusions 158 into the holes 136 to secure the collet 150 within the longitudinal bore 122 . referring to fig1 , the trocar 22 includes a pointed distal end 30 and an enlarged proximal portion 32 that defines a shoulder 32 a . as known in the art , the proximal end of the trocar 22 is secured to an approximation mechanism ( not shown ) of the stapling device 12 ( fig1 ) to facilitate movement of the trocar 22 between retracted and advanced positions . when the trocar 22 is inserted into the longitudinal bore 122 of the anvil shaft 104 and the longitudinal bore 152 of the collet 150 in the direction indicated by arrow “ d ” in fig1 , the enlarged proximal portion 32 of the trocar 22 engages a proximal end of the flexible legs 120 of the anvil shaft 104 to urge the flexible legs 120 outwardly in the direction indicated by arrows “ e ”. when the enlarged proximal portion 32 of the trocar 22 is moved distally in the direction indicated by arrow “ d ” into alignment with the recess 160 defined at the proximal end of the flexible legs 120 , the flexible legs 120 return to their undeformed configuration to receive the enlarged proximal portion 32 of the trocar 22 . when the enlarged proximal portion 32 is received within the recess 160 , the shoulder 32 a on the enlarged proximal portion 32 of the trocar 32 engages a proximal wall 161 defining the recess 160 to secure the anvil shaft 104 to the trocar 22 . during an endoscopic surgical procedure , the anvil assembly 100 is grasped with a grasper ( not shown ) that is inserted through a small incision in the skin to position the trocar 22 within the longitudinal bore 122 of the anvil shaft 104 and secure the anvil assembly 100 to the trocar 22 of the surgical stapling device 12 . the collet 150 is positioned within the longitudinal bore 122 of the anvil shaft 104 and extends from a distal end of the flexible legs 120 towards the proximal end of the flexible legs 120 to support the flexible legs 120 and inhibit radial compression or other deformation of the flexible legs 120 that may result from pressure applied to the flexible legs 120 by a manipulating instrument ( not shown ). collet 150 may be formed from any suitable , medical grade material having a stiffness to perform the functions described herein . suitable materials include , for example , stainless steel or nylon . the collet 150 is secured within the longitudinal bore 122 of the anvil shaft 104 in a position that does not interfere with outward flexing of the flexible legs 120 and , thus , allows the anvil assembly 100 to be readily connected to the trocar 22 . persons skilled in the art will understand that the devices and methods specifically described herein and illustrated in the accompanying drawings are non - limiting exemplary embodiments . it is envisioned that the elements and features illustrated or described in connection with one exemplary embodiment may be combined with the elements and features of another without departing from the scope of the present disclosure . as well , one skilled in the art will appreciate further features and advantages of the disclosure based on the above - described embodiments . accordingly , the disclosure is not to be limited by what has been particularly shown and described , except as indicated by the appended claims .

an anvil assembly is disclosed that includes an anvil shaft including a proximal portion and a distal portion and defining a first longitudinal bore . the proximal portion includes a plurality of flexible legs that define the first longitudinal bore dimensioned to receive a trocar of a stapling device . an anvil head assembly is secured to the distal portion of the anvil shaft and supports an annular anvil plate that a plurality of staple deforming pockets . the anvil assembly also includes a rigid collet defining a second longitudinal bore that is configured to receive the trocar of the stapling device . the rigid collet is supported within the first longitudinal bore and is positioned to prevent crushing of the plurality of flexible legs when the anvil assembly is manipulated with a grasper .

fig1 illustrates an optical ablation system 15 according to the present invention including an ablation instrument 10 and an electro - optic generator 11 . in fig1 optical energy in the form of light is supplied to ablation instrument 10 by electro - optical generator 11 . as used herein , the term &# 34 ; optical &# 34 ; is intended to include that portion of the electromagnetic spectrum including radiation in the ultraviolet , visible and infrared wavelengths . electro - optical generator 11 includes an optical energy source 12 , one or more energy coupling devices 14 , one or more optical filters 16 , one or more variable attenuators 18 which may also comprise a variable neutral density filter , one or more fiber optic bundles 20 , one or more thermocouple inputs 24 and control circuitry 22 . optical energy source 12 may be , for example , a laser , a halogen lamp , a conventional incandescent lamp or other optical energy source . optical energy source 12 may be a single source which provides light which is white or spectrally pure at a specific wavelength . alternatively , optical energy source 12 may include a plurality of light sources having any combination of wavelengths and power levels . optical energy source 12 is coupled to fiber optic bundle 20 by energy coupling lens 14 , optical filter 16 and variable attenuator 18 . energy coupling lens 14 focuses optical energy from optical energy source 12 through optical filter 16 and variable attenuator 18 onto the proximal end of fiber optic bundle 20 . the intensity and / or wavelength of optical energy source 12 may be controlled by , for example , signals from control circuit 22 transmitted through control line 72 . optical filter 16 may be a single frequency filter adapted to filter out all but one of the wavelengths generated by optical energy source 12 . alternatively , optical filter 16 may be a plurality of selectable filters from which a filter effective at one or more wavelengths may be chosen to selectively filter optical energy generated by optical energy source 12 . optical filter 16 may also be a spectral filter adapted to pass energy within a band of wavelengths . optical filter 16 may also be a filter wheel which contains a number of band pass filters . the wavelength of light filtered by optical filter 16 may be controlled by , for example , signals from control circuit 22 transmitted through control line ( s ) 70 . after passing through optical filter 16 , energy from optical energy source 12 passes through variable attenuator 18 . variable attenuator 18 may also be referred to as a variable neutral density filter . variable attenuator 18 is adapted to control the energy level of the light which is focused on to the proximal end of fiber optic bundle 20 . the setting of variable attenuator 18 may be controlled by , for example , signals from control circuit 22 transmitted through control line ( s ) 74 . the energy passed by variable attenuator 18 may be controlled by signals from control circuit 22 to ensure that the appropriate energy level is input to the proximal end of fiber optic bundle 20 . energy coupling lens 14 may include a plurality of energy coupling lenses , for example the three energy coupling lenses 14a , 14b and 14c illustrated in fig1 . optical filter 16 may include a plurality of optical filters , for example , the three optical filters 16a , 16b and 16c illustrated in fig1 . variable attenuator 18 may include a plurality of variable attenuators , for example , the three variable attenuators 18a , 18b and 18c illustrated in fig1 . in addition , fiber optic bundle 20 may include a plurality of fiber optic bundles , for example , the three fiber optic bundles illustrated in fig1 . the number of energy coupling lenses , optical filters , variable attenuators and fiber optic bundles will depend upon the design of the ablation system 15 , however , the number of coupling lenses , optical filters , variable attenuators and fiber optic bundles will generally correspond to the number of regions the ablation instrument is designed to separately heat within the body cavity being treated . electro - optic generator 22 includes temperature signal wires 24 which are adapted to relay signals representative of the temperature at selected points at the distal end of ablation instrument 10 to control circuit 22 . the number of temperature signal wires 24 will depend upon the design of ablation system 15 , however , the number of thermocouple inputs will generally correspond to a multiple of the number of regions the ablation instrument is designed to separately heat . in the embodiment of the ablation instrument illustrated in fig1 the electro - optic generator includes three temperature signal wires 24a , 24b and 24c . in one embodiment of the present invention , temperature signal wires 24 comprise a pair of wires which are connected through ablation instrument 10 to a thermocouple at a distal end of the ablation instrument . fiber optic bundles 20 and temperature signal wires 24 terminate at generator connector 19 which is adapted to mate with instrument connector 26 . in fig1 instrument connector 26 is shown in cutaway view to show fiber optic bundles 21a , 21b and 21c and to show thermocouple inputs 25a , 25b and 25c which are positioned within instrument connector 26 and flexible sleeve 27 . fiber optic bundles 20 exit electro - optic generator 11 at generator connector 19 where each fiber optic bundle 20a , 20b and 20c is butt - coupled to a corresponding fiber optic bundle 21a , 21b and 21c such that optical energy is transmitted from fiber optic bundles 20a , 20b and 20c to fiber optic bundles 21a , 21b and 21c , respectively . temperature signal wires 24 also exit electro - optic generator 11 at generator connector 19 where temperature signal wires 24a , 24b and 24c are connected to temperature signal wires 25a , 25b and 25c , respectively . fiber optic bundles 21 and temperature signal wires 25 pass through flexible sleeve 27 to instrument handle 28 and through instrument handle 28 to rigid sleeve 34 . instrument handle 28 includes connector 35 , fluid source connector 29 , sleeve retractor 32 , sleeve retractor stop 33 and fluid line 36 . flexible sleeve 27 , terminates at connector 35 while fiber optic bundles 21 and temperature signal wires 25 pass through connector support 27 and the central portion of instrument handle 28 to the central annulus of rigid sleeve 34 . fluid source connector 29 , which is adapted to receive a fluid source such as , for example , syringe 30 , is connected to fluid line 36 . in the embodiment of fig1 syringe 30 includes plunger 31 which is adapted to force fluid , for example air , through fluid line 36 . fluid line 36 extends from fluid source connector 29 to the annulus of rigid sleeve 34 . in instrument handle 28 as illustrated in fig1 sleeve retractor 32 is connected to sleeve collar 37 which is connected to rigid sleeve 34 such that rigid sleeve 34 may be retracted in the proximal direction by moving sleeve retractor 32 in the proximal direction . the travel of sleeve retractor 32 is limited by sleeve retractor stop 33 , thus limiting the proximal travel of rigid sleeve 34 . as rigid sleeve 34 is retracted , expandable sleeve tip 40 at the distal end of rigid sleeve 34 opens , releasing the balloon or other device positioned in the central annulus of rigid sleeve 34 at the distal end of sleeve 34 . fig2 is a cross sectional view of the ablation instrument illustrated in fig1 along view line 2 -- 2 . in fig2 fluid line 36 is surrounded by fiber optic bundles 21a , 21b and 21c and by temperature signal wires 25a , 25b and 25c . as illustrated in fig2 fiber optic bundles 21a , 21b and 21c each include one or more fiber optic fibers 38 which are adapted to transmit optical energy . temperature signal wires 25 are adapted to transmit signals representative of temperature . fluid line 36 is adapted to transmit fluid such as , for example , air . fig3 illustrates an optical ablation system according to the present invention including an ablation instrument and an alternative embodiment of an electro - optic generator . in the embodiment of electro - optic generator 11 illustrated in fig3 optical energy source 12 of fig1 is divided into a plurality of controllable optical energy sources 12a , 12b and 12c . in one embodiment of the present invention , the intensity of optical energy sources 12 is controllable and the energy from optical energy sources 12a , 12b and 12c is controlled by energy control signals from control circuit 22 which are transmitted through , for example , control lines 72 . each of energy sources 12a , 12b and 12c pass optical energy through energy coupling lenses 14a , 14b and 14c respectively . energy coupling lenses 14a , 14b and 14c focus optical energy on fiber optic bundles 20a , 20b and 20c through optical filters 16a , 16b and 16c respectively . in one embodiment of the present invention , optical filters 16 may include a plurality of selectable optical filters which may be selected by filter selection signals from control circuit 22 which are transmitted through , for example , control lines 70 . the number of energy coupling lenses , optical filters and fiber optic bundles will depend upon the design of ablation system 15 , however , the number of coupling lenses , optical filters and fiber optic bundles will generally correspond to the number of regions the ablation instrument is designed to separately heat within the body cavity being treated . in all other respects , the ablation system 15 illustrated in fig3 is substantially identical to the ablation system 15 illustrated in fig1 . fig4 is a cutaway view of a cross section of an expandable diffusing web 46 according to the present invention . in fig3 expandable defusing web 46 includes reflective coating 42 , balloon 44 , optical fiber mesh 47 and an adhesive layer 50 for attaching the fiber optic mesh to the balloon . reflective coating 42 may be , for example , a coating of silver or other reflective material which covers the outer surface of balloon 44 . balloon 44 may be constructed of , for example , mylar or other expandable balloon material . optical fiber mesh 47 may include optical fibers 48 , reflective fiber terminator 52 and fill threads 49 . fill threads 49 may be solid as illustrated in fig4 . alternatively , fill threads 49 may be made of an optically conductive material . optical fiber mesh 47 may be , for example , a light emitting woven light emitting panel which is manufactured by ploy - optic or by lumitex . reflective fiber terminator 52 is located at the end of optical fiber 48 to reflect any optical energy which reaches the end of optical fiber 48 without being diffused . fig5 is a cutaway side view of the distal end of ablation instrument 10 according to the present invention prior to deployment of expandable diffusing web 46 . in fig5 the distal end of rigid sleeve 34 , including expandable diffusing web 46 is disposed within uterus 56 . expandable diffusing web 46 is folded to fit within rigid sleeve 34 . the interior of uterus 56 is covered by an endometrial layer 58 . as rigid sleeve 34 is withdrawn , by , for example moving sleeve retractor 32 , expandable diffusing web 46 forces expandable sleeve tip 40 open , exposing expandable diffusing web 46 . fluid line 36 is connected to the proximal end of expandable diffusing web 46 such that a fluid , such as air , supplied at fluid source connector 29 fills the interior of expandable diffusing web 46 , forcing expandable diffusing web 46 to expand . fig6 is a cutaway side view if the distal end of ablation instrument 10 according to the present invention after deployment of expandable diffusing web 46 . in fig6 rigid sleeve 34 has been retracted , exposing expandable diffusing web 46 . expandable diffusing web 46 , which includes balloon 44 and optical fiber mesh 47 is expanded to fit against endometrial lining 58 of uterus 56 by filling balloon interior 60 with a fluid such as air . fluid line 46 connects balloon interior 60 to fluid source connector 29 . fig7 is a side view of a balloon 44 for use in the present invention . it will be recognized that balloon 44 may be shaped to fit within any body cavity , however , in the embodiment of the invention described herein , expandable diffusing web 46 is designed to be used within the uterus to destroy the endometrial lining . thus , balloon 44 illustrated in fig7 is shaped to fit within the uterus and to hold the optical fiber mesh firmly against at least a substantial portion of the endometrial lining . nor is it necessary that the invention be limited to the use of a balloon as an expandable element since any means of expanding expandable diffusing web 46 to position optical fiber mesh near or adjacent the interior lining ( e . g . the endometrium ) of the body cavity to be treated is within the scope of the present invention . in fig7 balloon 44 has been expand ed by filling interior 60 with an appropriate fluid , such as air , and the expanded balloon 44 takes on the shape of the interior of a uterus . fig8 is a side view of the distal end of ablation instrument 10 according to the present invention illustrating a portion of expandable diffusing web 46 which includes a first optical fiber mesh 47a . the embodiment of the invention illustrated in fig8 further includes a first thermocouple 62a . in fig8 optical fiber mesh 47a is disposed on the distal end of balloon 44 . in fig8 optical fiber mesh 47a includes optical fibers 48a which are interwoven with fill threads 49a . at their proximal end , optical fibers 48a of optical fiber mesh 47a are connected to the distal end of one of fiber optic bundles 21 which extend through rigid sleeve 34 , alternatively , optical fibers 48a of optical fiber mesh 47a may be a continuation of one of the optic fiber bundles 21 . for example , the proximal ends of fiber optics 48a may be gathered together to form an optical fiber bundle 51a which is connected to , for example , the distal end of fiber optic bundle 21a using , for example a butt - connector such as the one used to connect fiber optic bundle 20a with fiber optic bundle 21a , alternatively , fiber bundle 51a may be a continuation of the distal end of fiber optic bundle 21a . fiber optic bundle 21a is joined to or disperses to form optical fibers 48a such that optical energy is passed from fiber optic bundle 21a to optical fibers 48a , thus optical energy generated at optical energy source 12 may be transmitted through fiber optic bundle 20a to fiber optic bundle 21a and through fiber optic bundle 21a to optical fibers 48a of optical fiber mesh 47a . thermocouple 62a is positioned to detect the temperature of tissue adjacent optical fiber mesh 47a . temperature signal wires 25a , being connected to thermocouple 62a , relay a signal representative of the temperature at thermocouple 62a to temperature signal wires 24a which , in turn relay the signal to control circuit 22 . optical fiber mesh 47a , being positioned on balloon 44 , is held in place against the tissue to be treated by the expansion of balloon 44 as a result of the fluid supplied through fluid line 36 . fig9 is a side view of the distal end of ablation instrument 10 according to the present invention illustrating a portion of expandable diffusing web 46 which includes a first optical fiber mesh 47a and a second optical fiber mesh 47b . the embodiment of the invention illustrated in fig9 further includes a first thermocouple 62a and a second thermocouple 62b . in fig9 a second optical fiber mesh 47b has been wrapped around the distal end of the balloon illustrated in fig8 to increase the surface area of balloon 44 covered by optical fiber mesh 47 . thus , the previous description of the instrument with respect to fig8 is applicable with respect to like elements of fig9 . in addition to the elements described with respect to fig8 fig9 illustrates optical fiber mesh 47b which includes optical fibers 48b which are interwoven with fill threads 49b . at their proximal end , optical fibers 48b of optical fiber mesh 47b are connected to the distal end of one of fiber optic bundles 21 which extend through rigid sleeve 34 . for example , the proximal ends of fiber optics 48b may be gathered together to form an optical fiber bundle 51b which is connected to , for example , the distal end of fiber optic bundle 21b using , for example , a butt - connector such as the one used to connect fiber optic bundle 20b with fiber optic bundle 21b , alternatively , fiber bundle 51b may be a continuation of the distal end of fiber optic bundle 21b . fiber optic bundle 21b is joined to optical fibers 48b such that optical energy is passed from fiber optic bundle 21b to optical fibers 48b , thus optical energy generated at optical energy source 12 may be transmitted through fiber optic bundle 20b to fiber optic bundle 21b and through fiber optic bundle 21b to optical fibers 48b of optical fiber mesh 47b . thermocouple 62b is positioned on balloon 44 to detect the temperature of tissue adjacent optical fiber mesh 47b . temperature signal wires 25b , being connected to thermocouple 62b , relay a signal representative of the temperature at thermocouple 62b to temperature signal wires 24b which , in turn , relay the signal to control circuit 22 . optical fiber mesh 47b , being positioned on balloon 44 , is held in place against the tissue to be treated by the expansion of balloon 44 as a result of the fluid supplied through fluid line 36 . fig1 is a side view of the distal end of ablation instrument 10 according to the present invention illustrating a portion of expandable diffusing web 46 which includes a first and optical fiber mesh 47a , a second optical fiber mesh 47b and a third optical fiber mesh 47c . the embodiment of the invention illustrated in fig1 further includes a first thermocouple 62a , a second thermocouple 62b and a third thermocouple 62c . in fig1 , a third optical fiber mesh 47c has been wrapped around the distal end of the balloon illustrated in fig8 and fig9 to increase the surface area of balloon 44 covered by optical fiber mesh 47 . thus , the previous description of the instrument with respect to fig8 and fig9 is applicable with respect to like elements of fig1 . in addition to the elements described with respect to fig8 and fig9 fig1 illustrates an optical fiber mesh 47c which includes optical fibers 48c which are interwoven with fill threads 49c . at their proximal end , optical fibers 48c of optical fiber mesh 47c are connected to the distal end of one of fiber optic bundles 21 which extend through rigid sleeve 34 . for example , the proximal ends of fiber optics 48c may be gathered together to form an optical fiber bundle 51c which is connected to , for example , the distal end of fiber optic bundle 21c using , for example , a butt - connector such as the one used to connect fiber optic bundle 20c with fiber optic bundle 21c , alternatively fiber bundle 51c may be a continuation of the distal end of fiber optic bundle 21c . fiber optic bundle 21c is joined to optical fibers 48c such that optical energy is passed from fiber optic bundle 21c to optical fibers 48c , thus optical energy generated at optical energy source 12 may be transmitted through fiber optic bundle 20c to fiber optic bundle 21c and through fiber optic bundle 21c to optical fibers 48c of optical fiber mesh 47c . thermocouple 62c is positioned on balloon 44 to detect the temperature of tissue adjacent optical fiber mesh 47c . temperature signal wires 25c , being connected to thermocouple 62c , relay a signal representative of the temperature at thermocouple 62c to temperature signal wires 24c which , in turn , relay the signal to control circuit 22 . optical fiber mesh 47c , being positioned on balloon 44 , is held in place against the tissue to be treated by the expansion of balloon 44 as a result of the fluid supplied through fluid line 36 . the embodiment of the invention illustrated in fig1 is adapted to controllably heat three separate regions within the uterus of a human patient to selectively destroy the endometrial layer within those regions . the energy and depth of penetration of the optical energy may be controlled by controlling the energy level and wavelength of the energy transmitted to the proximal end of each fiber optic bundle 20a , 20b and 20c . longer wavelengths penetrate deeper into tissue . shorter wavelengths , for example , blues and greens , may be used to achieve surface heating . thus , depending on the effect that is desired , different wavelength of optical energy may be selected . optical energy is transmitted through optical bundles 20 to optical bundles 21 and optical bundles 51 . optical energy which passes through optical bundles 51 is diffused by optical fiber mesh 47 of expandable diffusing web 46 . reflective coating 42 acts to reflect optical energy away from balloon 44 and into tissue surrounding expandable diffusing web 46 . the depth of penetration of the optical energy into surrounding tissue will be a function of a number of factors , including the wavelength of the optical energy radiated by expandable diffusion web 46 and the distance from the expandable diffusion web 46 to the tissue to be treated . the rate at which the tissue is heated will also depend upon a number of factors , including the output energy generated by optical energy source 12 , the losses in electro - optic generator 11 and ablation instrument 10 , the distance from the expandable diffusion web 46 to the tissue to be treated and the wavelength of the optical energy . however , by monitoring the tissue as it is treated using , for example , thermocouples 62 , the surgeon may control the temperature of the tissue being treated with relative accuracy . in use a surgeon will introduce the distal end of ablation instrument 10 into the body cavity of a patient such that expandable sleeve tip 40 is positioned at a predetermined depth within the body cavity . for the purposes of this discussion , the body cavity to be treated will be the uterus of a female human being . it will be recognized that , with slight modification , the present invention may be used to treat other body cavities . once sleeve tip 40 is inserted into the uterus 56 as illustrated in fig5 sleeve retractor 32 may be used to slide rigid sleeve 34 back away from expandable diffusing web 46 . as rigid sleeve 34 is retracted , expandable diffusing web 46 forces expandable sleeve tip 40 open . once sleeve retractor 32 reaches its proximal most travel point it is stopped by sleeve retractor stop 33 which prevents rigid sleeve 34 from retracting further . once rigid sleeve 34 is retracted , expandable diffusing web 34 may be expanded to contact the interior of the uterus by , for example inflating balloon 44 by injecting an appropriate fluid , such as , for example air into balloon interior 60 . fluid is introduced into balloon 44 through fluid line 36 which is connected to fluid source connector 29 which , in the embodiment illustrated in fig1 is connected to a syringe and plunger which may be used to inflate or deflate balloon 44 . expandable diffusing web 46 , being shaped to fit the body cavity , e . g . the uterus , being treated , is designed to force optical fiber mesh 47 against a substantial portion of the interior surface of the body cavity . thus , when expandable diffusing web 46 is fully expanded , optical fiber mesh 47 is positioned directly adjacent or in direct contact with endometrium 58 of uterus 56 . once expandable diffusing web 46 is positioned within uterus 56 , optical energy may be supplied to optical fiber mesh 47 by turning on optical energy source 12 . once optical energy source 12 is turned on , the light radiated by optical energy source 12 is focused on the proximal end of optical fiber bundle 20 by energy coupling lens 14 . as optical energy passes through optical filter 16 , it is filtered to remove unwanted wavelengths . as optical energy passes through variable attenuator 18 the energy level is attenuated . therefore , the optical energy focused upon fiber optic bundle 20 is filtered and attenuated such that it is optical energy of a selected wavelength and energy level . optical energy focused upon the proximal end of fiber optic bundle 20 is transmitted through fiber optic bundle 20 to fiber optic bundle 21 and from fiber optic bundle 21 to expandable diffusing web 46 where it is radiated into the endometrial layer from optical fiber mesh 47 . where different optical energy levels or wavelengths are to be transmitted to different regions of the endometrium , a plurality of energy coupling lenses 14a - 14c , optical filters 16a - 16c and variable attenuators 18a - 18c may be used to focus filtered optical energy onto a plurality of fiber optic bundles 20a - 20c as illustrated in fig1 . alternatively , where different optical energy levels or wavelengths are to be transmitted to different regions of the endometrium , a plurality of optical energy sources 12a - 12c , energy coupling lenses 14a - 14c and optical filters 16a - 16c may be used to focus filtered optical energy onto a plurality of fiber optic bundles 20a - 20c as illustrated in fig2 . the optical energy focused on optical bundles 20a - 20c may then be transmitted through optical fiber bundles 21a - 21c to each optical fiber mesh 47a - 47c . once the optical energy reaches expandable diffusing web 46 , it is radiated by optical fibers 48 which are woven with fill threads 49 to form optical fiber mesh 47 . radiation from optical fibers 48 which is not directed into the tissue adjacent optical fiber mesh 47 is reflected by reflective coating 42 as illustrated in fig4 . thus , both the energy radiated toward the tissue and the reflected energy is absorbed by the tissue adjacent to fiber optic mesh 47 . further , since the energy is transmitted optically , it is not necessary for the tissue to be directly adjacent fiber optic mesh 47 as the radiated energy will be absorbed by any tissue illuminated by the energy from the mesh . this arrangement provides for uniform escape or emission of energy focused on the fiber optic bundles 20 in fiber optic generator 11 . further , in an arrangement according to the present invention , energy is evenly radiated from the outside of the expandable diffusing web , and is , therefore absorbed by the endometrial lining of the uterus causing temperature of the tissue to rise . the control sequence for control circuit 22 of the electro - optic generator illustrated in fig1 is illustrated in fig1 . once expandable diffusing web 46 has been positioned and inflated as described previously , optical energy may be supplied to expandable web 46 to heat endometrial lining 58 . the first step in supplying optical energy to endometrial lining 58 is to select an appropriate wavelength . in particular , red and near infrared wavelengths would be selected for heating deep ( e . g . 0 - 10 millimeters ) into uterine tissue . ultraviolet , blue or green wavelengths would be used for heating uterine tissue to a depth of , for example , ( 0 - 3 millimeters ). once the appropriate optical energy wavelength has been selected by , for example , adjustment of optical filter 16 or by appropriate selection of optical energy source 12 , optical energy may be supplied to expandable web 46 . the energy level or intensity of the optical energy supplied to expandable web 46 may be controlled by controlling the attenuation of variable attenuators 18 or by controlling the intensity of optical energy source 12 . temperature feedback from thermocouple 62 may be used to adjust the energy level supplied to fiber optic bundles 20 . thus , the temperature of the body lining being treated is controlled by controlling the energy level supplied to expandable web 18 while the depth of penetration of the energy supplied to expandable web 46 is controlled by controlling the wavelength of the optical energy supplied to fiber optic bundles 20 . the flow diagram of fig1 illustrates the control sequence for the electro - optic generator illustrated in fig1 . the temperature of endometrial lining 58 is sensed by , for example , thermocouple 62 which provides a signal to control circuit 22 through temperature signal wires 24 and 25 . as illustrated in fig1 , control circuit 22 , in step 67 , senses the temperature at thermocouple 62 and produces a signal 100 which is representative of the temperature measured at thermocouple 62 . in step 68 , signal 100 is compared to a predetermined set point temperature such as , for example , any temperature between 42 ° c . and 100 ° c . for a time sufficient to destroy the inner lining of the organ in question . if the temperature represented by signal 100 is lower than the set point temperature , control circuit 22 generates a signal 103 . in step 71 , signal 103 causes control circuit 22 to decrease the attenuation of the optical energy focused on optical fiber bundle 20 , thus increasing the optical energy supplied to expandable web 46 . once the attenuation has been reduced , control circuit 22 generates a signal 105 which causes control circuit 22 to return to step 67 where the temperature is measured again and a new signal 100 is generated . once the temperature represented by signal 100 reaches the set point temperature control circuit 22 , in step 69 , generates a signal 106 which is representative of the time the endometrium has been at the desired temperature . the time represented by signal 106 is compared , in step 72 to a predetermined set time and if the time represented by signal 106 is less than the predetermined set time , control circuit 22 generates signal 107 which returns control circuit 22 to step 67 . if during the control cycle , the signal 100 rises above the set point temperature , then signal 102 is generated , causing control circuit 22 to increase attenuation at variable attenuators 18 , thus decreasing the optical energy delivered to expandable diffusing web 46 . once the actual time at the desired temperature , represented by signal 106 , reaches the predetermined set time in step 72 , signal 108 is generated indicating , in step 73 , that the procedure is complete and generating signal 109 which turns off optical energy source 12 in step 74 . the flow diagram of fig1 illustrates the control sequence for the electro - optic generator illustrated in fig2 . the temperature of endometrial lining 58 is sensed by , for example , thermocouple 62 which provides a signal to control circuit 22 through temperature signal wires 24 and 25 . as illustrated in fig1 , control circuit 22 , in step 80 , senses the temperature at thermocouple 62 and produces a signal 200 which is representative of the temperature measured at thermocouple 62 . in step 81 , signal 200 is compared to a predetermined set point temperature . if the temperature represented by signal 200 is lower than the set point temperature , control circuit 22 generates a signal 203 . in step 84 , signal 203 causes control circuit 22 to increase the optical energy from optical energy source 12 which increases the intensity of the optical energy focused on optical fiber bundle 20 , thus increasing the optical energy supplied to expandable web 46 . once optical energy has been increased , control circuit 22 generates a signal 205 which causes control circuit 22 to return to step 80 where the temperature is measured again and a new signal 200 is generated . once the temperature represented by signal 200 reaches the set point , temperature control circuit 22 , in step 82 , generates a signal 206 which is representative of the time the endometrium has been at the desired temperature . the time represented by signal 206 is compared , in step 85 to a predetermined set time and , if the time represented by signal 206 is less than the predetermined set time , control circuit 22 generates signal 207 which returns control circuit 22 to step 80 . if during the control cycle , the signal 200 rises above the set point temperature , then signal 202 is generated , causing control circuit 22 to decrease the optical energy from optical energy source 12 , which decreases the intensity of the optical energy focused on optical fiber 20 , decreasing the energy delivered to expandable diffusing web 46 . once the actual time at the desired temperature , represented by signal 206 , reaches the predetermined set time in step 85 , signal 208 is generated indicating , in step 86 , that the procedure is complete and generating signal 209 which turns off optical energy source 12 in step 87 . in operation , ablation instrument 10 would be connected to electro - optic generator 11 and the distal end of instrument 10 would be inserted into the appropriate body organ , for example , into the uterus 56 . rigid sleeve 34 would then be retracted using sleeve retractor 32 , thereby exposing expandable diffusing web 46 which includes balloon 44 . balloon 44 is inflated using , for example , balloon inflator syringe 30 which includes plunger 30 . once balloon 44 is inflated forcing expandable diffusing web 46 to conform to the interior of uterus 56 , electro - optic generator 11 is activated , thus delivering optical energy to optical fibers 48 of optical fiber mesh 47 on expandable diffusing web 46 . control circuit 22 is then used to monitor the heating of endometrial layer 58 of uterus 56 through thermocouple ( s ) 62 . control circuit 22 acts to bring endometrial layer 58 up to a desired temperature , hold endometrial layer 58 at that temperature for a predetermined length of time and then turn off optical energy to the endometrial layer . expandable diffusing web 46 may then be collapsed by deflating balloon 44 using , for example syringe 30 . once expandable diffusing web 46 is deflated , it may be retracted from uterus 56 . use of an ablation instrument according to the present invention may be advantageous , when compared to electrosurgical or other apparatus for use in endometrial ablation , for example : light energy may be less likely to interfere with the operation of the thermocouples ; a light diffusing fiber - optic web may be more adaptable to expansion than rf electrodes ; contact with the uterine wall is not required as it may be in an rf device ; it is possible to control the depth of heating by controlling the wavelength of the optical energy applied to the endometrial lining . according to one embodiment of the present invention , light energy from optical energy source 12 , which may be , for example , common projection lamps , may be used to uniformly heat the endometrium 58 ° to 70 ° c . and thereby ablate the endometrium . the array of fiber - optic mesh or webs 47 are connected individually to an array of high intensity lamps 12 via fiber - optic cables 20 and 21 . fiber optic mesh 47 may heating of the endometrium 58 is achieved through absorption of the optical radiation transmitted through fiber optic cables 20 and 21 . the temperature of each fiber optic web , for example fiber optic webs 47a - 47c , is monitored by a thermocouple , for example 62a - 62c , which , through a feedback loop including temperature signal wires 24 and 25 which are connected to control circuitry 22 , controls the intensity of its associated lamp 12 . in this embodiment , fiber - optic mesh 47 and thermocouples 62 cover the outside of an inflatable silvered mylar pouch or balloon 44 . balloon 44 is inserted into the uterus and then inflated . inflation brings fiber - optic webs 47 and thermocouples 62 into contact with the endometrium or endometrial layer 58 . lamps 12 are then turned on and the temperature of the endometrium is monitored intensity of the optical energy supplied to fiber optic webs 47 is controlled by monitoring feedback from thermocouples 62 until therapy is complete . the silvered surface of mylar balloon 44 directs all the optical radiation into the endometrium for heating . while preferred embodiments of the present invention have been shown and described herein , it will be obvious to those skilled in the art that such embodiments are provided by way of example only . numerous variations , changes , and substitutions will now occur to those skilled in the art without departing from the invention . accordingly , it is intended that the invention be limited only by the spirit and scope of the appended claims .

a method of performing endometrial ablation comprising heating entire surface of the endometrium to a temperature of between 45 ° c . and 70 ° c . to destroy the cells of the endometrial lining while maintaining the average temperature of the myometrium at a temperature below approximately 42 ° c . an apparatus for performing an endometrial ablation comprising an expandable membrane such as a balloon adapted to fit within the uterus and contact the endometrial lining when expanded . a web of light diffusing fiber - optic cables arranged on the outer surface the balloon such that the web contacts the endometrial lining of the uterus when the balloon is expanded . the fiber - optic web is connected to an array of high intensity lamps via a series of fiber - optic cables . the temperature of the endometrium is monitored by a of a series of temperature sensors arranged upon the surface of the balloon .

1 indicates the tank containing the mixture of vegetable and / or animal natural products , each one in a clean and fragmented state , containing one or more primary mineral elements in addition to those in smaller quantities , combined with organic substances to be eliminated ; 2 indicates the heated cell , normally at a temperature included between 200 ° and 900 ° c ., in which the mixture coming from container 1 is mineralised , therefore the organic portion is normally separated in vapours and fumes . the mineralised complex in container 3 is a mineral complex characterised by a qualitative and quantitative composition of the chosen primary mineral elements , each one combined with a plurality of mineral elements already present , sometimes in minimum measures , on the vegetal and / or animal products from which they are originally produced and contained . the product coming out from group 3 is in one case conveyed directly to chamber 6 , and in the other case conveyed to mixer 4 in which it is mixed with other active principles coming from container 5 in order to originate in chamber 6 the mixture that is to be transformed into capsules or tablets , then to be packed and after distributed on the market . in the general formulation the production process of a mineral complex first foresees the quantitative determination of the metals that one wishes to integrate , hence a selection of the vegetal and / or animal raw materials that present a particularly high content of the above - mentioned metals . after having accomplished the choice of the organic raw materials to be used , the process through which the wanted mineral complex is obtained , can be described in a detailed way as follows : the chosen raw materials are analysed to make sure that the element is to be integrated is constant in them . the selected raw materials are dried , then individually cut and sieved until obtaining a uniform granulometry that is adapted for being mineralised . the previously processed raw materials as described above , are eventually mixed between them in the right proportion in order to obtain in the final complex the content of principal elements as wanted in the ratio . the aforesaid mixture is distributed on trays of stainless steel until reaching a layer of 5 cm . for each tray . the trays are stacked in a muffle one on top of the others , with some space between them for combustion fumes to escape . the normally methane operating muffle is programmed in such a way to reach within it a temperature of approximately 200 - 400 ° c . for 1 - 3 hours , then it is raised to a temperature of about 500 - 900 ° c . for 3 - 5 more hours , or anyway until the complete removal of the organic portion from the mixture of drugs introduced . the first period of time , at a temperature of 200 - 400 ° c ., is essential in order to obtain a perfect light coloured mineralised product , without any carbonised organic products . the mineralised product obtained from the muffle is subjected to a quantitative analysis for being titrated , at least in its main elements , and to a control in order to verify the absence of elements recognised as toxic . it can be conveyed in the packaging division , or first mixed with additional chosen active principles , and hence sent to the packaging . however , the invention is illustrated here as follows with reference to two applications for the production of different highly concentrated mineralised natural complexes . the proportion for the mixing has been chosen according to the content of iron in the single drugs above - indicated , in particular : the selected vegetal drugs have been cut until reaching a uniform granulometry that is adequate to be mineralised . the optimal granulomethy is the following : the aforesaid fragmented mixture has been distributed on the stainless steel trays until reaching a layer of about 5 cm . of drug for each tray . the trays are stacked one on top of the other , with some space between them for the combustion fumes to escape . the methane operating muffle is programmed to reach within it a temperature of approximately 300 ° c . for a time of 2 hours at first , then it is raised and kept at a temperature of approximately 700 ° c . for 4 more hours . the first step at 300 ° c . is essential in order to obtain a perfect white coloured final product completely inorganic . the mineralised product is encapsulated in gelatine capsules with a final weight of about 500 mg . in this process the obtained mineralised complex contains all the mineral substances originally contained in the raw materials in form of oxides and other salts . the composition of the mineralised complex is the following : ______________________________________element concentration in the complex in mg / g______________________________________iron 7 . 73 calcium 109 . 8 zinc 0 . 19 magnesium 21 . 75 potassium 85 . 0 sodium 9 . 3 copper 0 . 03 manganese 0 . 49______________________________________ due to the high concentration of iron and the relatively high specific weight of the mineralised complex , only four capsules a day are sufficient to obtain a good daily integration of such element ( the daily recommended ration of iron is 14 mg . according to the italian law ). as a matter of fact , the solubility , and therefore the bio - availability with a ph : 1 , is extremely high : in fact 2 g . of product are 93 . 05 % soluble in one litre of hydrochloric acid with a ph : 1 at 37 ° c . ( liquid simulating gastric juice ). the proportions for the mixing have been chosen according to the calcium content in the single above - mentioned drugs , in particular : the selected vegetable drugs have been cut until reaching a uniform granulometiy , adequate for being mineralised . the optimal granulometry for each drug is the following : after having mixed the drugs , separately chopped up by following the above - mentioned granulometry , the mixture is distributed on steel trays until reaching a layer of 5 cm . of drug for each tray . the trays are stacked one on top of each other , with some space between them for the combustion fumes to escape . the muffle , normally heated with methane , is programmed in such a way to reach within it a temperature of approximately 300 ° c . for 2 hours , then it is raised and kept at a temperature of about 700 ° c . for 4 more hours . the first step at 300 ° c . is essential in order to obtain a perfect white coloured final product and completely inorganic . the mineralised product is encapsulated in gelatine capsules with a final weight of about 500 mg . in this process the obtained mineralised complex contains all the mineral substances originally contained in the raw materials in form of oxides and other salts . the composition of the obtained mineralised complex is the following : ______________________________________element concentration in the complex in mg / g . ______________________________________iron 1 . 9 calcium 299 . 5 zinc 0 . 46 magnesium 33 . 74 potassium 94 . 6 sodium 8 . 5 copper 2 . 5 manganese 4 . 08______________________________________ due to the high concentration of calcium and the relatively high specific weight of the mineralised complex , only five capsules per day are sufficient to obtain a good daily integration of calcium ( in italy the recommended daily ration of calcium is of 800 mg .). in fact , the solubility , and so the bio - availability with a ph : 1 , is extremely high : 2 g . of product are 77 . 15 % soluble in a little of hydrochloric acid with a ph : 1 at 37 ° c . ( liquid simulating gastric juice ). the process is repeated for any other individually chosen vegetal and / or animal product , or in combination with other organic products characterised by a high content of metal or metals , through which the integration of mineral oligoelements in humans , animals or plants is intended to be operated .

the invention concerns a highly concentrated mineralised natural complex , characterised by at least one main mineral element quantified with nutritional and / or dietetic integrator properties and by other mineral elements obtained in the complex from the mineralization of vegetal and / or animal products . moreover , it concerns the method for its production consisting in using vegetal and / or animal organic substances , having a high content of oligominerals , in carrying out their fragmentation , their mixing and the mineralization until the inorganic part is completely separated from the organic part , and then in transforming the aforesaid inorganic part in forms of easy commercialization .

illustrated in fig1 and 3 is the exterior box or container 10 for the curtain puller . the box 10 may be constructed of metal or plastic halves that merely snap together or are fastened together with mechanical fasteners . adjacent to the top of the box is a separate cover piece 12 open at the top and affixed to the front of the box 10 . within the cover 12 is a drive pulley 14 mounted on a motor drive shaft extending from a small electric motor 16 within the box 10 . the pulley 14 engages the drapery or curtain cord 18 in turn extending downwardly about the pulley 14 and upwardly to the curtain rod ( not shown ). thus , the electric motor 16 drives the curtain cord 18 to open or close the curtains or drapes . in other words , the motor 16 moves the object or curtains from an open first position to a closed second position or vice versa . below the box is a bracket 20 that may be attached to the wall of a house adjacent a window with mechanical fasteners through the holes 22 in the bracket . within the bracket 20 is a transverse rod 24 to which a pair of springs 26 are attached at their lower end . the upper ends of the springs 26 are attached to a second transverse rod 28 in turn affixed to the inside of the back of the box 10 . the springs 26 provide suitable tensioning for the curtain cord 18 . atop the box 10 is a small shield 30 which may be manually rotated about a vertical axis . the shield 30 has an opening 32 to permit light to enter therein . inside the shield is a photocell connected to the internal circuitry of the curtain puller . a 110 volt ac power supply cord as indicated at 34 extends into the box 10 and is attached to a rectifier and motor power circuit indicated at 36 . also inside the box 10 is a printed circuit board 38 to which are attached the electric elements comprising the control circuit for the curtain puller . as shown the box 10 encloses the entire electric control and power supply for the curtain puller . the box 10 is not substantially larger than a conventional spring tensioner for a curtain cord loop . fig4 a , 4b , and 4c illustrate the control and power circuitry for the curtain puller . with the exception of the 110 volt ac power supply cord 34 and plug for the electrical power to the curtain puller , the control and power circuitry is entirely contained within the box 10 . referring in particular to fig4 c , a fuse f1 and transformer t1 in the 110 volt ac supply provide power to a regulator circuit comprising a diode bridge 40 and an integrated circuit regulator reg - 1 . the regulator circuit provides 12 volts dc power to the control circuit illustrated in fig4 a and 4b and to the isolator circuit including opto - isolators ic1 and ic2 shown in fig4 c . the transformer t1 also provides ac power at reduced voltage to the pulley drive motor 16 through the triacs q1 and q2 . triacs q1 and q2 are in turn triggered by signals respectively from opto - isolators ic1 and ic2 . in other words , the transformer and regulator circuit act as a power supply means for supplying power from the 110 ac power source to the control circuit and motor . a suitable motor 16 is a reversible 24 volt 60 cycle ac motor . a reversible dc motor might be substituted for motor 16 with suitable changes in the power supply to provide dc current and solid state switching means in substitution for triacs q1 and q2 . the opto - isolators or optical couplers ic1 and ic2 provide electrical isolation between the ac power for the motor 16 and the low voltage substantially dc control signals in the control circuit shown in fig4 a and 4b . the signal through the opto - isolators ic1 and ic2 is provided by a 12 volt dc signal in turn controlled by a pair of transistors q3 and q4 . the pair of optically isolated connection circuits is between transistor q4 and triac q1 and between transistor q3 and triac q2 . thus , the control of rotational direction of the motor 16 is determined by a signal from opto - isolator ic1 to triac q1 , or for the other direction , by the signal from opto - isolator ic2 to triac q2 . the control circuit identified by the reference 38 to a printed circuit board within the box 10 comprises in fig4 a and 4b a photo - electric cell q5 which is contained within the hooded cover 30 at the top of the box 10 . in response to a sufficient increase or decrease in light the photo cell q5 provides an input to an integrated circuit ic3 which in turn provides an output at pin 7 of a sudden up or down voltage change as indicated by arrows 42 and 44 . in other words , the photoelectric cell q5 is a light sensing means for detecting changes in levels of light , i . e ., presence or absence of light in the daytime and nighttime , respectively . the sudden change in voltage up 42 or down 44 is provided as an input to pin 4 of integrated circuit ic4 which in turn massages the signal to provide through integrated circuit ic7 a reset and start signal illustrated by the &# 34 ; one shot &# 34 ; 46 at pin 4 of integrated circuit ic7 . the reset and start &# 34 ; one shot &# 34 ; 46 in turn is provided to pin 6 of a dual timer integrated circuit ic5 . a suitable integrated circuit ic4 is a motorola monostable multivibrator mc14538b or equivalent . integrated circuit ic5 is a national semiconductor dual timer lm556 or equivalent . the reset and start &# 34 ; one shot &# 34 ; 46 is also provided through integrated circuit ic8 from pin 3 to the base of transistor q6 , which with the associated circuitry and dual timer ic5 provides a ramp function timing signal that increases in voltage continuously from the moment that the &# 34 ; one shot &# 34 ; reset and start signal is received . typically , this ramp function , as indicated schematically by arrow 48 on the xy plot adjacent transistor q6 , constantly increases the charge on capacitor c6 until a prespecified voltage is reached . each time the signal from the photocell q5 passes a threshold of increasing light or decreasing light an up or down voltage change is generated by integrated circuit ic3 and sensed at the base of transistor q6 to reset the ramp function output 48 by discharging capacitor c6 . typically the ramp function circuit elements connected between transistor q6 and pins 1 , 2 and 3 of integrated circuit ic5 are specified to provide about a 15 minute time period from start or reset until a specified voltage is reached . thus , short term changes in light level sensed by the photo electric cell q5 do not result in actuation of the control circuit beyond resetting the ramp function output 48 . once the specified ramp function voltage is reached , the second timer of integrated circuit ic5 is actuated by the output 1 at pin 5 to t2 pin 8 . the second timer includes the circuit elements connected to pins 7 , 11 , 12 and 13 of integrated circuit ic5 . the potentiometer p1 provides adjustable means for setting the length of time the motor 16 operates by setting the specified ramp function maximum voltage for the second timer . with actuation of the second timer an output 2 signal at pin 9 is provided to pin 3 of integrated circuit ic6 which acts as a flip - flop or latch to determine the current state or position of the motor 16 and thereby determine the current position of the curtain . a suitable integrated circuit ic6 is motorola dual flip - flop mc14013b or equivalent . the flip - flop integrated circuit ic6 thereby permits or does not permit the motor to operate depending upon the direction of operation of the motor the previous time the motor was actuated to move the curtain . in other words , the flip - flop or latch acts as a latching means for determining the current position of the motor in either of the first and second positions and for actuating the motor to move the object or curtain to the position opposite the current position of the object or curtain . the status of the integrated circuit ic6 can be easily determined by the light emitting diode d8 which is connected to pin 9 of integrated circuit ic6 and illuminated when the curtain is in the closed position . a by - pass or a manual switch s2 is also provided so that the curtain can be conveniently opened or closed as desired during the night or during the day . the manual closure or opening of the curtain is sensed through the connection to pins 2 and 5 of integrated circuit ic6 . the output from integrated circuit ic6 pins 1 and 2 respectively provide one - half of the control to the base of transistor q4 or the base of transistor q3 thereby determining the direction of rotation . the other half of the control is provided by the output at pin 9 of the dual timer ic5 . once actuated by the output at pin 9 of integrated circuit ic5 the motor operates for a period of time necessary to move the curtain as set by the exterior circuitry and potentiometer p1 of the second timer of dual timer ic5 . the second timer circuit is also actuated by engaging the manual switch s2 to also start the motor running with the second timer . in either case the motor runs for a set period of time sufficient to open or close the curtain . in summary , the flip - flop circuitry only permits the motor to operate when either the signal from integrated circuit ic3 or from the manual switch s2 , if thrown , provides for movement of the curtain opposite to that of the previous movement of the curtain .

an automatic electro - mechanical device for opening and closing a curtain or drapery in response to changed light striking a photoelectric cell on the device . the device comprises a miniature high torque reversible electric motor and control packaged in a container of substantially the same size as a conventional cord tensioner of curtains or draperies . to close the drapes at sun - down and open the drapes at sun - up automatically without actuation if the lighting changes for short periods of time , the device comprises a dual timer circuit with individual ramping circuits . one timer circuit monitors the sustained presence or absence of light for a predetermined amount of time . the other timer regulates the motor drive run time . a flip flop circuit signals the current state of the curtains or drapes by providing memory of the last directional movement of the motor .

as shown in fig3 , the present invention is a container includes a cup ( 1 ), a rigid lining ( 2 ) mounted inside the cup ( 1 ). the lining ( 2 ) is a prefabricated component combined to the cup ( 1 ) by injection molding . in other words , the lining ( 2 ) is first placed in the mode and then a transparent or translucent acrylic cup ( 1 ) is formed to wrap over the circumference of the lining ( 2 ) integrally as a whole by injection molding ; finally , they are never detached from each other . lining ( 2 ) is shaped as a half - mask , that is , the lining ( 2 ) only shields the lower half portion of the cup ( 1 ) but the upper half portion of the cup ( 1 ) is not shielded by the lining ( 2 ). users can see vegetable or fruit cubes are whipped or thrashed in the cup ( 1 ). if the lining ( 2 ) is shaped as a whole - mask ( as shown in fig1 ), the upper and lower half portions of the cup are shielded by the lining ( 2 ). users only look down on the vegetable or fruit cubes whipped or thrashed in the cup ( 1 ). lining ( 2 ) is combined to the inner wall of the cup ( 1 ) to form a shield screen characterized in that a number of teeth ( 21 ) projected from the inner wall of the lining ( 2 ) applied to grate fibers of vegetable and fruit . teeth ( 21 ) can be arranged in parallel with one another , but they are all arrayed in alignment with each other finally to form a crossed or columned shape of teeth array . rather , the lining ( 2 ) can be made of metal , glass , alloy , or non - alloy material , which is with a hardness rather rigid than the acrylic cup ( 1 ). lining ( 2 ) is an annular member formed integrally as a whole one , but which is preferred in the shape of polygon . a lining base ( 21 ) can be added to the bottom of the cap ( 1 ) as a shield screen thereof . the top end of the lining ( 2 ) has an l type wall ( 25 a ) bended outward and upward , the bottom end of the lining ( 2 ) has an l type wall ( 25 b ) bended inward and downward respectively . both l type walls ( 25 a , 25 b ) are embedded into the inner wall of the cup ( 1 ) to eliminate the permeation of liquid through a chink on the wall . cup ( 1 ) has a handle ( 12 ) and a spout ( 13 ). several vertical ribs ( 11 ) are protruded from the inner wall of the cup ( 1 ); several vertical stopper members ( 22 ) corresponding to the ribs ( 11 ) are also formed on the obverse side of the wall of the lining ( 2 ), hollowed troughs opposed to the stopper members ( 22 ) are formed on the reverse side of the wall of the lining ( 2 ), the hollowed troughs are suitable for matching up and receiving the vertical rib ( 11 ). as shown in fig6 , look down on the cup ( 1 ), and the lining ( 2 ), a facet ( 111 ) of the rib ( 11 ) and a facet ( 221 ) of the stopper members ( 22 ) can be formed as perpendicular spoilers which dampen vibration of the vegetable and fruit fibers ( as shown in fig7 ) but sweep them in the whirlpool ( 4 ) as much as possible to the center thereof ; and then to the lower half portion of the cup ( 1 ) being crumbled by the straight blades . but only a few rough and long fibers ( 41 ) are forced into the center of the whirlpool , most of them still left outside the inner circle of the whirlpool ( 4 ). as shown in fig7 , when the straight blades ( not shown ) is rotated in high speed , rough and long fibers ( 41 ) in the whirlpool ( 4 ) remained in the teeth ( 21 ) on the surrounding inner wall of the lining ( 2 ) will soon be grated and chopped into pieces . possibility of the rough and long fibers being grated is greatly improved . though the fibers all are not easily forced into the whirlpool center at once , they can be chopped into pieces by the teeth ( 21 ) as well . therefore , the duration for the blender stirring the chopped fibers is reduced ; meanwhile , possibility of oxidization of the stirred juice is also reduced . rather , the top end of the stopper members ( 22 ) has a number of teeth ( 21 ′) projected up thereof , by means of the projected teeth ( 21 ′), the fibers of vegetable and fruit can be further grated and chopped into pieces . the teeth ( 21 ′) projected up from the top end of the stopper members ( 22 ) are advantageous to the grinding . as shown in fig8 , the container of the blender includes a cup ( 1 ), and a rigid lining ( 2 ) mounted inside the cup ( 1 ). first , each of the cup ( 1 ) and lining ( 2 ) are prefabricated components , and then the lining ( 2 ) is mounted inside the cup ( 1 ) and combined to the cup ( 1 ) integrally as a whole . after combination , the assembled view of the container is illustrated as shown in fig9 . the lining ( 2 ) is shaped as a half - mask . but several prop stands ( 23 ) extended from the top rim of the hood ( 2 ) to a height adjacent to the top rim of the cup ( 1 ), a horizontal ring ( 24 ) is connected to the top ends of the prop stands ( 23 ). the horizontal ring ( 24 ) is convenient for the users to hold , and when the lining ( 2 ) is mounted inside the cup ( 1 ), the horizontal ring ( 24 ) placed on the l - shape ( i . e . like a top step of a ladder ) top rim of the container which is suitable for a lid ( not shown ) capped over the container , then the horizontal ring ( 24 ) is sandwiched between the container and the lid . therefore the lining ( 2 ) can be mounted inside the container without any movements . as shown in fig1 , the container of the blender includes a cup ( 1 ), and a rigid lining ( 2 ) mounted inside the cup ( 1 ). the cup ( 1 ) and the lining ( 2 ) are prefabricated separately , and then the lining ( 2 ) is embedded into the cup ( 1 ) and combined to the cup ( 1 ) integrally as a whole . after combination , the assembled view is illustrated as shown in fig1 . the lining ( 2 ) is shaped as a half mask , which is composed of a number of lining pieces ( 2 a ). a stopper member ( 22 ) is formed on the obverse side of the lining piece ( 2 a ) as well as the teeth ( 21 ) are arrayed on the same side . the first facet of the stopper member ( 22 ) is bended inward to form a buckled piece ( 222 ). a groove ( 113 ) is defined on the first facet of the rib ( 11 ) of the cup ( 1 ), the buckled piece ( 222 ) can be led into the groove ( 113 ) in place and then the rib ( 11 ) enclosed inside the hollowed trough formed on the reverse side of the stopper member ( 22 ). the second facet of the lining pieces ( 22 ) is a flat facet directly leads into a trench ( 112 ) defined on the second facet of the rib ( 11 ) of the cup ( 1 ). a number of teeth ( 21 ′) can also be arranged on the top end of stopper member ( 22 ). rather , the lip ( 26 ) is extended radially outwardly from the top rim of the lining pieces ( 2 a ) is convenient for the user to hold when the lining pieces ( 2 a ) are assembled or disassembled with each other . as shown in fig1 , the container of the blender includes a cup ( 1 ), and a rigid lining ( 2 ) mounted inside the cup ( 1 ). the cup ( 1 ) and the lining ( 2 ) are prefabricated components . the lining ( 2 ) is embedded into the cup ( 1 ) and then combined to the cup ( 1 ) integrally as a whole . after combination , the assembled view is illustrated as shown in fig1 . the lining ( 2 ) is shaped as a whole mask . the lining ( 2 ) is composed of a number of lining pieces ( 2 b ), but the top rim of the lining ( 2 ) is bended outward to form a horizontal ring ( 27 ). the horizontal ring ( 27 ) is not only convenient for the user to hold to assemble or disassemble the lining pieces ( 2 b ), but the horizontal ring ( 27 ) can be placed on the top step of the ladder like top rim of the container so as the horizontal ring ( 27 ) can be sandwiched between the cup ( 1 ) and the lid ( not shown ) without any movements .

the present invention is aimed to provide a container of the blender . it can prevent the inner wall of the container from abrasions and blemishes . further , the time - consuming for fibers of the fruit and vegetable being grated and chopped can be reduced . the container of the blender includes a cup , a lining mounted inside the cup characterized in that the lining as a shield screen on the inner wall of the cup , the inner wall of the lining has a number of teeth projected thereof for grating the fibers of the vegetable and fruit .

the catheter comprises a calibrator oval 10 , a flexible shaft 12 , a manifold 14 which serves for the connection of a syringe 16 to the instrument , a balloon 18 which is longitudinally extensible from the oval 10 under the fluid pressure applied by syringe 16 and thereafter laterally expansible under increased fluid pressure , and a guide wire 20 to be pulled to re - invert the balloon 18 within the oval 10 . a blood vessel 22 partially occluded by occlusion 24 is provided with an incision 26 for the introduction into the vessel of the catheter . the catheter is moved along the vessel until the oval 10 bears against the end of occlusion 24 , as shown in fig1 . the syringe 16 is then attached to manifold 14 and actuated to evert the balloon 18 and extend it into the restricted lumen of occlusion 24 . the fluid pressure is then increased to radially expand the balloon and compress the occlusion . the fluid pressure is then reduced by reverse operation of the syringe and the syringe is removed from manifold 14 . wire 20 is then manually pulled to re - invert the balloon within the oval . the oval is then moved within the compressed occlusion 24 . ready movability of the oval through the occlusion indicates that the occlusion has been adequately compressed . if the oval is not readily movable through the occlusion the instrument is used to further compress the occlusion . once the occlusion has been suitably compressed the instrument may be moved further along the vessel 22 , as indicated in fig4 if there is a further occlusion to be treated . the details of construction of the instrument are shown in fig5 - 6 . the oval 10 and shaft 12 are formed by a tightly wound helical spring 28 which provides the catheter with sufficient flexibility to enable its movement through tortuous arteries . the oval and shaft are provided with an overcoating 30 of silicone , heat - shrink tubing , teflon , or the like . the balloon element 18 is made of an elastomeric material such as latex . one end of the balloon is attached to the end of the oval 10 and the other end of the balloon is attached with suture 32 to guide wire 20 . the wire 20 is small in diameter relative to the internal diameter of spring 28 to provide an annular fluid passage between the syringe 16 and balloon 18 . expansion of the balloon element out of the end of the catheter takes place in anisotropic fashion , with the balloon element first everting out of the catheter in advance of substantial lateral expansion , and then , after eversion , laterally expanding in response to the continued exertion of fluid pressure internally of the catheter . optimal dimensional data for the catheter and the balloon element are set forth in my co - pending application ser . no . 060 , 408 . while the invert - evert form of balloon is preferred , other types and forms of balloons may be used as long as they do not impede the movability of the catheters through the arteries and as long as they do not interfere with the use of the calibrator ovals to measure or calibrate the inside diameters of the arterial lumens .

a catheter is provided with an inflatable - deflatable balloon element to radially enlarge a partially occluded artery lumen and the catheter is provided with a calibrator oval to internally gauge the enlarged lumen .

turning now to the drawings wherein several preferred embodiments of the invention are shown , in fig1 , a conventional , well known agricultural cutting machine , which is a combine 20 , is shown including a header 22 . header 22 is shown supported in the conventional , well - known manner on a forward end 24 of combine 20 , and is operable for cutting or severing crops such as , but not limited to , small grains such as wheat and soybeans , and inducting the severed crops into a feeder 26 for conveyance into combine 20 for threshing and cleaning , in the well known manner , as combine 20 moves forwardly over a field , as denoted by arrow f . referring also to fig2 , which is a side view of header 22 , header 22 includes a pan or floor 28 which is supported in desired proximity to the surface of the field during the harvesting operation , and an elongate , sidewardly extending sickle 30 along a forward edge portion 32 of floor 28 , sickle 30 being operable for severing the crop for induction into header 22 , as will be explained . header 22 additionally includes an elongate , sidewardly extending reel 34 ( shown in outline form in fig1 ) disposed above sickle 30 and rotatable in a direction for facilitating induction of the severed crops into header 22 . an elongate , rotatable auger 36 ( also shown in outline form in fig1 ) that extends in close proximity to a top surface 38 of floor 28 and has helical flights therearound is operable in cooperation with reel 34 for conveying the severed crops toward an inlet opening of feeder 26 for induction into combine 20 , in the well - known manner . referring more particularly to fig1 , sickle 30 extends in a sideward direction along the width of floor 28 , between a first side edge portion 40 of the floor , and an opposite second side edge portion 42 . sickle 30 includes an elongate , sidewardly extending cutter bar assembly 44 supported in substantially longitudinally aligned relation adjacent to forward edge portion 32 of floor 28 , along the length thereof . referring also to fig3 , 4 and 5 , cutter bar assembly 44 includes a plurality of forwardly extending , elongate guards 46 arranged in a sidewardly extending , spaced apart array , along the forward edge portion of header 22 . each guard 46 is preferably of cast metal and includes a rearwardly located base 48 , which is suitably attached , here by a bolt 50 and a nut 52 , to a fixed bar 54 or other fixed structure of assembly 44 . here , it can be observed that guards 46 are provided in pairs connected together by a crossmember , although it should be understood that , alternatively , they could be provided individually , or connected together in a greater number , with equal utility for the purposes of the present invention . each guard 46 additionally includes a forwardly extending finger 56 attached to base 54 , finger 56 having a forwardly located forward tip 58 . each finger 56 includes oppositely facing side surfaces 60 and 62 which extend forwardly from adjacent base 48 to tip 58 , and which taper convergingly as they approach tip 58 . each finger 56 also includes an upwardly facing surface 64 which extends from base 48 to tip 58 . each finger 56 includes a slot 66 extending therethrough between side surfaces 60 and 62 , intermediate base 48 and tip 58 , slots 66 of the respective fingers 56 being aligned along the length of sickle 30 . referring more particularly to fig2 and 5 , cutter bar assembly 44 supports an elongate sickle knife 68 for reciprocating longitudinal movement within slots 66 , knife 68 including a row of knife sections 70 including oppositely facing , angularly related knife edges 72 which , in conjunction with site surface 60 or 62 of adjacent guards 50 , respectively , effect a shearing or cutting action which severs plant stems and stalks or other material captured between the knives and the guards as the knife sections are reciprocatingly moved sidewardly , as denoted by arrow a in fig5 . guards 46 will typically extend beyond sickle knife 68 by no more than 12 inches , as it may be desired under some conditions to have a capability to point the guards downwardly at a small acute angle to the ground , for instance , with the sickle close to the ground , for harvesting downed crops , without the guard tips entering the ground . it is also desirable for the guards to have a smooth streamlined shape , which is relatively narrow , so as to smoothly guide the crops into the spaces therebetween , for cutting . as noted above under the background art heading , as combine 20 is moved forwardly over a field containing crops , sickle knife 68 will be moved reciprocatingly sidewardly relative to guards 46 , to sever the crops which enter the spaces between guards 46 . knife edges 72 will capture and cut the stems or stalks of the crop plants against the side surface 60 or 62 of the adjacent guard , in an area denoted as a cutting zone 74 illustrated in relation to the leftmost guard 46 in fig5 . as a result of the cutting action , and particularly if the crop is dry and / or knife edges 72 are dull , and / or the side edge of the slot is worn and rounded , and also as a result of being batted by reel 34 , grain can be loosened from the crop plants , e . g ., pods shattered , such that the loose grain will fall onto sickle 30 , and onto any plant material thereon , so as to be in danger of falling to the ground and being lost . grain can also be shaken loose if the guards are large , or are not sufficiently streamlined for smooth crop flow therepast , or have obstructions that extend into the crop flow path , so as to shake or jar the crops as they are inducted into the sickle . this can be particularly problematic in drilled crops which lack defined rows and thus increase the possibility of guards 46 being propelled directly into plants during the cutting operation . referring more particularly to fig2 , loose soybeans 76 are depicted in the area above sickle 30 , as would be typically present during the harvesting of crops such as soybeans or other legumes , as well as other small grains . if not captured , at least some of loose grains 76 would typically be lost , for instance by falling through the spaces between knife sections 70 and guards 46 , or by falling forwardly over the front edge of the sickle . to avoid or reduce the occurrence of grain loss in the above described manner , an air discharge system 78 is incorporated into some and preferably all of guards 46 of sickle 30 , according to the present invention . air discharge system 78 includes at least one rearwardly facing air discharge nozzle 80 incorporated into upwardly facing surface 64 of each finger 56 , and an air flow passage 82 extending internally through each finger 56 from an air inlet 84 located adjacent to base 48 , to nozzle 80 , for delivering a flow of pressurized air thereto . the pressurized air is provided by a suitable source thereof , such as , but not limited to , an air pump or air compressor 86 disposed at a suitable location , such as on header 22 , and which is suitably powered , for instance , by a fluid motor , belt , shaft , chain , or the like , in the well - known manner . compressor 86 is connected to air inlets 84 , for delivering pressurized air thereto , via an air distribution system which will preferably include a main air manifold 88 extending sidewardly beneath floor 28 of header 22 , and including a plurality of nipples or small air distribution tubes 90 emanating therefrom at appropriately spaced locations therealong corresponding to the locations of air inlets 84 . smaller air distribution tubes 90 are shown extending from manifold 88 individually to air inlets 84 . alternatively , it should be recognized that a variety of different air distribution system configurations can be utilized according to the present invention . the configuration and location of air discharge nozzles 80 on surfaces 64 of respective fingers 56 can be varied according to the preferences and / or requirements for a particular application . generally , it will be an objective of the invention for nozzles 80 to be minimally if at all obstructive to crop and plant flow over and passed fingers 56 , such that little or no resultant additional jarring or disturbing of the plants passing over the nozzle occurs so as to result in additional loosening of grain from the plants . additionally according to the invention , an objective will be to generate rearwardly directed pressurized air flows that will be effective in blowing and directing loose grain on to floor 28 to capture the loose grain and prevent loss thereof . further according to the invention , it will be an objective to minimize susceptibility of plugging of nozzles 80 by plant material and the like . still further , it will be an objective when incorporating nozzles 80 and air flow passages 82 into fingers 56 , to maintain and not significantly degrade the structural integrity of the fingers , or to materially change the operability thereof . in accordance with the above objectives , several embodiments of nozzle configurations of the invention are illustrated in fig2 through 9 . referring more particularly to fig2 , 4 , 5 , and 7 through 9 , nozzles 80 are illustrated as rearwardly directed and recessed into upwardly facing surface 64 of fingers 56 . of these , nozzles 80 of fig2 , 4 , 5 and 8 are circular shaped , and nozzles 80 of fig8 and 9 are diamond shaped . this represents a range of acceptable nozzles and is thus not intended to be limiting . each nozzle 80 is also illustrated disposed at a forward end of a rearwardly extending recessed channel 92 , which , in cooperation with the nozzle configuration , facilitates and guides the pressurized air flow in a desired pattern , without significantly disrupting crop flow over upwardly facing surface 64 of the finger . however , it should be noted that other locations , including a more forward location , can be utilized according to the invention . referring more particularly to fig2 , the pressurized air flow , denoted by arrows 94 , is illustrated as flowing along a relatively low , rearwardly directed trajectory over sickle 30 and forward edge portion 32 of floor 28 . referring in particular also to fig5 , fig5 and 6 , air flow 94 is also illustrated from the side in fig8 . here , it should be recognized that the configuration , including , but not limited to , size , shape , and angular orientation , of nozzles 80 can be determined for a particular application , as can the configuration , e . g ., size , shape and angular orientation of the channel 92 if used . fig5 illustrates possible air flow patterns that can be achieved with the nozzles of the invention , including a narrower pattern that generally extends over the base region of the guard in which the nozzle is located , as defined by lines 96 emanating from the respective nozzles , and a wider fan shape pattern that extends over a greater portion of the sickle knives also , as defined generally be lines 98 . referring in particular to fig3 , a nozzle 80 which is substantially flush with surface 64 is shown , the nozzle having a generally oval or tear drop sectional shape when viewed from above . again , this illustrates the variety of nozzle configurations that can be used according to the invention . referring more particularly to fig6 , still another nozzle configuration is illustrated , which is a multiple nozzle arrangement including an array of three nozzles 80 disposed in surface 64 , facing in slightly offset directions , and configured to discharge streams of pressurized air in a wide ranging fan pattern , illustrated again by lines 98 emanating from each of the nozzles . here , it should be noted that the number of nozzles , positions , and orientations , on a finger can be varied , as desired or required for a particular application . in the fore and aft direction , nozzles 80 are preferably disposed so as to most advantageously direct the pressurized air for recovering or protecting from the loss of loose grain , without degrading the integrity and strength of the fingers . in the embodiments shown , nozzles 80 are generally located above a forward region of slot 66 through which the sickle knife reciprocates . to achieve this location , air flow passage 82 has a generally v shape , including a lower portion 100 which is routed forwardly through the finger below slot 66 , and an upper portion 102 which connects with lower portion 100 and extends rearwardly therefrom to the nozzle , or nozzles , as variously shown in the figs . air flow passage 82 can be cast in place in the finger . essentially , the fore and aft location selected here has been found to be advantageous as it places the nozzles close to the cutting zone where the largest portion of the loose grain has been typically found to be present , such that the air will be at its greatest pressure where the grain is found , and will be less likely to be dissipated by intervening plant material such as leaves , stems and the like which will be passing through the cutting zone also . it will be understood that changes in the details , materials , steps , and arrangements of parts which have been described and illustrated to explain the nature of the invention will occur to and may be made by those skilled in the art upon a reading of this disclosure within the principles and scope of the invention . the foregoing description illustrates the preferred embodiment of the invention ; however , concepts , as based upon the description , may be employed in other embodiments without departing from the scope of the invention . accordingly , the following claims are intended to protect the invention broadly as well as in the specific form shown .

a guard for a sickle of an agricultural plant cutting machine includes a forwardly extending finger including a longitudinally extending , upwardly facing surface extending over the sickle , which includes a rearwardly facing air discharge nozzle therein located above and / or forwardly of the sickle , and the finger includes an air flow passage extending internally therethrough from an air inlet adjacent to a base of the finger to the nozzle , for delivering a flow of pressurized air thereto , the nozzle being at least mostly flush with or recessed into the upwardly facing surface . as a result , the nozzle is operable for discharging the flow of air rearwardly over the finger without obstructing plant material flow thereover , the air flow being sufficient to blow at least a substantial amount of loose grain and other plant material located forwardly of the front edge of a header floor of the machine , onto the floor for collection by a conveyor of the header for processing .

referring now to the drawings , and particularly to fig1 a two - level storage and display rack , adapted for mounting on a store counter , is shown generally at 10 . the storage rack shown in fig1 has only two tiers , but more tiers may be provided using vertical spacers , as shown in fig3 and 5 , to space the additional tiers apart . each shelf , or tier , of the two - tiered display rack example of fig1 may be provided of a size , to have supported thereon , the goods - containing portion of a box of counter goods , such as chocolate bars , chewing gum , or other goods that the store keeper may be offering for sale . a five - tiered rack , using structural elements as disclosed hereinafter , has been constructed and has been demonstrated to be of stable construction . the horizontally elongated shelf of the lowermost tier of display rack 10 is generally indicated by numeral 12 , with an upper , second , horizontally elongated tier shelf 14 spaced above said lowermost tier shelf 12 . each of the tier shelves 12 and 14 has associated , elongated , edge rails that are similarly constructed , so that a detailed description of the edge rail elements , and other features of construction of the lower tier shelf 12 will operate to provide a description of similar elements shown associated with the second tier shelf 14 . some elements , such as the specific vertical , columnar , side spacers 16 , that are positioned to extend between side rails associated with the two shelves 12 and 14 are shown assembled only in fig1 - 3 , in position on vertically aligned side rails to serve as a spacer and a support . the exploded view of fig5 illustrates how these vertical spacers may be used either above or below a tier that includes one horizontal tier shelf for supporting another tier shelf , and these spacers may , for example , be used below the tier shelf 12 shown in fig5 or between a pair of tier shelves 12 and 14 , to serve to either support the lowermost tier above a counter , or to space a next higher tier above a next lower tier . in the specific illustrations in the figures , the lower tier includes a flat , planar , horizontal support shelf member 12 . the forwardmost end of shelf member 12 is provided with a transverse abutment wall 20 that lies in a plane transverse to the plane of shelf member 12 , and is secured to shelf member 18 by any means , such as by being glued or melded thereto . the portion of the transverse , forward abutment wall 20 that extends above the upper surface of shelf 12 , is positioned to serve as an abutment against which a wall of a body , or box , that is supported on shelf 12 may abut . the rear end of the storage and display rack 10 , that is opposite forward wall 20 , is open , so that an attendant may easily withdraw an empty box supported on the shelf 12 , and insert onto the shelf 12 , from rearwardly of the rack 10 , a fresh , or replacement , box with goods therein . the lower tier shelf 12 is provided , along each of its longitudinal edges , with associated , elongated , upper and lower rail members , respectively 22 and 24 , whose assembled structural portions are best seen in fig1 - 4 , and whose overall shape may be seen in perspective in fig5 . an upper rail member 22 , located adjacent to the left edge of shelf member 12 , as viewed in fig1 and 3 , includes an elongated , upper side rail , or body , that is provided with an elongated upwardly - opening groove means 25 in the upper edge of rail member 22 that is bounded by spaced , upright , inner and outer , longitudinal side walls , 28 and 30 , that are spaced by transverse end walls 32 and 33 . the upper side rail along the right hand longitudinal edge of shelf 12 is of similar construction and is designated 22 &# 39 ;, and with the parts thereof using the same identifying numeral with a prime (&# 39 ;) mark . as seen in fig3 when a shelf , such as shelf 12 , and its side rails are assembled , only a portion of the total height of upper rails 22 and 22 &# 39 ; extend above the upper surface of shelf 12 . the lower rails 24 and 24 &# 39 ; each are of mirror image construction relative to its adjacent upper side rails 22 and 22 &# 39 ;. but while upper rails 22 and 22 &# 39 ; have only portions thereof located vertically above the plane of adjacent shelf 12 , the lower edge rails 24 and 24 &# 39 ; have all portions thereof located below the plane of shelf 12 . the lower edge rails 24 and 24 &# 39 ; each also include a downwardly opening elongated recess or groove 27 that is located in a mirror - image relation to the similar structures provided in upper rails 22 and 22 &# 39 ;, but as seen in fig3 all portions of lower side rails 24 and 24 &# 39 ; are located below the plane in which shelf 18 is located . one purpose of having a pair of laterally spaced upper rails 22 located adjacent the two longitudinal edges of shelf 12 is to provide a pair of longitudinal elements that may be moved toward or away from each other to engage , or accommodate , the width of the box that rests on shelf 12 , where the box is at least as wide as , or or wider than , the shelf 12 . if the width of a rectangular box on shelf 12 is less than the width of shelf 12 , then , at most , only one side wall of the box might be engaged by the innermost side of one of the two upper rails 22 or 22 &# 39 ;. since each of the two upper rails 22 and 22 &# 39 ; are mirror images of each other , the similar elements on rail 22 &# 39 ; carry the same identifying numeral as appears on rail 22 , but with a prime mark (&# 39 ;) added . it will now be seen , from fig1 and 5 together , that the upper and lower rail members adjacent the side edges of shelf 12 have an exterior shape that is essentially the same . it will be understood that , if desired or necessary , the rail members themselves may be provided with selected interior shapes and walls for receiving and cooperating with spacer members of different size as may be necessary , or desired . however , for purposes of the description herein , it is to be understood that all rail members will be fundamentally of the same shape and size , except as may be needed to provide a modification . fig1 and 3 illustrate how a pair of upper , side rail members , 22 and 22 &# 39 ;, are each assembled alongside the two longitudinal edges of both lower shelf 12 and upper shelf 14 . the underside of each shelf , 12 and 14 , includes the same structure as shown on the underside of shelf 22 in the exploded perspective view of fig5 . thus , the underside of each tier shelf , 12 and 14 , is provided with two pairs of spaced angle sections 26a and 26b that are secured , or otherwise adhered to , or melded with , the undersurface of said shelves to make an integral structure adjacent each of the two lateral edges of the shelf . also , and so that shelf 12 will not tilt , or slope , from front to back , the rear end of shelf 12 is provided with a rail 20 &# 39 ;, seen in exploded fig5 which extends below shelf 12 the same distance that the lower portion 20a , of transverse abutment wall 20 , extends below shelf 12 . as best seen in fig5 a shelf , such as either the planar support shelf 12 or 14 , has affixed to the underside thereof , such as by gluing , or melding , two sets of socket angle sections , 26a and 26b , that lie respectively adjacent the lateral shelf edges 12a and 12b . although aligned sets of separated socket angle sections 26a and 26b are shown , elongated angle - shaped sections , of the cross - section seen in fig4 could be used instead , and then the end portions of said elongated sections would be the equivalent of the structures shown . the said socket angle sections , together with the underside of the shelf 12 to which the socket angle sections attach , provide generally socket - like , or generally rectangular , tubular - like , sockets , or tongue - holding means , indicated at 26c , for slidably receiving thereinto , or therethrough , lateral extensions , or tongues , 22a and 22b , that extend from an upper rail 22 . the same sockets , or tongue - holding means , also receive lateral extensions 24a and 24b that extend from a lower rail 24 , as is seen in fig3 . as best seen in fig3 when a shelf 12 or 14 has its rails 22 or 24 assembled thereon , the socket angle sections 26a and 26b are of a size and spacing from the underside of the associated shelf 12 , so that the two adjacent tongues , 22a and 24a , or 22 &# 39 ; a and 24 &# 39 ; a , of the two rails 22 and 24 are held by the tongue - holding means against the undersurface of a planar support , such as 12 or 14 , in each socket space 26c provided between spaced , angled , flange sections 26a and 26b . the cross - sectional view of fig3 shows the upper rails 22 and 22 &# 39 ;, when moved to their closest spacing , which is controlled or dictated , by the fact that upper rails 22 and 22 &# 39 ;, as seen in fig1 and 3 , abut opposite lateral edges of shelf 12 , with rail 22 abutting shelf edge 12a while rail 22 &# 39 ; abuts an opposite shelf edge 12b , as seen in fig3 . the lower rails 24 and 24 &# 39 ; are not so constrained , but lower rails 24 and 24 &# 39 ;, are preferably to be selectively moved into a position of vertical alignment with a set of upper rails 22 and 22 &# 39 ;, as best seen in fig1 . alternatively , lower rails 24 and 24 &# 39 ;, may be selectively moved laterally inwardly until said rails abut the edges of angle flange sections 26a and 26b , or may be moved laterally outwardly of the position shown in fig3 provided that some portion of tongues 24a and 24 &# 39 ; a are not moved outwardly to a position where all portions of tongues 24a and 24 &# 39 ; a escape the tongue holding means provided by socket angle sections 26a and / or 26b . considering the structure shown in fig3 the lower rails , 24 and 24 &# 39 ;, could be moved inwardly toward each other until an innermost portion of those rails abut an edge of the socket angle sections 26a and 26b . referring now to the manner of effecting selective vertical spacing between the support shelves 12 and 14 , or between shelf 12 and the top of a counter upon which the tiered display of fig1 is supported , or between upper shelf 14 and a third shelf thereabove , the means for effecting such spacing utilizes the fact that each rail member 22 , 24 , 22 &# 39 ; and 24 &# 39 ; is provided with an interior groove means , such as the upwardly opening groove means 26 of rail 22 , that is bounded longitudinally , such as by side walls 28 and 30 as described above , and as seen in fig1 - 3 and 5 . more specifically , the groove means 26 does not provide a continuous slot along the length of its rail . instead , each rail , such as rail 22 seen in fig2 and 4 , and rail 24 as seen in fig3 and 5 , includes , in the groove means for the rail , one or more transverse ribs such as 40 and 42 , that are clearly shown in fig2 . to cooperate with such groove means and its transverse ribs 40 and / or 42 , there are provided vertical spacers , or columnar spacer means , in the form of planar , spacer plates 16 , referred to earlier above . these planar spacer plates 16 are of a thickness to slidably fit into the longitundinal space between spaced side walls 28 and 30 of a rail member 22 or 24 . within the longitundinal space between the spaced side walls 28 and 30 of the rail member , there are provided one or more transverse ribs 40 and 42 as seen in fig2 . the shape of spacer plates 16 are most clearly seen in fig1 and 5 . spacer plates 16 are rectangular in elevation as seen in fig5 with their length edges 46 being greater than their height edges 48 . as will appear from the following description , the rectangular spacer plates provide for two alternative spacings between shelves 12 and 14 . a pair of opposed notches , 44 , extending from the length edges of spacer plate 16 , are provided in alignment with each other and extend toward each other from the long edges 46 of the rectangular plate 16 . the length of the short edges 48 and 48 &# 39 ; of plate 16 provides an effective measure of one spacing between an aligned upper rail 22 , associated with lower shelf 12 , and a lower rail 24 , associated with upper shelf 14 , spaced thereabove as seen in fig1 . the notches 44 are of a size and shape to permit a spacer plate 16 to fit over a transverse rib 40 or 42 , here shown , in fig2 to be rectangular in cross section . the spacing of notch 44 from the distal short edge 48 &# 39 ; is selected so that when a notch 44 receives therein a rib 40 , as seen in fig2 the distal short edge 48 &# 39 ; of plate 16 will slide against , and engage the closest edge 42 &# 39 ; of rib 42 , as shown in fig2 . similar ribs provided in an opposite rail member , such as rail members 24 or 24 &# 39 ; ( seen in fig5 ) permits the spacer plate to provide for firm engagement and interconnection between a pair of oppositely facing rail members , such as between one lower rail 22 and an opposed upper rail 24 , as seen in fig1 . if a greater spacing is desired between a pair of shelves 12 and 14 , the spacer plates 16 are to be rotated ninety degrees ( 90 °) from their length position seen in fig1 to a width position where edges 48 and 48 &# 39 ; take the positions shown for long edges 46 as seen in fig5 . the length of edges 48 and 48 &# 39 ; are selected so that long edges 46 of a spacer plate 16 will slidingly fit between ribs 40 and 42 . in this latter arrangement , since a shorter edge of spacer plate 16 is captured in a groove , the spacing between a pair of spaced shelves 12 and 14 will be greater . the spacer plates may also be used as a pair of free legs to support lower rail members 24 and 24 &# 39 ; upon the surface of a flat counter , as suggested by the lower truncated spacer plates shown extending downwardly in fig3 . by inclining , or beveling the lower edges , of a pair of laterally spaced support legs extending downwardly from lower rail members 24 and 24 &# 39 ;, the tiered display stand may be converted to a stand wherein the goods supported thereon are displayed at an inclined attitude , with the goods on a shelf , such as shelf 12 , engaging the upper front flange 20 located at the forward end of a support shelf plate 12 or 14 . the material used in making the various parts shown in the figures of the drawings are a transparent plastic , thereby creating a tiered display stand that is eye - catching and attractive , while at the same time providing the rigidity and strength needed to serve the purpose as a display stand . the nature of the plastic material permits ease in forming and assembly , yet provides for inexpensiveness of construction and strength for the intended purposes . while a particular embodiment of this invention has been shown and described , it will be obvious to those skilled in the art that various changes and modifications may be made therein without departing from the spirit and scope of the invention and , therefore , it is intended in the appended claims to cover all such changes and modifications which fall within the true spirit and scope of the invention .

a variable width tiered display stand , which may be supplied in knocked - down condition , and which may be readily assembled at the site of use , is disclosed . the stand provides multiple tiers , each adapted for support of a box of boxed goods thereon , to provide an attractive means for display , and offer , of goods to prospective customers , while permitting the shopkeeper to easily withdraw empty boxes of goods from the tiers and to insert fresh boxed goods on the tiers as may be required or desired . the stands are preferably made of transparent plastic parts which may be easily fit together , and which do not require additional fastener means for keeping the tiered display stand assembled .

as shown in the drawing fig1 - 70 , the present invention is directed to a mission - adaptable set of components forming a convertible cart / utility table . for example , the present invention may include foldable cart 1 , having a load support for carrying a load , such as a boat , such as a canoe , which can also function as a game cart or a wagon for carrying gear in outdoor field applications . fig1 shows cart 1 in a disassembled storage position with a pair of horizontal load support members 10 laid parallel adjacent to each other , supporting wheels 30 thereon . wheels 30 are secured in place by a transverse connecting rod 31 through wheel hubs 30 a and by one or more load securing straps 50 . disassembled storage cart 1 is inserted within carry bag 120 , which includes ledge 121 and fabric loops 122 for holding bracket members 60 , 70 and handle 80 outside of carry bag 120 . to transport portable cart 1 by hand carry straps 124 are attached to carry bag 120 . conversely as shown in fig2 , to transport portable cart 1 upon the back of a user , carry straps 124 are attached to carry bag 120 , which supports portable cart 1 in a weight bearing manner , or else horizontal support members 10 are inverted to support portable cart 1 in a weight bearing manner , and carry bag 120 covers portable cart 1 in a non - weight bearing manner . to be disassembled in a carry position , u - shaped bracket rails 60 , 70 , wheels 30 and axle members 32 are inversely attached to horizontal load supports 10 to comprise a folded manually transportable cart . as shown in the exploded view of fig3 , in the storage position , in a preferred embodiment , cart 1 includes a pair of parallel , spaced apart inverted horizontal load support members 10 . support members 10 each have a front - end 10 a and a rear end 10 b . the front and rear ends 10 a , 10 b each have at least one axially placed receptacle aperture 12 extending longitudinally within each load support member 10 , for holding structural components therethrough in a storage position , such as axle members 32 for wheels 30 . in this storage position , axle members 32 are also inserted within aperture of 33 of axle connector 34 . fig3 also shows horizontal load support members 10 having preferably a generally upside down u - shaped configuration when viewed in cross - section , wherein a generally flat member 10 c has downwardly extending flanges 10 d , 10 e including one or more linearly extending slots 10 f for insertion of holding straps 50 therein . although apertures 12 are shown in the drawings , it is contemplated that other configurations may be applicable to horizontal load support members 10 , so long as other members , such as rails 60 , 70 and so forth , may be attached thereto by fasteners , preferably in an axis parallel to the axis of horizontal support members 10 . while size may vary , support member 10 is preferably sixteen ( 16 ) inches long and two and a quarter ( 2 . 25 ) inches wide . each flange 10 d , 10 e extends down about one ( 1 ) inch from flat member 10 c . slots 10 f are preferably 2 . 125 inches wide and 0 . 1875 inches high , to accommodate straps 50 , such as , for example , standard 2 - inch wide fabric straps . fig3 also shows vertical struts 20 optionally having at least one small hole 22 , such as kickstand receptacle aperture 22 , for insertion of optional kickstand 40 therein . fig3 also shows horizontal load support members 10 being respectively demountably attached to a pair of vertical struts 20 , having apertures 21 and 22 . in one embodiment , horizontal load support members 10 can be demountably attached to vertical struts 20 , but in an alternate embodiment they can be permanently affixed to each other , such as in the alternate embodiments shown in fig3 a and 3b . moreover , while preferably horizontal struts are u - shaped , as in fig3 , in alternate embodiments other configurations can be used , as long as vertical strut 20 can be attached to horizontal support member 10 . for example , in fig3 a vertical strut 20 ′ is in a unified t - shaped member with horizontal support member 10 ′. in fig3 b , vertical struts 20 ′ and horizontal support members 10 ′ are attached by weldment 20 ″. in fig3 c , vertical strut 20 ′ is inserted in hole 10 ″ of horizontal support member 10 ′, and attached by fastener 10 ′″, such as a screw or other fastener . in these alternate embodiments shown in fig3 a , 3 b or 3 c , horizontal load support members 10 ′ may be solid in cross sectional configuration . one such configuration shown in fig3 a , 3 b and 3 c is that of a parallelepiped , namely a solid form , all of whose sides are parallelograms , such as rectangles , and whose opposite sides are parallel to one another . in another embodiment vertical strut 20 may be adjustable in length with a sleeve containing a telescopic shaft ( not shown ) and with a spring urging the shaft in and out of the sleeve , with a lock provided . kickstand 40 is secured in place by a fastener , such as nylon set screw 37 . setscrews 37 also hold axle members 32 in the storage position through vertical struts 20 . vertical struts 20 are preferably made from 1½ × 2 - inch solid bar stock anodized aluminum , or stainless steel . vertical struts 20 are preferably about 10 . 25 inches long , 2 inches wide and 1½ inches in depth . also shown in fig3 , the plurality of optional larger holes 21 , such as holes , which are 0 . 765 or 1 . 625 inches in diameter , are located on a front side of vertical strut 20 . smaller hole 22 on the bottom accommodates kickstand 40 , which is preferably a hollow aluminum tube of 0 . 75 - inch diameter and 16 inches in length . optional larger holes 21 within vertical strut 20 are provided for weight reduction of portable cart 1 . on a side 23 transverse to the front 24 of each vertical strut 20 , at a lower portion 20 a thereof , is provided a further hole 25 of about 1 - inch in diameter for insertion of each axle member 32 therethrough . hole 25 has a permanently affixed , bushing 26 therein , such as a pvc ( polyvinyl chloride ) bushing , to prevent wear and tear of each aluminum axle member 32 by the aluminum surface of hole 25 . as also shown in fig3 , 4 and 6 , each wheel 30 is demountably attached at an end , respectively , to a pair of axle members 32 , with axle members 32 extending inwardly from and demountably attached to lower portion 20 a of the respective vertical struts 20 , wherein axle members 32 are in a transverse relationship to horizontal load support members 10 . fasteners , 36 , such as cotter pins , hold each wheel 30 upon each axle 32 . each axle member 32 is received within each hole 25 , of each lower portion 20 a of each vertical strut 20 . a compression groove 27 exists from the underside of vertical strut 20 to hole 25 and continues to further through hole 27 a , providing for compression of lower portion 20 a of vertical strut 20 . to accommodate narrow or wider cargo , such as watercraft of varying widths , the distance between vertical struts 20 can be varied along the axle length by loosening and tightening the tightening member 28 and moving vertical struts 20 laterally apart or towards each other along axle members 32 . although optionally a one - piece axle may be used ( not shown ), preferably the pair of axle members 32 are held in opposite axial orientation by straight rigid axle connector 34 . axle connector 34 has tightening member 35 , and a pair of receptacles 33 at the respective two ends of axle connector 34 , so that axle members 32 respectively extend outwardly from , and are demountably attached within , the axle connector receptacle bore 33 . while the axle may be optionally a one - piece axle , such as shown as reference numeral 606 in fig3 herein , preferably the pair of connected oppositely extending axle members 32 form together an axle for wheels 30 . each axle member 32 is made of solid round stock of anodized aluminum or stainless steel , approximately 0 . 75 inches in diameter . at the wheel - supporting end 32 a , the diameter is about 0 . 59 inches in diameter with shoulders 32 b of about 0 . 08 inches in height , transverse to the axis of axle member 32 . these shoulders 32 b provide a resting surface to prevent axial movement of wheel 30 upon axle member 32 . as shown in fig7 , each wheel 30 rotates about press fit bearings 32 b , while each wheel 30 is positioned upon each respective axle member 32 of fig8 . as shown in fig6 , at the opposite end of one axle member 32 , there is provided a hollow , threaded recess 32 c of about 0 . 75 inches deep , to accommodate a connecting threaded member 32 d of other axle member 32 , to axially connect both axle members 32 together within axle connector 34 , with a wheel 30 at each end . fig8 and 9 show how axle connector 34 is compensated along groove 38 , thereby locking axle members 32 within bushing 39 , which is within receptacle bore 33 of axle connector 34 , by tightening of tightening bolt 35 a of tightening member 35 . preferably bushing 39 is a pvc ( polyvinyl chloride ) bushing . groove 38 is preferably 1 / 16 to ⅛ inch , in width , which allows for the compression of axle connector 34 around axle members 32 . tightening bolt 35 a is inserted within a conventional receptacle which is a through hole at the proximal end and which is tapped with threaded grooves at the distal end , to allow for compression of axle connector 34 . fig4 and 6 also show at least one kickstand 40 , preferably a pair , respectively extending horizontally rearward from each lower portion of vertical struts 20 . each kickstand member 40 extends rearwardly from the at least one kickstand receptacle aperture 22 of respective vertical struts 20 and each kickstand 40 is demountably attached within each respective kickstand receptacle aperture 22 . each kickstand member 40 is preferably contoured so as to contact the ground to stabilize portable cart 1 is a parked position of rest . as shown in fig5 , to hold a canoe , game or cargo in place upon cart 1 , one or more adjustable load - securing straps 50 are slidably attached to both respective horizontal load supports 10 in a transverse relationship to load supports 10 . straps 50 are preferably reinforced flexible canvas straps of about 2 inches in width . to complete portable cart 1 as a canoe or boat cart , fig4 shows support cushions 13 mounted upon respective horizontal load supports 10 . support cushions 13 are flexible , such as of rubber or foam , to support the weight of boat 2 thereon . fig1 and 11 show the precision balancing of boat 2 upon cart 1 , wherein the placement of boat 2 upon cart 1 causes cart 1 to rotate from a position of rest in fig1 to a horizontal load position of fig1 , in the direction of the arrow . fig1 - 17 show another embodiment that converts portable cart 1 into a game cart . alternatively , fig1 - 20 show how to convert cart 1 into a cargo wagon with a hollow well . first , in either situation , carry frame 55 is secured to horizontal load supports 10 . although a one piece , generally rectangular frame ( not shown ) may be used , preferably frame 55 includes a pair of u - shaped brackets 60 , 70 joinable together to form frame 55 . various fasteners may be provided to horizontal load supports 10 to carry objects , such as carriers , thereon . alternatively , for example , a clamp maybe provided to horizontal load supports 10 to carry a frame of a discrete transportable carrier directly thereon , as disclosed hereinafter with respect to fig2 - 24 . in that case , instead of the frame being integrally part of the portable chart , as in fig1 - 17 , in fig2 - 24 , the frame is clamped to the horizontal load supports 10 of portable cart 1 . other fasteners may include longitudinally extending channel slots , such as in fig3 - 39 described further below . meanwhile , further with respect to fig1 - 17 , u - shaped front bracket 60 extends horizontally forward from front - end receptacle apertures 12 of horizontal load supports 10 , wherein front bracket 60 is demountably attached within front - end receptacle apertures 12 at one end of horizontal load supports 10 . u - shaped rear bracket 70 extends horizontally rearward from oppositely positioned rear end receptacle apertures 12 of horizontal load supports 10 and rear bracket 70 is demountably attached within each oppositely positioned rear end receptacle aperture 12 of horizontal load supports 10 . fig1 shows how frame 55 is secured to cart 1 . each distal end of u - shaped front bracket 60 is inserted through apertures in respective ends 10 b of horizontal supports 10 until each distal end engages a corresponding hole in each vertical support 20 , where they are held in place by pins 29 . pins 29 engage lateral holes 18 in horizontal supports 10 and corresponding through holes 19 in distal ends of u shaped brackets 60 . likewise , each distal end of u - shaped rear bracket 70 is inserted through apertures in respective ends 10 a of horizontal supports 10 until each distal end engages a corresponding hole in each vertical support 20 , where it is also held in place by a pin 29 . pins 29 engage lateral holes 18 in horizontal supports 10 and corresponding through holes 19 in distal ends of u shaped brackets 60 , 70 of frame 55 . u - shaped brackets 60 , 70 are preferably of hollow , anodized aluminum tubing of about 0 . 75 inches in diameter . the length of each distally extending side member thereof is about 23 . 50 inches and the width of the cross bar connecting the distal side members is about 21 . 63 inches . about 0 . 75 inches from each distal end is a scoring , to accommodate a clamp thereon , to form frame 55 . as shown in fig1 and 15 for pulling or pushing game or cargo upon portable cart 1 , handle 80 extends rearwardly at an upward angle from joints 71 of either u - shaped rear bracket 70 for pushing portable cart 1 , or from front u - shaped bracket 60 for pulling portable cart 1 ( not shown ). furthermore , handle 80 may be permanently attached to either u - shaped bracket 60 or 70 , or handle 80 may be removable and demountably attached to either front u - shaped bracket 60 or rear u - shaped bracket 70 . handle 80 has preferably two aluminum tubing connecting members about 22 . 5 inches in length , connected by a hand accommodating transverse bar of solid aluminum , and is 17 . 5 inches in width . handle 80 includes connectors 81 , having distal sleeves , such as pvc ( polyvinyl chloride ) sleeves 82 , permanently affixed thereto , which are insertable within joints 71 by locking member 72 , having threaded member 72 a which passes through bore 71 a of joint 71 and bore 81 a of handle 80 . compression groove 73 exists in joint 71 , providing compression of joint 71 . handle 80 may optionally have an auxiliary extension member and clamp ( not shown ), so that it can be attached to the rear frame of a bicycle ( not shown ), to pull portable cart 1 . to carry game 3 , as shown in fig1 , or to carry an injured person in a rescue operation , fig1 shows portable cart 1 having fabric stretcher 100 stretched tautly between horizontal load members 10 and preferably mounted over and around front and rear u - shaped brackets 60 and 70 of frame 55 , by threading brackets 60 , 70 through fasteners such as sewn - in loops 102 of fabric stretcher 100 , which may alternatively be made of plastic or other taut load bearing material . other types of fasteners can be used . for example , fig1 shows that loop 102 a is openable , and closed by fastener , such as zipper fastener 102 b . as also shown in fig1 , handle 80 may include a pair of posts extending obliquely off of a horizontal axis of portable cart 1 , wherein a head rest cushion 85 extends between the posts to support the head and neck of an injured person being transported upon stretcher 100 . fig1 - 20 show that to carry cargo , hollow fabric cargo well 110 is attached in the same manner to frame 55 . hollow cargo well 110 may also alternatively be made of plastic or other taut load bearing material , and covered by cover 112 . fig1 and 19 also show wider wheels 130 for use on sand or granular terrain . the various embodiments of the mission adaptable multiple - purpose portable cart / utility table can be quickly and easily assembled and disassembled . for example , for making a canoe cart from the disassembled portable cart 1 , wheel - retaining members , such as cotter pins 36 , are taken out of axle members 32 in their stored position , and wheels 30 come out . axle members 32 are then removed from between vertical struts 20 . the axle members 32 are then clamped in a horizontal use position into receptacles 33 of rigid axle connector 34 . axle members are inserted between vertical struts 20 and locked in place . wheels 30 are placed upon axle members 32 and secured by cotter pins 36 . kickstand 40 is loosened from its rest position and placed in place in receptacles within vertical struts 20 . canoe supporting cushions 13 are installed upon horizontal load supports 10 to support a canoe or boat thereupon . straps 50 hold the canoe or boat installed upon cushions 13 in a secure transportable position . to convert portable cart 1 into a game cart as in fig1 or a rescue cart as in fig1 , kickstands 40 are removed and fabric stretcher 100 is installed on u - shaped frame members 60 , 70 of frame 55 frames by fasteners such as sewn loops 102 thereof . u - shaped frame members 60 , 70 are placed on horizontal load supports 10 , and kickstand members 40 are installed as braces for fabric stretcher 100 . straps 50 are then installed to securely hold game or an injured party upon stretcher 100 . then handle 80 is installed upon u - shaped bracket 60 or 70 of frame 55 to pull or push portable cart 1 . to convert portable cart 1 into a wagon to haul cargo , as in fig1 and 19 , fabric stretcher 100 is removed and hollow well 110 is installed over u - shaped members 60 , 70 of frame 55 . to make the portable chart 1 portable again , the components are disassembled in reverse into bag 120 . strap or straps 50 are used as a carry handle or for backpack shoulder loops . while the rescue stretcher shown in fig1 has its own customized stretcher 100 , in another embodiment shown in fig2 - 24 , to convert portable cart 1 to a retrofit disabled person - bearing transportable carrier cart for search and rescue operations , using conventional railed stretcher 230 , support cushions 13 are removable from horizontal load supports 10 and replaced by clamping assembly 200 . clamping assembly 200 includes lower jaw 202 , and upper jaw 204 . while different jaw configurations can be used , the embodiment shown in fig2 - 24 shows each having longitudinally extending recesses 206 and 208 therein to grip perimeter frame rails of a load supporting transportable carrier , such as conventional railed stretcher 230 therebetween , as shown in fig2 . lower jaw 202 of clamping assembly 200 includes an engaging surface 210 with threaded studs 212 which are inserted into through - holes 214 of load supports 10 , and permanently locked with nuts 216 . upper jaw 204 is provided with a pair of oblong through - slots , 218 , to allow upper jaw 204 to slide on upper surface of lower jaw 202 , when threaded t - handles 220 are loosened . as shown by the arrows in fig2 this sliding action allows for quick removal of any stretcher frame rail secured between jaw assembly 200 . fig2 and 24 are perspective views of a typical stretcher 230 , and a stokes - type rescue basket 240 , securely clamped to portable cart 1 utilizing the previously described clamping assembly 200 . as shown in fig2 in this embodiment , instead of being permanently attached to each horizontal load support 10 , removable support cushion 13 is permanently attached to removable plate 302 with an adhesive 304 . this cushion assembly is removably attachable by nuts 316 and threaded studs 312 , to each horizontal load support 10 . fig2 illustrates portable cart 1 , outfitted with a plurality of racking assemblies 400 , each comprising a rail clamp 410 , an upstanding post 424 , and a hanger clamp 430 . rack assembly 400 , when used in conjunction with additional rack assemblies 400 , allows for transportation and quick removal of essential hunting gear such as a chair stand 440 , archery equipment 441 , and rifle 442 . other related items such as knapsacks and bedrolls may be supported by rack assembly 400 , as well . rack assembly 400 is easily disassembled from cart 1 upon reaching a chosen destination , and the components are conveniently transported within cart 1 &# 39 ; s storage backpack , such as carry bag 120 shown in fig1 . also illustrated in fig2 are stabilizing assemblies 450 and 460 . assembly 450 makes use of post 420 , which is friction - fit into an inverted rail clamp 410 . assembly 460 comprises an inverted tubular sleeve 462 , optionally permanently welded to the handle assembly crosspiece . sleeve 462 accepts kickstand post 424 in a similar fashion to rail clamp 410 . these assemblies 450 460 serve to brace the cart 1 when it is parked . moreover , kickstand post 424 may be used with any embodiment having a handle , such as handle 80 of fig1 and 17 - 19 , or handle 81 of fig3 and 33 . turning to fig2 , which is highlighted in fig2 , an exploded perspective close - up detail view of rail clamp 410 is presented . clamping block 411 is provided with a bore 412 to receive post 424 , an attachment face 413 including a semi bore 414 , and notch 415 , and threaded bore 416 . plate 417 includes semi bore 418 , through hole 419 , and protruding rib 420 . as shown in fig2 , when threaded knob 422 is inserted into hole 419 of plate 417 and tightened into threaded bore 416 of block 411 , clamping is achieved against frame member 60 . rib 420 is secured within notch 415 by a camming action in the direction of arrow “ a ”. fig2 shows cantilevered hanger clamp 430 , poised to slide down upstanding post 424 . hanger clamp 430 is provided with a bore 431 , which is notched in a similar manner to clamping receptacles 71 of the handle assembly . the notch separates the body of hanger clamp 430 into two walls . threaded knob 422 will compress the walls surrounding the notch , thereby tightening bore 431 around post 424 . l - shaped region 432 is integrally formed with the body of the hanger clamp , and provides a strong and durable support for transporting hunting or other gear . fig3 is a perspective view of an anti - tipping linkage 500 , which couples cart 1 to a bicycle . linkage 500 counteracts cart rollover caused by centrifugal force as the bicycle negotiates turns . fig3 illustrates the components of linkage 500 . bicycle seat - stem compression clamp 510 is formed of a body portion 511 , and plate 512 , fastened by screws 513 . bore 514 is angled so that clamp 510 remains perpendicular when installed on a typical bicycle seat - stem . clamp 510 is provided with a bore 515 on rear face 516 , which accepts a shaft 520 . pin 517 passes through clamp and fixes shaft 520 via a through - bore . shaft 520 includes through - bore 522 at its distal end . another through - bore 523 is provided slightly proximal of aperture 522 . when shaft 520 is inserted into coil spring 530 , hooked leg 531 of the spring will fit into bore 522 . a sliding collar 524 will then extend over leg 531 to prevent pull - out , and a pin 526 will be fitted into collar hole 525 , and into bore 523 of the shaft 520 , thereby securing the collar to the shaft and preventing removal of the coil spring . a shaft 540 is provided for the opposite end of coil spring 530 . hooked leg 532 fits into bore 542 of the shaft , and collar 544 slides over and is fixed by pin 546 , fitted into collar hole 535 and shaft bore 543 . support rails 550 and 551 are fixed to handle clamps 71 of cart 1 . the rails are bent into an inverted v configuration , and permanently affixed to block 552 . block 552 is provided with bore 553 , into which the free end of shaft 540 is fitted . pin 555 is inserted into through bore 554 of block 552 , and passes through bore 547 of shaft 540 , creating the continuous , secure anti - tipping linkage 500 between cart 1 and a bicycle . it is understood that during maneuvers of the bicycle , there will be no problems associated with a typical universal or pivot joint ; the coil spring will absorb and disperse any rotational stresses , and will react as a 360 ° “ living hinge ”. fig3 a - 32g , 33 and 33 a show an alternate embodiment 600 of the portable cart using four wheels 30 in an overlapped configuration . a hard molded cover 601 is illustrated although any cover or no cover can be used as well . cover 601 covers bin 602 with lower overlapping edge cap 601 a fitting over peripheral shoulder 602 a of bin 602 . bin 602 also has longitudinally extending concave channels 603 , which rest upon rails 604 of cart 600 of fig3 . downward pressure of the weight of bin 602 and its contents helps stabilize bin 602 upon rails 604 , which may be optionally covered with rubber or other resilient linearly extending cushions . although fig3 illustrates portable cart 600 with covered bin 602 , portable cart 600 can be used with other embodiments , such as , for example , boat cushions 13 shown in fig4 , framed rail stretchers 100 as in fig1 , the game cart of fig1 , the cargo cart of fig1 , the conventional rescue carriers of fig2 and 24 or the gear rack of fig2 , among others . fig3 h shows an exploded inverted view of an alternate embodiment for a ruggedized handle assembly , including handle 630 and handle shaft 626 with spring pin 628 lined up to enter the end of stanchion truss weldment 620 . stanchion truss weldment 620 has two downward extending struts 632 , which accommodate axles 624 therethrough , which axles 624 , in - turn , attach to wheels 622 . central bushing receptacle 634 accepts the end of handle shaft 626 . receptacle 634 also has a lower pushpin aperture and a pair of opposite holes for a through pin to hold handle shaft in place . fig3 h also shows kickstand 640 stowable within handle shaft 626 . fig3 i shows a close - up inverted view of receptacle 634 , showing handle shaft 626 located within truss weldment 620 , and held in place by spring pin 628 of handle shaft 626 and / or through pin 629 . fig3 j shows a four wheel cargo hauling cart with kickstand 640 attached to kickstand attachment bracket 638 , which is part of handle 630 . also shown are stacked cargo bin shell containers 634 held securely by straps 636 . in the sequence of fig3 k , 32 m , and 32 n , straps 636 have been detached from bin shell containers 634 , and the sequence of removal of top bin 634 is shown ending with a vertically oriented bin drawer cabinet 635 with a cover panel 639 removed , thereby exposing slidably openable drawers 642 on its front surface . fig3 n shows drawers 642 behind drawer retaining panel 639 in a cutaway view . lower bin 634 optionally contains related medical supplies for a field hospital , such as power packs , oxygen tanks , and other necessary medical supplies . fig3 o is an optional hitch assembly 644 , which replaces the handle assembly . hitch legs 646 are received into handle 630 . spring pins 651 also participate in this coupling . connector 646 , with hitch tongue 652 , form a structure engagable with receiver clevis 653 attached to all terrain vehicle 656 . fig3 p shows hitch 644 being used to pull cart 632 by all - terrain vehicle 656 . fig3 shows a perspective view of the frame of cart 600 . long axle 606 attaches front wheels 30 while short axle 605 attaches rear wheels 30 through respective vertical support pairs 20 . the use of four wheels doubles the carrying capacity of the cart of this invention while the overlapped positioning of the wheels maintains a short wheelbase for compactness and for maneuverability such as turning with fixed axles and the ability to easily climb ledges . for durability , the rails 604 may be a double pair of parallel rails . double axled cart 600 has increased maneuverability , since user pushing upon an optional handle 81 enables user to lift the farther away , distal pair of wheels 30 off the ground , and the user pulling upward of handle 81 raises the nearer proximal wheels 30 off the ground . fig3 through 39 are concerned with an alternate embodiment of the horizontal load support member 10 . the alternate embodiment 610 has an integral t - slot channel 611 in its top surface to facilitate easy installation and removal of a variety of attachments , such as cushions 615 shown in fig3 - 36 , clamps 620 , 630 , 640 , shown in fig3 - 39 , or platform 1450 shown in fig5 . load member 610 can be conveniently extruded of aluminum or magnesium ; it can be used either with the two - wheel cart 1 or the four - wheeled embodiment 600 . fig3 shows a resilient cushion 615 installed in the t - slot 611 of support member 610 . this cushion 615 can be extruded of a variety of rubber or thermoplastic elastomers and serves the same purpose as cushion member 13 described above . a perspective view of fig3 shows cushions 615 installed on a four - wheel cart 600 . as described above , clamp assembly 200 is used to convert portable cart 1 to a disabled person - bearing transportable carrier cart . three separate alternate embodiments of clamp assembly 200 are presented ; all are compatible with the use of horizontal support member 610 . fig3 shows a one - piece clamp 620 with full width top section 622 and short end pieces 621 , which mate with , and slip into the t - slot 611 of horizontal support member 610 . fig3 shows clamp 630 with a full width bottom member 631 which mates with and slides into t - slot 611 of horizontal support 610 . fig3 shows another alternate embodiment consisting of two short identical clamp members 640 , which are inserted into the t - slots 611 of member 610 at the two extreme ends . in all cases , the short clamping sections can be sized to offer spring - like gripping action on the tubular members , or fasteners , such as thumbscrews or ball plungers ( not shown ) can be used for retention . fig4 - 50 show alternate embodiments for converting a conventional hand carried , railed medical rescue stretcher to a lightweight wheeled version . for example , fig4 - 42 show shortened horizontal support members 710 with tightening members 711 . rails 713 are held either by clamps , such as shown in fig3 - 39 , or alternatively through apertures in horizontal support members 710 , as shown in fig1 . horizontal support members 710 are demountably attached to vertical struts 720 having extending therethrough transverse axles 732 supporting wheels 730 . optional pivotable kickstand 740 is attached to rails 713 by clamp 800 . as also shown in fig4 - 50 , clamp 800 includes two jaws 801 , 802 having aperture recess 803 for insertion of rails 713 therethrough . clamp 800 is closed and tightened by fastener 804 operated by rotatable knob 805 . internal spring pins 806 , as shown in fig4 , cooperate with fastener 804 and knob 805 to tighten clamp 800 about rail 713 . internal grooves 807 , 808 accommodate kickstand 740 in the respective positions of support and rest , as shown in fig4 and fig4 respectively . fig4 shows an alternate embodiment for a military or emergency rescue carrier cart 900 with a profile set low to the ground , including shortened horizontal members 910 with tightening fasteners 911 . rails 913 are also held by clamps as in fig3 - 39 , or alternately through apertures in horizontal support members 910 , as in fig1 . horizontal support members 910 are demountably attached to shortened vertical struts 920 to keep stretcher rails 913 close to the ground . optional bent handle 945 is connected by clamps 800 disclosed in fig4 - 50 , as discussed above . fig4 - 46 show how the stretcher version shown in fig4 - 42 can be converted to a stationary medical gurney 1000 . rails 1013 are supported by horizontal support members 1010 , which hare demountably attached to vertical struts 1020 , having axles 1032 supporting wheels 1030 . to stabilize gurney 1000 , horizontally extending tie rods 1036 , 1037 are joined by threaded clamp 1038 or other fastening means . the major structural components of an alternate embodiment low profile rescue carrier are shown in fig4 a . latch clamps 1800 of stretcher bearing tube assemblies 950 support stretcher 1730 and also engage handles 630 at each end . handles 630 may be rotated into an upward locking position or downward . tube assemblies 950 include lateral spring pins 962 and upper spring pins 963 for proper placement of wheel assemblies comprising struts 920 having rail bearing clamps 910 operable by latch handles 911 . fig4 b shows an exploded view of handles 630 engagable with stretcher bearing tube assemblies 950 of fig4 a . handles 630 are attached to short handle shafts 956 with spring pins 958 ( as in detail callout fig4 c ) within . similarly , a coupling section detailed in fig4 c has spring pins 958 installed as shown . spring pins 958 include bent leaf spring section 960 which tail end impinges on the inside of tube 956 or tube 952 while the other end is attached to spring pin button 962 which protrudes through a hole in the side of tube 956 or 952 . buttons 962 couple with a tube mid sections 954 via holes near the ends of these tubes . buttons 963 function as wheel set locators and fit into wheel set clamps for proper fixturing , as shown in fig4 a . the low profile rescue carrier is also shown in the side elevational view of fig4 d , which illustrates the feature of the handles 630 rotated to the downward position and functioning as kickstands . as shown in fig4 e , the low profile rescue carrier is easily converted into a low profile transport rotating handles 630 from the kickstand support position to an upright handle position which is easily grasped by medical personnel . short handle shafts 956 are shown in the optionally extended position in fig4 e , to allow for clearance between the medic and the stretcher . the medic may drag the stretcher 1730 upon stretcher bearing assembly 950 as shown , or alternatively , push or pull the stretcher or other carrier bearing assembly 950 forward by reversing his orientation . fig5 - 53 show a further embodiment for portable cart 1101 which folds down to a disassembled storage position as in fig5 and which unfolds to an assembled position of use as in fig5 . cart 1101 includes a pair of horizontal load support members 1110 laid parallel to each other , which rotate axially to move perpendicularly extending vertical struts 1120 outward from a position within a storage bag 1101 a , where vertical struts 1120 face each other &# 39 ; s distal ends , to a position of use 90 degrees perpendicular to the storage position , where vertical struts 1120 extend in the same plane but outward from horizontal load support members 1110 . in this embodiment shown in fig5 - 53 , the resilient rails 1178 are engaged to horizontal supports 1110 such that when in a position of storage the rails 1178 are biased to return to their normal position of use , when released from the storage position , thus causing vertical struts 1120 attached to horizontal supports 1110 to pivot upward and bow , thus increasing the strength of the cart . the same is true with other embodiments of the present invention . for example , placing a boat 2 upon cart 1 causes horizontal support members 10 and wheel axles 31 to bow , giving it the strength of an uncollapsible roman arch . the same is true with respect to stretcher or cargo hauling embodiments shown in fig1 , 17 - 19 , 40 - 45 and 58 - 66 , for example , wherein putting weight makes the carrier portion taut and bows the frame members into a position of strength . also the multiple floating overlapping rails as in fig1 , for example , bow the rails and strengthen the cart with a load supported thereon . moreover , vertical struts 1120 can be further strengthened in place to horizontal supports 1110 by connecting braces , such as v - shaped braces 1121 . wheels 1130 are held by axle 1131 , which in a storage position is placed within the storage bag 1101 a . to lengthen cart 1101 , rails 1178 move away from each other within holes 1112 within horizontal supports 1110 , and are stopped from further movement by spring stop buttons 1171 . fig5 - 55 show portable cart 1201 which can be converted from a cargo hauling wagon configuration with cargo well 1290 attached to frame 1255 , to a rescue stretcher with taut rescue canvas or other stretcher 1292 when stretcher 1292 , which sits loosely above hollow well 1290 during the cargo hauling configuration , but which becomes taut when peripheral fasteners , such as zippers 1296 , snaps or the like tighten stretcher 1292 in place about frame 1255 . optional kickstand 1240 or handle 1280 may be attached to cart 1201 by joints 1271 . a further accessory arm bag 1201 b may be draped down from handle 1280 for further storage . an optional hard floor member 1294 may be provided below stretcher layer 1292 within cargo well 1290 for cargo hauling strength . fig5 shows optional ski attachments 1330 for cart 1301 , wherein ski portions 1331 are attached by braces 1332 to vertical struts 1320 . the length of braces 1332 is equal to the radius of wheels 30 in previous embodiments . fig5 shows optional platform base 1450 for supporting object such as camera tripods , cooking devices , ordnance , etc . upon cart 1401 . platform base 1450 slides within channels 1411 and is secured in place by fasteners such as recessed hex nuts . fig5 shows a portable cart frame of this invention configured as a cargo hauler or as a multi - victim stretcher . the cart includes two outer longitudinal horizontal parallel rigid load support frame members 1501 , which are preferably tubular . the cart also may include an optional center frame member 1502 , also preferably tubular , as well as optional transverse frame members 1503 , overhead tube frame 1505 , two vehicle actuators , such as wheels 30 and axle 32 . it is contemplated that in snow conditions the vehicle actuators can alternatively be skis , such as shown in fig5 herein . also as shown in fig5 , fasteners , such as cotter pins 1504 are used to attach horizontal support members 1501 and 1502 within holes , such as circular holes for tubular shaped horizontal support members in transverse members 1503 . also as in fig5 , vertical struts having the wheel subassembly with wheel 30 are attached to outer horizontal support members 1501 , such as tubes , with mechanisms 1506 which permit quick attachment and detachment . attachment clamps 1507 secure overhead handle 1505 to outer ends of horizontal support members 1501 . although not shown in the drawings , any of the embodiments herein shown in all the drawing fig1 - 70 may have vertical length adjustment means ( not shown ), such as a sleeve containing a telescoping shaft , the sleeve having a spring means for urging the shaft in a selectably extendable manner out of the sleeve and a lock for locking the telescoping shaft into a selected extended position . fig5 shows a single cargo or person hauling fabric top surface sheet 1512 , which can be made of canvas or similar material . sheet 1512 preferably has sewn longitudinal pockets at the outer edges to accept horizontal support members 1501 and a central pocket 1513 to accommodate optional central frame member 1502 when inserted in direction 1514 as shown . optional apron sections 1513 can be flipped over the side edges . fig6 shows the frame of this cargo hauling or multi - victim cart readjusted to foreshorten the distance between transverse members 1503 by securing cotter pins 1504 in holes in horizontal support members 1501 and 1502 which are located farther in from the ends . as shown in fig6 , this adjustment can be used to accommodate separate stretchers 1525 with locating extensions 1526 and handles 1527 . fig6 and 63 show end views of the quick disconnect / connect mechanisms 1506 ( in viewing direction “ 62 - 62 ” in fig5 ) with horizontal support member 1501 shown optional as tubular in cross section . top clamping member 1532 has slot 1531 which permits it to slide from the locking position shown in fig6 to the unlocked position of fig6 thereby releasing side horizontal support member 1501 from the wheel 32 subassembly which continues below lower clamp jaw 1533 . in fig6 , spring 1534 is compressed since the locking shaft concentric with it has been threaded downward by turning handle 1530 in a clockwise direction . in fig6 , handle 1530 has been turned about 180 degrees counter - clockwise thereby permitting spring 1534 to push up on top member 1532 releasing horizontal support member 1501 . fig6 is a partial end cross section ( in plane “ 64 - 64 ” of fig5 ) of clamp 1507 . the split 1544 in clamp body 1540 permits selective grasping of horizontal support member 1501 as per the clamping force from screw 1542 as applied through knob 1541 . stainless steel insert 1543 prevents collapse of the end of tube 1505 of the overhead assembly . fig6 shows yet another embodiment of the cart of this invention as a frame for a portable operating room table or a gurney . this portable operating room table / gurney includes side horizontal support members 1550 , such as , for example , frame tubes , auxiliary side bars 1551 , transverse frame members 1552 , vertical struts 1553 , overhead support frames 1554 , overhead rails 1555 , trolley 1556 , and attachment clamps 1557 . the portable operating room table / gurney rides on four wheels 30 with axles 32 . the fully configured gurney is shown in fig6 . additional features shown include flexible fluid capture collection sling 1562 , fluid collection tube 1563 , fluid collection tank 1564 , adjustable side clamp 1560 , side rest or surgical instrument table 1561 , wheel brakes 1558 , and overhead accessory 1569 for attaching lights or other surgical accessories . fig6 and 68 show the construction and operation of wheel brake assembly 1558 . brake frame 1570 is rigidly attached to vertical strut 1553 . upper pivot frame 1572 works in conjunction with handle / link 1574 , curved spring link 1573 , and plunger shaft 1575 to form an “ over - center ” mechanism with two stable states , clamped or unclamped . in fig6 , handle 1574 is pushed down into a snap - locked position pushing tip 1576 into contact with wheel 32 tire 1571 thereby contacting the top surface and deforming it to prevent wheel 32 from rotating . fig6 shows the “ brake - off ” position which is obtained by lifting handle 1574 past the center position thereby lifting tip 1576 out of contact with tire 1571 . fig6 is an end view of adjustable side clamp 1560 with side tube 1550 and auxiliary rod 1551 in cross section ( see plane “ 69 - 69 ” in fig6 ). instrument table 1561 attached to clamp body 1580 can be moved longitudinally along tube 1561 and locked in place as desired by turning knob 1581 which impinges the end of screw 1582 against horizontal support member 1550 . fig7 shows an exploded view of attachment clamp 1557 used in a variety of locations on overhead frames 1554 . it includes main body 1590 with groove 1591 , outer clamp member 1593 with lip 1593 and screw 1596 with knob 1595 . in operation , lip 1593 pivots within groove 1591 ; tube 1554 is grasped by the concave surfaces of body 1590 and outer member 1593 as tightened by screw 1596 . a tube end 1594 which can represent a tube 1555 or an accessory 1568 is inserted in the hole in the end of body 1590 and locked . fig7 is a flow chart showing the use of the convertible cart / utility table of the present invention in a medical emergency response triage environment . for example , in disaster medical care , triage is the medical screening of patients to determine their relative priority for treatment . three groups are defined , the first is those casualties not expected to survive even with treatment , second is the group who will recover without treatment , and third the highest priority group who need treatment in order to survive . fig7 illustrates how the convertible cart / utility table ( ccut ) of this invention can be utilized in this environment . for example , as in fig7 , incoming casualties 1650 arrive at triage center 1652 by ambulance , helicopter or otherwise . here they are screened into the three categories , labeled “ type 1 ”, “ type 2 ” and “ type 3 ” and those who can be treated are then transported via exit path 1654 to field hospital unit 1656 by using a wheeled version of the convertible cart / utility table ( ccut ). after prep at a pre - operative station , the patient is wheeled via path 1658 to the operating room ( or ) where a table version of the convertible cart / utility table ( ccut ) is used in a utility table mode as an operating platform . patient is then wheeled upon convertible cart / utility table ( ccut ) via path 1660 to the post - operative / post recovery station for monitoring , which may be done , on either a wheeled or table version of convertible cart / utility table ( ccut ). the patient may need further surgery , which would require transporting wheeled on convertible cart / utility table ( ccut ) back via path 1666 to the pre - operative station . if patient is sufficiently recovered , he or she is transported via path 1662 upon wheeled convertible cart / utility table ( ccut ) back to triage center 1652 vicinity for further transportation merging with others from triage in the outgoing exit queue path 1664 . fig7 shows an exploded view of the major components of convertible cart / utility table ( ccut ) 1700 for supporting stretcher 1730 thereon . these include axle support struts 1712 with rail clamps 1716 at the top ends and wheels 1718 located by axle 1715 . kick stands 1704 , used with heavy duty rail clamps 1714 , convert convertible cart / utility table ( ccut ) to the stationary utility table configuration . adjustable feet 1710 provide a high friction surface and terrain adjustability . macro adjustment of leveling or height is via multiple holes 1706 , in kickstand like 1704 , which accept spring pin 1713 attached near the end of foot extension 1708 . side rails 1702 complete the basic structure . fig7 shows side rails 1702 , which are mounted to kickstands 1704 by clamps 1714 , which engage tubing rails 1702 . tubing rails 1702 have middle connecting tube 1723 and side tubes 1722 , connected by connectors , such as , for example , spring pins and holes . fig7 shows convertible cart / utility table ( ccut ) 1700 configured as a utility table with auxiliary power pack 1732 and stretcher 1730 . fig7 shows the feature , which tilts the table top by adjusting the height of kickstands 1704 on different ends at different heights . fig7 also shows an optional body fluid capture collector 1760 such as a concave sling connected to a medical waste collector 1762 . fig7 shows details of kickstand foot 1710 . threshold shaft 1752 is screwed into nut 1754 and into foot extension 1713 thereby providing a micro adjustment of height up to about one inch . high friction pad 1756 and tilt adjustment ball and socket joint 1754 complete foot 1710 . fig7 shows reversible clamp 1800 , as in fig4 a , which is used with convertible cart / utility table ( ccut ) 1700 . it includes housing block 1802 , with rail aperture 1812 , which clamps onto tubing 1722 via lever screw 1814 . groove 1816 receives tubing rail 1730 , such as that from a stretcher , which rail 1730 is locked in place via over - center clamp 1804 with jaw 1808 , operable by actuator lever 1810 . the opposite grooves 1818 , 1820 and 1822 are spaced laterally to accommodate stretchers of different widths . these can be optionally locked via a clamp 1806 having a jaw similar to jaw 1808 , which is moved to the desired groove 1818 , 1820 or 1822 . fig7 shows reversible clamp 1800 inverted to use the multiple width grooves 1818 , 1820 or 1822 . fig7 and 80 show details of heavy duty clamp 1900 , which has upper block 1902 with groove 1904 to receive a stretcher side tube 1730 . over - center latch 1906 locks stretcher tube via jaw 1910 and actuator lever 1908 . lower block 1912 has side rail groove 1920 , holding rail 1722 , which groove 1920 is lockable via latch 1914 with jaw 1918 and lever 1916 . lower extension 1922 accommodates either stretcher tube or fluid drape in groove 1924 . the end view of clamp 1900 in fig8 shows that upper retaining latch block 1932 can pivot to permit stretcher tube 1930 to tilt relative to side rail 1722 . in the more complete perspective view of fig8 , it can be seen that the lower ( foot ) end of stretcher rail 1731 of stretcher 1730 is then supported by recess or groove 1924 in the lower extension 1922 of the second clamp 1900 . fig8 depicts auxiliary pivotable medical support platform assembly 2000 including base 2001 , clamp insert 2002 and platform 2003 . this versatile mechanism clamps onto a side rail of the convertible cart / utility table ( ccut ). body limb member support 2004 holds a limb . assembly 2000 has movable hinge section can swivel relative to clamp base 2016 . fig8 shows medical support platform assembly 2000 with pole 2022 used to support intravenous ( iv ) bag 2026 with infusion line 2028 . extension rod 2024 provides more height for proper infusion gravity head . tray 2030 is similarly supported . fig8 shows medical support assembly 2000 used to support gooseneck examination / surgical lamp 2040 attached to flexible neck conduit 2042 held in and movable arm support 2046 . fig8 shows another use of medical support assembled 2000 to support multiple instrument trays 2050 . it is further noted that other modifications may be made to the present invention , without departing from the scope of the invention .

a mission adaptable multi - purpose , collapsible portable cart / utility table , for use in emergency response and disaster situations , camping , hunting and other outdoors activities , which carries medical rescue carts , canoes , small boats , game , or hauled cargo by hand . it transports one or more cargo bins over long , rough terrain and each bin can include one or more cabinet drawers therein , wherein upon tilting of a cargo bin from a horizontal transport position to a substantially vertical position the cargo bin serves as a supply cabinet . each bin is openable to expose the supply drawers for use .

it is presumed that patients perceive tinnitus because neurons within the central auditory system ( auditory cortex and / or medial geniculate nucleus ( mgn ) of the thalamus ) are firing abnormally . by using sophisticated medical imaging and neurosurgical techniques discussed in u . s . pat . no . 5 , 496 , 369 , the contents of which are incorporated herein by reference , specific regions in the brain can be targeted and the abnormal electrical activity blocked or masked with stimulating electrodes or with drugs delivered through precisely placed brain catheters . the primary auditory region of the human brain is buried deep within the sylvian fissure . it is not visible from the brain surface and its exact location varies slightly from one person to the next . mri and ct scanners were not invented at the time of dr . dobelle &# 39 ; s experiments so the anatomy of the patient &# 39 ; s auditory cortex could not be studied prior to surgery , and this region could only be visualized with difficulty in the operating room after the sylvian fissure was surgically dissected . once the buried auditory cortex was exposed , surface stimulating electrodes were placed by hand over the area thought to be the auditory cortex and the brain was stimulated in a fashion similar to that used to generate visual phosphenes . reproducible sound sensations were generated in the experimental subjects . though these preliminary findings were encouraging , a range of limitations precluded further work by this group . among the more daunting problems the utah group faced were recruiting suitable patients for the experimental study and obtaining good stimulation characteristics from the experimental surface electrodes . the minimal stimulation threshold for eliciting sound sensations was found to be 6 milliamperes , which is too high to be tolerated chronically and is thousands of times greater than currents found subsequently to be required to generate phosphenes in visual cortex using penetrating electrodes . recent advances in mri and computer technology now allow detailed preoperative imaging of human auditory cortex . an important aspect of the cochlear implant technology , which is now highly refined , involves transducing sound into complex electrical stimulation sequences . this large body of technical knowledge developed over the last twenty years will be directly applicable to the treatment of tinnitus via the auditory cortex prosthetic device . mechanisms of human hearing are reviewed briefly to provide a framework for discussion of the tinnitus masking system . the auditory system is composed of many structural components that are connected extensively by bundles of nerve fibers . the system &# 39 ; s overall function is to enable humans to extract usable information from sounds in the environment . by transducing acoustic signals into electrical signals that can then be processed in the brain , humans are able to discriminate amongst a wide range of sounds with great precision . fig1 a and 1b show a side and front view of areas involved in the hearing process . in particular , the normal transduction of sound waves into electrical signals occurs in cochlea 110 , a part of the inner ear located within temporal bone ( not shown ). cochlea 110 is tonotopically organized , meaning different parts of cochlea 110 respond optimally to different tones ; one end of cochlea 110 responds best to high frequency tones , while the other end responds best to low frequency tones . cochlea 110 converts the tones to electrical signals which are then received by cochlear nucleus 116 . this converted information is passed from cochlea 110 into brain stem 114 by way of electrical signals carried along the acoustic nerve and in particular , cranial nerve viii ( not shown ). the next important auditory structure encountered is cochlear nucleus 116 in brain stem 114 . as the acoustic nerve leaves the temporal bone and enters skull cavity 122 , it penetrates brain stem 114 and relays coded signals to cochlear nucleus 116 , which is also tonotopically organized . through many fiber - tract interconnections and relays ( not shown ), sound signals are analyzed at sites throughout brain stem 114 and thalamus 126 . the final signal analysis site is auditory cortex 150 situated in temporal lobe 156 . the mechanisms of function of these various structures has also been extensively studied . the function of cochlea 110 is the most well - understood and the function of auditory cortex 150 is the least understood . for example , removal of the cochlea 110 results in complete deafness in ear 160 , whereas removal of auditory cortex 150 from one side produces minimal deficits . despite extensive neural connections with other components of the auditory system , auditory cortex 150 does not appear to be necessary for many auditory functions . advanced imaging combined with an intraoperative stereotactic system now enable placement of penetrating electrodes into auditory cortex during routine epilepsy surgery without dissection of the sylvian fissure . primary auditory cortex 150 in fig1 a and 1b is tonotopically organized , meaning stimulation in different areas is likely to cause the patient to perceive different tones . these tones form the building blocks of complex sound phenomena such as speech . tonotopic organization is a fundamental characteristic of the cochlea and cochlear nucleus as well , as discussed above . auditory cortex 150 , however , has its tonotopic map stretched across a larger volume of tissue ( greater that twice the volume of cochlear nucleus 116 ). greater tissue volume enables placement of a greater number of electrical contacts for a given tonotopic zone . this results in increased signal resolution and improved clarity of auditory sensation . finally , because of anatomical differences , auditory cortex 150 can accommodate penetrating electrode arrays . fig2 a shows a multi - contact recording / stimulating electrode system 100 for blocking and / or masking the abnormal electrical activity present in tinnitus patients according to one embodiment of the invention . in particular , system 100 includes a multi - contact stimulating / recording electrode 104 connected to cables 108 via connector 112 . cables 108 enter skull 116 at burr hole opening 120 of skull 116 and are connected to a stimulation device 410 positioned in subcutaneous tissue of axial skeleton ( thorax or abdomen ). fig2 b shows a closer view of multi - contact stimulating / recording electrode 104 of electrode system 100 . electrode 104 has a first end 206a and a second end 206b which is blunt or smoothly curved . electrode 104 has electrical contacts 220 along a longitudinal support 226 . support 226 can be anywhere from several millimeters long to several centimeters long . electrical contacts 220 are small metal pads which can be separately electrically charged via respective wires 232a available at first end 206a . wires 232a are coupled to stimulation device 410 ( see fig2 a and 4 ). electrical contacts 220 are spaced approximately 10 micrometers to several millimeters apart and preferably approximately 50 to 150 micrometers apart . application of a voltage to contacts 220 near first end 206a results in stimulating low ( or high -- to be determined by questioning the patient ) tones in auditory cortex 150 ( see fig1 a and 1b ), whereas application of a voltage to contacts 220 near second end 206b results in stimulation of high ( or low ) tones in auditory cortex 150 . electrode 104 is stereotaxically placed into the primary auditory cortex of the patient with tinnitus . this can be done using a standard stereotaxic head frame under local anesthesia . that is , the above discussed three dimensional computerized mri reconstruction method of fig3 a - 3c is used to stereotaxically place electrode 104 within the targeted region of auditory cortex 150 . correct placement is confirmed by presenting a series of tones to the patient and mapping the tonotopic responses of the neurons along electrode 104 . in deaf patients , this mapping procedure is not possible , but mapping can still be carried out using microstimulation currents delivered to various contacts along electrode 104 . the deaf patient describes the relative pitch of the sounds he or she perceives following stimulation , whereby the electrically stimulated location and parameters which most closely match the patient &# 39 ; s tinnitus are determined . this approach could be used in the thalamus ( mgn ) as well , but the preferred embodiment involves implantation in the cortex . regardless of whether or not stimulating electrode 104 is placed into the correct region of the cortex or into the correct region of the mgn , electrode 104 is coupled to stimulation device 410 via cables 108 and in particular , wires 232a . longitudinal support 226 can be a rigid support or a flexible wire with a rigid introducer which enables the physician to introduce electrode 104 into a patient &# 39 ; s brain and then subsequently remove the rigid introducer thereby exposing electrical contacts 220 to auditory cortex 150 . support 226 can be one of the probes shown in fig3 - 5 in &# 34 ; possible multichannel recording and stimulating electrode arrays : a catalog of available designs &# 34 ; by the center for integrated sensors and circuits , university of michigan ann arbor , mich ., the contents of which are incorporated herein by reference . alternative electrodes such as depthalon depth electrodes and interconnection cables from pmt corporation 1500 park road , chanhassen , minn ., 55317 could also be used as support 226 and electrical couplers between contacts 220 and a speech processor ( 410 in fig4 ). electrical contacts 220 can operate as high impedance ( megohms ) contacts or low impedance ( a few ohms to several thousand ohms ) contacts . this enables the contacts to output a small ( a few microamperes as opposed to a few milliamperes ) current . high impedance contacts localize the potentials applied to the patient &# 39 ; s primary auditory cortex to approximately a few hundred micrometers . the localization of applied electric charges corresponds to the tonotopic spacing of nerve cell pairs . electrode 104 is arranged along a longitudinal direction of auditory cortex 150 . however , auditory cortex 150 is located in the transverse temporal gyrus and is buried deep within the sylvian fissure . consequently , its location cannot be determined simply by looking at an exposed surface of the brain . therefore , mri imaging techniques must be employed to reveal the exact orientation of auditory cortex 150 . a single coronal image of an individual &# 39 ; s brain cannot reveal the exact orientation of auditory cortex 150 . however , for treatment of tinnitus , a standard coronal mri provides a fairly good estimate as to the location of the target region , whether or not the target region is the auditory cortex or the thalamus . however , if more precise targeting is desired , a series of two dimensional images must be obtained and a resulting 3 - d mri image constructed . once such an image is constructed , the digital data making up that image can be transformed to provide a view of the sylvian fissure . this in turn exposes auditory cortex 150 as a mole - like mound . that is , tissue on top of the digital image can be &# 34 ; peeled off &# 34 ; to expose the sylvian fissure and consequently auditory cortex 150 &# 34 ; pops out &# 34 ; of the image . this process is described in &# 34 ; three - dimensional in vivo mapping of brain lesions in humans &# 34 ;, by hanna damasio , md , randall frank , the contents of which are incorporated herein by reference . fig3 a shows a side view of a plane a which intersects a coronal section 310 as well as a view of coronal section 310 with sylvian fissure 316 exposed . fig3 b and 3c show coronal section 310 before and after tissue is digitally &# 34 ; peeled off &# 34 ; to expose auditory cortex 150 . one or more resulting mounds 320 is revealed in fig3 c and this mound corresponds to auditory cortex 150 of fig1 b . mound 320 does not appear until after tissue on the underside of sylvian fissure 316 is reconstructed to provide the 3 - d image . once the exact location and orientation of mound 320 and consequently auditory cortex 150 have been determined using these 3 - d mri image processing techniques , electrode 104 can be accurately inserted into auditory cortex 150 . fig4 shows electrode 200 just prior to insertion into auditory cortex 150 . in addition , fig4 shows stimulation device 410 coupled to wires 238 via cable 414 . stimulation device 410 is a chronic electrical stimulation device . this stimulator device is well tested and widely available . examples include chronic epidural stimulators made by medtronics used for chronic back and leg pain and deep brain stimulators , as well as nearly all types of cochlear implants . the above electrical implantation technique for tinnitus is quick and safe , e . g ., over 100 auditory cortex region electrode implantations have been performed in patients being evaluated for medically intractable seizures as reported by a french epilepsy surgery group . in addition , since electrode 104 is placed in the exact site of presumed abnormal neuronal electrical activity , it is much more effective in disrupting or altering abnormal neuronal electrical activity , thereby eliminating tinnitus . moreover , preliminary testing has shown that placement of electrode 104 within the central auditory system causes patients to perceive sounds , and this will likely be the case even in patients who are deaf from causes refractory to cochlear implantation . also , stimulation in the auditory cortex does not impair hearing in tinnitus patients who do have good hearing . fig5 shows an electrode 510 which includes two longitudinal supports 226a and 226b according to another embodiment of the invention . although two supports are shown , three or more such supports could be used . longitudinal support 226a is connected to cable 108a containing wires 232a via connector 112a and longitudinal support 226b is connected to cable 108b containing wires 232b via connector 112b . cables 108a and 108b are again connected to stimulation device 410 as in fig4 . fig6 shows an electrode 610 according to yet another embodiment of the invention . in particular , fig6 shows longitudinal support rod 226 with first end 606a and second end 606b . end 606a is arranged in the region of auditory cortex 150 with low tones ( or high tones as previously discussed ) and second end 606b is arranged in the region of auditory cortex 150 with high ( or low ) tones in a manner similar to first end 206a and second end 206b of fig2 b . here , however , longitudinal support 226 has a sphere 616 which is stopped by a stopping piece 614 . this enables the physician to insert longitudinal support 226 at a wide range of angles and yet secure electrode 610 once longitudinal support 226 has been inserted . fig7 a shows electrode 610 of fig6 as looking down on the patient &# 39 ; s brain surface 704 . fig7 b shows a closer view of stopping piece 614 with a cup 708 and a lid 714 with a notch 716 for passing leads 232 . fig7 c corresponds to fig7 a with support 226 inserted into surface 704 and sphere 616 resting in cup 708 &# 34 ;( fig7 b )&# 34 ;. fig7 c also shows lid 714 covering sphere 616 with leads 232 extending out of notch 716 . fig8 shows another embodiment of the invention involving drug - infusion into regionally targeted locations within the brain . the alternative drug - infusion treatment strategy relies on the same principal of regionally targeted treatment within the brain , but employs a different effector to eliminate the abnormal neural activity causing tinnitus . namely , a small drug infusion catheter 801 is stereotaxically placed into either the auditory cortex or thalamus ( mgn ) and microinfusions of various drugs that block abnormal neural activity are infused into the targeted locations . referring in more detail to fig8 a drug infusion catheter - recording device 800 is connected to an injectable ( rechargeable ) drug reservoir - pump 804 via connector 803 which is secured with sutures widely used in neurosurgery . pump 804 is secured to the patient &# 39 ; s skull 808 under the scalp and is not exposed to the external environment . pump 804 has a valve 824 which can be accessed externally so that additional drugs can be injected via a syringe ( not shown ) without reopening the patient &# 39 ; s scalp . catheter 801 has multiple ports 814 from which the drugs are microinfused into the targeted brain regions . fig9 shows a closer view of catheter 801 with ports or openings 814 . catheter 801 can be made , for example , of silastic such as the catheters sold by radionics , codman , and medtronics . catheter 801 need not have a circular cross - section 817 and instead can be flat , elliptical or any other shape which facilitates broader diffusion of the drug . catheter 801 can include a small embedded recording - stimulating electrode 819 which can be connected to stimulation device 410 so that cathether 801 can be properly positioned . electrophysiologic recording data from this special catheter electrode will provide physiologic confirmation of proper catheter position in auditory cortex . the diameters of ports ( or openings ) 814 can be approximately between 10 micrometers and several millimeters and preferably between approximately 40 micrometers and 1 millimeter . the centers of ports 814 can also be tens of micrometers apart to millimeters apart and the spacing need not be uniform . pumps manufactured by medtronics and alzet can serve as injectable drug reservoir - pump 804 . examples of drugs that could be infused include anticonvulsants such as dilantin and inhibitory neurotransmitters such as gaba and local anesthetics such as lidocaine . in high enough concentrations , these compounds should block abnormal neuronal discharges . by delivering the drugs to the specific central nervous system target , significantly higher concentrations of the drug reach their target without exposing non - targeted surrounding tissue , as compared to the concentrations which could be delivered by simply systemically administering the same drug orally or intravenously . consequently , this strategy should result in marked improvement in efficacy while avoiding toxic side effects . the precise amount of drug infusion depends on the type of drug but can be determined at the outset of implantation . in particular , catheter 801 is initially inserted into the targeted location in the manner described above . the patient is then asked if there is any noticeable reduction in ringing due to the tinnitus as the amount of drug infusion is manually adjusted . the amount of infusion is that amount which is required to eliminate the ringing . once the amount is determined , the appropriate chronic infusion pump 804 is connected to catheter 801 and all incisions are closed . post - operative modifications of infusion rates can be carried out using percutaneous radio control techniques , e . g ., medtronics . as mentioned above , the alternative drug - infusion treatment strategy relies on the same electrode placement principals as described above with respect to fig3 a - 3c . namely , a series of images must again be obtained and a resulting 3 - d mri image constructed . once the image is constructed , the digital data making up that image can be transformed to provide a view of the sylvian fissure . this in turn exposes auditory cortex 150 as a mole - like mound . again , tissue on top of the digital image can be &# 34 ; peeled off &# 34 ; to expose the sylvian fissure and consequently auditory cortex 150 &# 34 ; pops out &# 34 ; of the image . numerous additional modifications and variations of the present invention are possible in light of the above teachings . it is therefore understood that the invention may be practiced otherwise than as specifically claimed .

a neural prosthetic device for reducing or eliminating the effects of tinnitus is inserted into a tinnitus patient &# 39 ; s primary auditory cortex . the prosthetic device includes a stimulation device for outputting processed electrical signals and an electrode arranged in the primary auditory cortex having a plurality of electrical contacts . each of the plurality of electrical contacts independently outputs electrical discharges in accordance with the electrical signals . in another embodiment , a catheter is inserted into the tinnitus patient &# 39 ; s primary auditory cortex or thalamus . the catheter microinfuses drugs which suppress or eliminate abnormal neural activity into disperse geometric locations in the cortex or thalamus , thereby reducing or eliminating the effects of the patient &# 39 ; s tinnitus .

conventional cocktail garnish picks are typically thin , straight , cylindrical pieces of wood , metal or plastic , with a sharpened end . while the typical garnish pick is formed by a single straight shaft to skewer and hold a garnish , such a design allows the entire pick to occasionally slide below the line of the liquid , potentially submerging the garnish pick . this is inconvenient for people that prefer to eat the garnish while drinking the cocktail , because it may require the person to dip his or her fingers into the cocktail to retrieve the pick and garnish , and which may be perceived as unsanitary and unappealing . in addition , when more than one garnish is skewered and stacked onto a single shaft , it may be difficult for a person to remove each garnish from the garnish pick without using his or her fingers . if , for example , three olives are stacked on a single shaft , the olive next to the sharp end of the shaft can be easily pulled off by a person using their teeth , while removing a second or third olive may require the person to use his or her fingers to remove the second or third olives because of the increased distance of the second and third olives from the sharp end of shaft . referring now to fig1 , an example garnish pick 100 is shown according to one embodiment in an example usage environment of a martini glass 114 . specifically , fig1 shows how an appendage 110 of the garnish pick may exit a main shaft 112 angling toward the skewering end of the garnish pick , and hook or otherwise secure the pick to the rim of a glass , preventing the garnish pick from sliding into the cocktail glass , or completely or further submerging the garnish pick into a beverage . in this embodiment , the main shaft 112 also serves as a skewering shaft for holding a garnish . fig2 shows a garnish pick 200 in an example usage environment of a martini glass 216 . in this example embodiment , garnish pick 200 includes three appendages , wherein a first appendage 210 may serve as a hook , and a second appendage 212 and a third appendage 214 may serve as skewering shafts . fig2 also shows how garnishes , e . g ., in this case olives , can be held on the garnish pick , for example , by appendages 212 and 214 . fig3 shows a single embodiment of a garnish pick depicted at different angles rotated 45 degrees relative to each other . fig3 shows how multiple appendages can exit the primary shaft , one serving as a hook for the rim of the glass , while the others serve as skewers . in further detail , still referring to fig1 , fig2 and fig3 , the garnish pick may be of a total length that is approximately equal to the distance from the rim of a martini glass to the center of the bottom of the glass . however , other suitable lengths may be used . because martini glasses come in a variety of shapes and sizes , this distance may vary . in at least one non - limiting example , a total length of the garish pick does not exceed five inches and is not less than two inches in length . fig9 further shows how an appendage for serving as a hook may be omitted from the garnish pick in at least some embodiments . in at least some embodiments , a total diameter or width of the garnish pick may be at its largest is 15 cm or less , with the diameter or width diminishing toward the sharp end of the skewering shafts . the portions of the garnish pick that are adapted to hold a garnish may have a diameter sufficiently small such that a garnish ( e . g ., an olive or other suitable garnish item ) can slide onto that portion of the garnish pick without undue difficulty and / or without splitting or damaging the garnish . in at least some embodiments , the main shaft and / or appendages may curve , have abrupt bends , or be curved along at least a portion of its axis . the main shaft and / or appendages may have bumps , ridges , craters , or be otherwise unsmooth or rough ( e . g ., as shown by the non - limiting examples of fig1 and 11 ). the main shaft and / or appendages may have circular cross - sections , convolute cross - sections , ovular cross - sections , non - circular cross - sections , square or rectangular cross - sections , pentagonal cross - sections , hexagonal cross - sections , or irregularly shaped cross - sections , among other shapes . the main shaft and / or appendages may have twists and / or cork screws that may be expanding or narrowing ( e . g ., at a radius of curvature ) along a longitudinal axis of the main shaft or appendage ( e . g ., non - regular corkscrew or twist ). such twists and / or corkscrews may be less than a full rotation , between one full rotation and two full rotations , greater than two full rotations , or comprise an even greater number of rotations . in at least some embodiments , one or more of the appendage may have smaller appendages ( e . g ., sub - appendages ) that branch from them . the construction details of the garnish picks disclosed herein may be that such garnish picks may be made of wood or of any other sufficiently rigid , flexible , and / or strong material such as plastic , rubber , metal , glass , ceramic , and the like depending on implementation . further , the various components of the garnish pick can be made of different materials . for example , a garnish pick may comprise two or more materials . for example , the garnish pick may comprise a first material ( e . g ., metal or plastic ) having an outer coating comprising a second material ( e . g ., rubber , plastic or paint ). the advantages of the disclosed embodiments may include , without limitation , that the garnish pick can be hooked to the side of a glass , preventing the pick from becoming completely or further submerged in a beverage , and can provide additional shafts ( e . g ., appendages ) on which to hold garnishes . such embodiments may also eliminate the need to retrieve the pick out of the beverage or beverage container ( e . g ., with fingers ) and may make it easier to eat garnishes off of the pick ( e . g ., without using fingers to touch the garnishes ). as previously described , a garnish pick is provided that may be used to hold garnishes with one or more appendages emerging from a main shaft , angled toward a sharp end of the main shaft , that are used either to hook the pick to the rim of the glass or to skewer garnishes , or both . in embodiments where the garnish pick comprises a plurality of appendages , such appendages may project from a main shaft of the garnish pick at the same or different angles relative to each other along a longitudinal axis and / or an orthogonal axis of the main shaft . for example , a first appendage may project from the main shaft at a greater angle relative to a longitudinal axis of the main shaft than a second appendage and / or a third appendage . accordingly , the garnish pick may comprise two , three , four , five , or more appendages that each project from a main shaft or other base appendage ( e . g ., where such appendages comprise sub - appendages ) at different angles relative to each other as measured relative to a longitudinal axis of the main shaft or other base appendage . as another example , a first appendage may project from the main shaft or other base appendage ( e . g ., for sub - appendages ) at a 2 o &# 39 ; clock position when viewed in a plane that is orthogonal to the longitudinal axis of the main shaft or base appendage , while a second appendage may project from the main shaft at a 6 o &# 39 ; clock position , and / or a third appendage may project from the main shaft at an 8 o &# 39 ; clock position . such examples are provided for descriptive purposes and should not be considered limiting . fig1 shows another example garnish pick 1200 according to one embodiment . fig1 shows the example garnish pick 1200 of fig1 in an example use environment of a beverage container . garnish pick 1200 includes a pick body 1210 . the pick body may include a first elongate body portion 1212 having a first end 1214 forming a first tapered skewer 1216 and having a second end 1218 forming a hook 1220 . the pick body may include a second elongate body portion 1230 branching outward from the first elongate body portion at an intermediate location 1232 between first end 1214 and second end 1218 . the second elongate body portion may have a distal end 1232 forming a second tapered skewer 1234 . in at least some embodiments , first elongate body portion 1212 may taper from second end 1218 toward first end 1214 , and second elongate body portion 1230 may taper from a base end 1236 toward distal end 1232 of the second elongate body portion . in at least some embodiments , a cross - sectional area of the second elongate body portion at the base end is smaller than a cross - sectional area of the first elongate body portion at the intermediate location where the second elongate body portion branches outward from the first elongate body portion . in at least some embodiments , the first elongate body portion may be curved along a length of the first elongate body portion between the first end and the second end . the curvature of the first elongate body portion may vary along at least a portion of the length of the first elongate body portion between the first end and the second end . in at least some embodiments , the first elongate body portion may be curved in one , two , or more orthogonal planes along at least a portion of the length of the first elongate body portion between the first end and the second end . the second elongate body portion may be curved in one , two , or more orthogonal planes along at least a portion of a length of the second elongate body portion between a base end and the distal end . the first and second elongate body portions may each have a different curvature . a length of the second elongate body portion may be less than , greater than , or equal to a length of the first elongate body portion between the intermediate location and the first end of the first elongate body portion . in at least some embodiments , the pick body may further include a third elongate body portion branching outward from the first elongate body portion at another intermediate location between the first end of the first elongate body portion and the intermediate location where the second elongate body branches outward from the first elongate body . the third elongate body portion may have a distal end forming a third tapered skewer . the third elongate body portion may be curved in one , two , or more orthogonal planes along at least a portion of the length of the third elongate body portion between a base end and a distal end of the third elongate body portion . the first , second , and third elongate body portions may each have different curvature a , and may each have similar or different lengths of one or more other elongate body portions of the garnish pick . in at least some embodiments , hook 1220 formed at second end 1218 of first elongate body portion 1212 may branch outward from first elongate body portion 1212 at a location that is offset 1240 from second end 1218 of first elongate body portion 1212 . the hook may taper along its length toward a distal end 1221 of the hook . the hook formed at the second end of the first elongate body portion may be adapted to receive a rim of a beverage container 1300 ( e . g ., as depicted in fig1 ). in at least some embodiments , a remainder of the pick body including at least the first and second elongate portions may be sized to fit substantially within a beverage container when or if the rim of the beverage container is received by the hook as depicted in fig1 , for example . fig1 shows garnish pick 1200 with example garnish 1310 . in at least some embodiments , the pick body may be asymmetric about any plane ( e . g ., any or all reference planes ) passing through the garnish pick . the pick body may comprise a core formed from a first material and an outer coating substantially surrounding the core , the outer coating formed from a second material that is different from the first material . as yet another alternative description of an example garnish pick , a pick body of the garnish pick may include a stem portion ( e . g ., the portion of pick body 1212 between 1218 and 1232 ), a first elongate body portion ( e . g ., the portion of pick body 1212 between 1214 and 1232 ) branching from the stem portion , and a second elongate body portion ( e . g ., elongate body portion 1230 branching from the stem portion or the first elongate body portion . the first elongate body portion may taper from a base end toward a distal end of the first elongate body portion to form a first tapered skewer , and the second elongate body portion may taper from a base end toward a distal end of the second elongate body portion to form a second tapered skewer . the stem portion may form a hook as previously described . while the foregoing written description enables one of ordinary skill to make and use what is considered presently to be the best mode thereof , those of ordinary skill will understand and appreciate the existence of variations , combinations , and equivalents of the specific embodiments , methods , and examples disclosed herein . such disclosure and / or claimed subject matter should therefore not be limited by the above described embodiments , methods , and examples .

a garnish pick for food and / or beverages is disclosed . in at least some embodiments , the garnish pick includes a plurality of appendages that form skewering shafts for skewering garnishes . in at least some embodiments , at least one appendage of the garnish pick forms a hook for securing the garnish pick to a food or beverage container . in at least some embodiments , the garnish pick and its associated appendages may be shaped to simulate the appearance of organisms or portions thereof . as one example , the garnish pick may simulate the appearance of a branch of a tree or an antler of an animal .

the present invention employs a sensor to monitor cardiac electrical activity and cardiac demand in a skeletal muscle - powered cardiac assist system ( hereinafter referred to as &# 34 ; cas &# 34 ;). a basic cas may be configured in a variety of ways as described in the aforementioned patent to khalafalla . one specific configuration is discussed herein simply as an illustration . the present invention , however , may be used in any system concerning cardiac augmentation using skeletal muscle , such as aortic counterpulsation or a skeletal muscle ventricle . thus it should be understood the particular configuration illustrated is not intended to limit the present invention . fig1 illustrates an example of a system 1 for performing long - term stimulation of skeletal muscles for cardiac assistance using systolic augmentation as well as direct electrical stimulation of a heart 2 . as seen , skeletal muscle graft 3 is positioned about the heart 2 . in the preferred embodiment the latissimus dorsi muscle is used for the skeletal muscle graft , as is well known in the art . the longitudinal fibers of the muscle graft 3 are oriented generally perpendicular to the longitudinal axes of the right ventricle 4 , left ventricle 5 and interventricular septum 10 of the heart . muscle graft 3 is positioned in this manner so that when it is stimulated , muscle graft 3 compresses ventricles 4 , 5 and particularly left ventricle 5 , to thereby improve the force of right and left ventricular contraction . in such a manner the overall hemodynamic output of heart 2 is increased . in a preferred configuration , muscle graft 3 is wrapped around the heart 2 and fixedly attached to itself to form a cup - shaped &# 34 ; sling ,&# 34 ; using running sutures 12 . alternatively , muscle graft 3 may be attached to heart 2 using running sutures 13 as illustrated . as seen , electrical stimulation and sensing of heart 2 is accomplished through lead 15 . in particular , lead 15 electrically couples pulse generator 6 to heart 2 . lead 15 provides cardiac pacing as well as defibrillation therapies . in the preferred embodiment lead 15 is the model 6936 tri - polar transvene lead from medtronic inc ., minneapolis , minn . as seen , lead 15 is implanted in right ventricle 4 such that bipolar pacing electrode assembly 16 is in the right ventricular apex and defibrillation coil 17 is within the right ventricle 4 . although in the preferred embodiment a single lead is provided for pacing as well as defibrillation therapies , other types of lead configurations , such as multiple transvenous or subcutaneous or any combination thereof , may be used . muscle graft 3 is electrically stimulated through a pair of leads 21 , 22 . in particular leads 21 , 22 couple pulse generator 6 to skeletal muscle graft 3 . in the preferred embodiment leads 21 , 22 are the model 4750 intramuscular lead from medtronic , inc ., minneapolis , minn . as seen , each lead 21 , 22 extends from pulse generator 6 to latissimus dorsi muscle graft 3 . the electrodes ( not shown ) of each lead 21 , 22 are placed to cause muscle graft 3 to contract when electrically stimulated , as is well known in the art . other types of leads or electrodes , however , may be used , such as epimysial or neuromuscular leads or nerve cuff electrodes . fig2 is a functional block diagram of a pulse generator 6 in which the present invention may usefully be practiced . this diagram should only be taken , however , as exemplary of the type of device in which the invention may be embodied and not as limiting . it is believed the invention may usefully be practiced in a wide variety of device implementations . for example , the invention is also believed practicable in conjunction with the implantable muscle stimulator - pacemaker - cardioverters - defibrillators disclosed in u . s . pat . no . 5 , 251 , 621 issued to collins entitled &# 34 ; arrhythmia control pacer using skeletal muscle cardiac graft stimulation .&# 34 ; the device is illustrated as being provided with six electrodes , 500 , 502 , 504 , 506 , 508 , 572 and 574 . electrodes 500 and 502 may be a pair of electrodes located in the ventricle and mounted to a lead 15 as discussed above . electrode 504 may correspond to a remote , indifferent electrode located on the housing of pulse generator 6 . electrodes 506 and 508 may correspond to large surface area defibrillation electrodes located within the right ventricle , coronary sinus , superior vena cava or may also be located subcutaneous , located on or part of the device housing or to the epicardium . electrodes 572 and 574 are muscle stimulation electrodes coupled to the skeletal muscle wrap 3 , as discussed above . electrodes 500 and 502 are switchable through switch matrix 512 to the r - wave detector circuit , comprising band - pass filter circuit 514 , auto threshold circuit 516 for providing an adjustable sensing threshold as a function of the measured r - wave amplitude and comparator 518 . a signal is generated on r - out line 564 whenever the signal sensed between electrodes 500 and 502 exceeds the present sensing threshold defined by the auto threshold circuit 516 . as illustrated , the gain on the band pass amplifier 514 is also adjustable by means of a signal from the pacer timing and control circuitry 520 on gain adj line 566 . the operation of this r - wave detection circuitry may correspond to that disclosed in commonly assigned u . s . pat . no . 5 , 118 , 824 , issued to keimel and incorporated herein by reference . however , alternative r - wave detection circuitry such as that illustrated in u . s . pat . no . 4 , 819 , 643 , issued to menken and u . s . pat . no . 4 , 880 , 004 , issued to baker et al ., both incorporated herein by reference , may also be employed . the threshold adjustment circuit 516 sets a threshold corresponding to a predetermined percentage of the amplitude of a sensed r - wave , which threshold decays to a minimum threshold level over a period of less than three seconds thereafter , similar to the automatic sensing threshold circuitry illustrated in the article &# 34 ; reliable r - wave detection from ambulatory subjects &# 34 ;, by thakor et al ., published in biomedical science instrumentation , vol . 4 , pp . 67 - 72 , 1978 . it is preferable that the threshold level not be adjusted in response to paced r - waves , but instead should continue to approach the minimum threshold level following paced r - waves to enhance sensing of low level spontaneous r - waves associated with tachyarrhythmias . the time constant of the threshold circuit is also preferably sufficiently short so that minimum sensing threshold may be reached within 1 - 3 seconds following adjustment of the sensing threshold equal to 70 - 80 % of the amplitude of a detected spontaneous r - wave . the invention may also be practiced in conjunction with more traditional r - wave sensors of the type comprising a band pass amplifier and a comparator circuit to determine when the band - passed signal exceeds a predetermined , fixed sensing threshold . switch matrix 512 is used to select which of the available electrodes are coupled to band pass amplifier 534 . under control of microprocessor 524 , switch matrix directs delivery of electrical stimulation pulses to cardiac tissue and the skeletal muscle wrap . selection of the switch matrix settings is controlled by the microprocessor 524 via data / address bus 540 . signals from the selected electrodes are passed through band - pass amplifier 534 and into multiplexer 532 , where they are convened to multi - bit digital signals by a / d converter 530 , for storage in random access memory 526 under control of direct memory address circuit 528 . multiplexer 532 further receives voltage from battery 537 via vbatt 536 . amplifier 534 may be a broad band pass amplifier , having a band pass extending for approximately 0 . 5 to 200 hertz . the filtered egm signals from amplifier 534 are passed through multiplexer 532 , and digitized in a - d converter circuitry 530 . the digitized data may be stored in random access memory 526 under control of direct memory address circuitry 528 . the occurrence of an r - wave detect signal on line 564 is communicated to microprocessor 524 via data / address bus 540 , and microprocessor 524 notes the time of its occurrence . the remainder of the circuitry is dedicated to the provision of muscle stimulation , cardiac pacing , cardioversion and defibrillation therapies . the pacer timing / control circuitry 520 includes programmable digital counters which control the basic time intervals associated with cardiac pacing and muscle stimulation . the durations of these intervals are determined by microprocessor 524 , and are communicated to the pacing circuitry 520 via address / data bus 540 . pacer timing / control circuitry also determines the amplitude of the muscle stimulation and cardiac pacing pulses and the gain of band - pass amplifier , under control of microprocessor 524 . during cardiac pacing or muscle stimulation , the escape interval counter within pacer timing / control circuitry 520 is reset upon sensing of an r - wave as indicated by a signal on line 564 , and on timeout triggers generation of a pacing pulse by pacer output circuitry 522 , which is coupled to electrodes 500 and 502 or electrodes 572 and 574 . the escape interval counter is also reset on generation of a cardiac pacing pulse , and thereby controls the basic timing of cardiac pacing functions , including anti - tachycardia pacing and subsequent muscle stimulation . the duration of the interval deemed by the escape interval timer is determined by microprocessor 524 , via data / address bus 540 . the value of the count present in the escape interval counter when reset by sensed r - waves may be used to measure the duration of r - r intervals , to detect the presence of tachycardia and change muscle stimulation parameters . microprocessor 524 operates as an interrupt driven device , and responds to interrupts from pacer timing / control circuitry 520 corresponding to the occurrence of sensed r - waves and corresponding to the generation of cardiac pacing and muscle stimulation pulses . these interrupts are provided via data / address bus 540 . any necessary mathematical calculations to be performed by microprocessor 524 and any updating of the values or intervals controlled by pacer timing / control circuitry 520 and switch matrix 512 take place following such interrupts . in the event that a tachyarrhythmia is detected , and an antitachyarrhythmia pacing regimen is desired , appropriate timing intervals for controlling generation of anti - tachycardia pacing therapies are loaded from microprocessor 524 into the pacer timing / control circuitry 520 and switch matrix 512 . similarly , in the event that generation of a cardioversion or defibrillation pulse is required , microprocessor 524 employs the counters in timing and control circuitry 520 to control timing of such cardioversion and defibrillation pulses , as well as timing of associated refractory periods during which sensed r - waves are ineffective to reset the timing circuitry . further , in the event the onset of a tachyarrhythmia is detected , but not yet confirmed , the filtered and digitized egm available at a / d 530 will be compared by microprocessor 524 with a value from ram 526 . measured values above set will continue detection . values below set confirm the arrhythmia if more than 50 % of the x out of y have been detected . in the preferred embodiment x and y are programmable counts corresponding to the vfnid and the fibrillation event buffer memory ( located in the ram 526 ) respectively , both of which are discussed in more detail below with regards to the vf counting mode state 34 seen in fig4 . microprocessor 524 will then initiate a therapy if programmed to do so . in response to the detection of fibrillation or a tachycardia requiring a cardioversion pulse , microprocessor 524 activates cardioversion / defibrillation control circuitry 554 , which initiates charging of the high voltage capacitors 556 , 558 , 560 and 562 via charging circuit 550 , under control of high voltage charging line 552 . during charging , microprocessor 524 enables pacer / timing control 520 to pace out 522 and switch matrix 512 to deliver muscle stimulation pulses until the high voltage capacitors 556 are sufficiently charged . the voltage on the high voltage capacitors is monitored via vcap line 538 , which is passed through multiplexer 532 , and , in response to reaching a predetermined value set by microprocessor 524 , results in generation of a logic signal on cap full line 542 , terminating charging . the cap full line 542 signal is sent over data / address 540 to the pace timer / control 520 , which then inhibits delivery of the muscle stimulation pulses . thereafter , delivery of the timing of the defibrillation or cardioversion pulse is controlled by pacer timing / control circuitry 520 . one embodiment of an appropriate system for delivery and synchronization of cardioversion and defibrillation pulses , and controlling the timing functions related to them is disclosed in more detail in the commonly assigned u . s . pat . no . 5 , 188 , 105 by keimel , method and apparatus for detecting and treating a tachyarrhythmia , incorporated herein by reference . any known cardioversion or defibrillation pulse generation circuitry , however , is believed usable in conjunction with the present invention . for example , circuitry controlling the timing and generation of cardioversion and defibrillation pulses as disclosed in u . s . pat . no . 4 , 384 , 585 , issued to zipes , in u . s . pat . no . 4 , 949 , 719 issued to pless et al ., cited above , and in u . s . pat . no . 4 , 375 , 817 , issued to engle et el ., all incorporated herein by reference may also be employed . similarly , known circuitry for controlling the timing and generation of anti - tachycardia pacing pulses as described in u . s . pat . no . 4 , 577 , 633 , issued to berkovits et el ., u . s . pat . no . 4 , 880 , 005 , issued to pless et el ., u . s . pat . no . 7 , 726 , 380 , issued to vollmann et el . and u . s . pat . no . 4 , 587 , 970 , issued to holley et el ., all of which are incorporated herein by reference may also be used . in modern cardiac pulse generators , the particular anti - tachycardia and defibrillation therapies are programmed into the device ahead of time by the physician , and a menu of therapies is typically provided . for example , on initial detection of tachycardia , an anti - tachycardia pacing therapy may be selected . on re - detection of tachycardia , a more aggressive anti - tachycardia pacing therapy may be scheduled . if repeated attempts at anti - tachycardia pacing therapies fail , a higher level cardioversion pulse therapy may be selected thereafter . prior art patents illustrating such pre - set therapy menus of antitachyarrhythmia therapies include the above - cited u . s . pat . no . 4 , 830 , 006 , issued to haluska , et al ., u . s . pat . no . 4 , 727 , 380 , issued to vollmann et al . and u . s . pat . no . 4 , 587 , 970 , issued to holley et al . the present invention is believed practicable in conjunction with any of the known anti - tachycardia pacing and cardioversion therapies , and it is believed most likely that the invention of the present application will be practiced in conjunction with a device in which the choice and order of delivered therapies is programmable by the physician , as in current cardiac pulse generators . in addition to varying the therapy delivered following a failed attempt to terminate a tachyarrhythmia , it is also known that adjustment of detection criteria may be appropriate . for example , adjustment may comprise reducing the number of intervals required to detect a tachyarrhythmia to allow a more rapid redetection or by changing the interval ranges to bias detection towards detection of ventricular fibrillation , for example as disclosed in u . s . pat . no . 4 , 971 , 058 , issued to pless et al and incorporated herein by reference . in the present invention , selection of the particular electrode configuration for delivery of the cardioversion or defibrillation pulses is controlled via output circuit 548 , under control of cardioversion / defibrillation control circuitry 554 via control bus 546 . output circuit 548 switches the high voltage electrodes 506 and 508 for delivery of the defibrillation or cardioversion pulse regimen , and may also be used to specify a multi - electrode , simultaneous pulse regimen or a multi - electrode sequential pulse regimen . monophasic or biphasic pulses may be generated . one example of circuitry which may be used to perform this function is set forth in u . s . pat . no . 5 , 163 , 427 , issued to keimel , incorporated herein by reference . however , output control circuitry as disclosed in u . s . pat . no . 4 , 953 , 551 , issued to mehra et al . or u . s . pat . no . 4 , 800 , 883 , issued to winstrom both incorporated herein by reference , may also be used in the context of the present invention . alternatively single monophasic pulse regimens employing only a single electrode pair according to any of the above cited references which disclose implantable cardioverters or defibrillators may also be used . fig3 is an illustration of detection interval ranges which may be employed in a preferred embodiment of the present &# 39 ; invention . the specific detection interval ranges are selected and programmed by the physician . as seen , events which occur less than 120 milliseconds ( hereafter &# 34 ; ms &# 34 ;) apart are not detected due to blanking . this is a fixed interval and its length is not programmable by the physician . the range of intervals between detected events taken as indicative of fibrillation are greater than 120 ms and less than 300 ms . that is the fibrillation detection interval ( hereafter &# 34 ; fdi &# 34 ;) extends to 300 ms . this range is programmed and is selected by the physician to suit the particular patient . the range of intervals between detected events taken as indicative of tachyarrhythmia are greater than 300 ms and less than 450 ms . that is the tachyarrhythmia detection interval ( hereafter &# 34 ; tdi &# 34 ;) extends to 450 ms . this range is also programmed and is selected by the physician to suit the particular patient . events having intervals between 450 ms to 923 ms , in the preferred embodiment , are taken as indicative of normal sinus rhythm . that is the brady escape interval ( hereafter &# 34 ; bei &# 34 ;) extends to 923 ms . this range is also programmed and is selected by the physician to suit the particular patient . events which occur at intervals which would be greater than the bei are taken as indicative of bradycardia . for example , if a first event is sensed and a second event is sensed 200 ms later , ventricular fibrillation is provisionally detected . as a second example , if a first event is sensed and second event occurs 100 ms later and a third event occurs 210 ms after the second event , then a ventricular tachycardia ( hereafter &# 34 ; vt &# 34 ;) is provisionally detected . this is so because the second event occurred during blanking and thus was not sensed ; the third event was thereafter sensed a sum of 320 ms after the first , well within the vt zone . it should be noted that the specific times for intervals is for the preferred embodiment and thus is only illustrative of the present invention . other interval lengths may also be used within the scope of the present invention . fig4 is an arrhythmia detection / therapy muscle state diagram of the present invention . as discussed above the present invention features skeletal muscle graft stimulation as well as cardiac stimulation . one of the important requirements of such a system , however , is to accurately detect cardiac arrhythmias and respond with the appropriate therapy . as discussed above , concurrent skeletal muscle graft stimulation may interfere with the detection and diagnosis of arrhythmias . thus , one important feature of the present invention is the manner in which it provides for skeletal muscle graft stimulation as well as cardiac stimulation while also managing the prompt detection and diagnosis of arrhythmias . in particular , the present invention temporarily stops or inhibits skeletal muscle stimulation once the onset of an arrhythmia is sensed . as seen , during normal sinus rhythm the system remains at normal sinus rhythm state 30 . in state 30 device provides both skeletal muscle graft stimulation and any bradycardia stimulation required . bradycardia stimulation may take the form of any suitable electrical stimulation therapy , and preferably is given in the form of vvi pacing , although other types of pacing therapy may be delivered , such as voo , ovo and wt . bradycardia stimulation is delivered , in the preferred embodiment , upon the detection of a sequence of cardiac events in which the range of intervals between detected events greater than bei . if , however , a sequence of cardiac events is detected in which the range of intervals between detected events is less than the tdi , then the skeletal muscle stimulation is inhibited ( as represented by line 31 ) and vt counting mode state 32 is reached . in the preferred embodiment , if only one tdi is detected , then the skeletal muscle stimulation is inhibited and vt counting mode state 32 is reached . while in the vt counting mode state 32 , the skeletal muscle stimulation is re - enabled and the device returns to normal sinus rhythm state 30 if one interval greater than the tdi is detected . in addition , when a sequence of cardiac events is detected in which the range of intervals between detected events is less than the fdi , then the skeletal muscle stimulation is inhibited ( as represented by line 31 ) and vf counting mode state 34 is reached . in the preferred embodiment , if only one fdi is detected , then the skeletal muscle stimulation is inhibited and vf counting mode state 34 is reached . while in the vf counting mode state 34 , if vt detection is programmed on , the skeletal muscle stimulation is re - enabled and the device returns to normal sinus rhythm state 30 upon the detection of consecutive events with intervals greater than tdi equal to one - third of the number of intervals to detect vf ( hereafter &# 34 ; vfnid &# 34 ;). if , however , vt detection is programmed off , the skeletal muscle stimulation is re - enabled and the device returns to normal sinus rhythm state 30 upon the detection of consecutive intervals greater than fdi equal to one - third of vfnid . of course , if vt detection is programmed off , deliver vt therapy state 36 may still be reached through combined count state 38 , discussed below . it should be noted because fdi is smaller than tdi , then when vf counting mode state 34 is reached , this necessarily implies vt counting mode state 32 is also reached . from an electronic circuit design perspective , however , the counting bins for each state are simultaneously active , although both not necessarily registering events at the exact same time . while in vt counting mode state 32 the device counts the number of events which meets the tdi criterion . when the cumulative vt event counter is equal to the number of intervals to detect vt , also called vtnid , then vt detection is fulfilled , deliver vt therapy state 36 is reached and vt therapy is delivered . in the preferred embodiment vtnid is programmable . as discussed in more detail below , vt detection and deliver vt therapy state 36 may also be reached through combined count state 38 . while in the vf counting mode state 34 the device counts the number of events which meet the fdi criterion . when the cumulative event counter is equal to vfnid , then vf detection is fulfilled , deliver vf therapy state 40 is reached and vf therapy is delivered . in the preferred embodiment vfnid is programmable . as discussed above , vfnid essentially is the number of past events that must satisfy the fdi criteria to be detected as fibrillation . the count uses past events that have been stored in the fibrillation event buffer memory ( located in the ram 526 of fig2 ) which include both paced and sensed events . for example , if vfnid is set to 18 and fibrillation event buffer is set to 24 ; then to detect vf 18 of the last 24 events must satisfy the fdi criteria . as seen , deliver vf therapy state 40 may also be reached combined count state 38 . combined count state 38 is provided to avoid excessive detection times during competing vt and vf counters . thus combined count state 38 is reached , in the preferred embodiment , when the vf event counter reaches five and the vt event counter plus the vf event counter is greater than or equal to the combined number of intervals to detect parameter ( hereafter &# 34 ; cnid &# 34 ;). in the preferred embodiment cnid is not directly programmable , but rather is equal to seven sixths of vfnid . once the combined count state 38 is reached , then the second look criterion is applied . second look criterion is used only after combined count state 38 is reached . second look criterion is applied to determine whether vt or vf therapy should be delivered . in the preferred embodiment second look criterion is as follows : if all of the previous 8 intervals are greater than or equal to fdi , then the vt detected path should be followed and deliver vt therapy state 36 is reached , but if one of the previous 8 intervals is less than fdi , then the vf detected path will be followed and deliver vf therapy state 40 is reached . once deliver vf therapy state 40 is reached , vf therapy is completed or aborted and vt / vf termination detection state 42 is reached . similarly once deliver vt therapy state 36 is reached , vt therapy is completed or aborted and vt / vf termination detection state 42 is reached . while in vt / vf termination detection state 42 , the device determines whether vt or vf is re - detected . if either vt or vf is detected , then the device returns to the relevant therapy state . if neither vt nor vf is re - detected , the device returns to normal sinus state 30 . vt / vf termination detection is accomplished as follows : if vt detection is programmed &# 34 ; off &# 34 ; and eight consecutive events having intervals greater than fdi are sensed , then vf termination is detected and the device returns to normal sinus state 30 . if vt detection is programmed &# 34 ; on &# 34 ; and eight consecutive events having intervals greater than tdi ( which by definition is greater than fdi ) are sensed , then vt termination is detected and the device returns to normal sinus state 30 . as discussed above the present invention also features skeletal muscle stimulation while charging for defibrillation . essentially this feature provides muscle stimulation pulses to the grafted skeletal muscle while the device is charging a capacitor to deliver a defibrillation pulse . as mentioned above , because the muscle continues to contract and causes cardiac perfusion to be maintained . this cardiac perfusion , in turn , limits the increase in the overall defibrillation threshold . because the increase in these thresholds is minimized , this permits the device to feature smaller capacitors or lower voltages or both . fig5 is a timing diagram showing the relationship between muscle stimulation , cardiac events and a defibrillation charge cycle . as seen , during normal sinus rhythm , represented here by normal qrs complex 202 the device is in normal sinus state 30 . as such , muscle stimulation burst 201 is delivered to stimulate the skeletal muscle graft and thereby provide cardiac assistance , as described above . at first occurrence of a vf event 204 device enters detection state 206 . as explained in fig4 during detection state 206 device is in vf counting mode state 34 and vt counting mode state 32 . as also explained in fig4 once a vf event 204 is detected all muscle stimulation is inhibited , as may be seen in the lack of any muscle bursts in the region of detection state 206 . once vf is confirmed the device then enters deliver vf therapy state 40 . while in deliver vf therapy state 40 , device performs several operations , including charging of the output capacitors , depicted as line 208 . in addition , skeletal muscle stimulation is re - initiated and a series of asynchronous muscle stimulation bursts 210 , 212 are delivered . in the preferred embodiment asynchronous bursts 210 , 212 have a greater amplitude than muscle stimulation burst 201 , on the order of one and a half times as large . once charging of the output capacitors is completed , a sequence to synchronize the defibrillation discharge to a sensed r - wave is undertaken . in particular , device begins a synchronization sequence during synchronization time 216 . synchronization sequence is undertaken to synchronize defibrillation discharge to a sensed cardiac event as well as to re - confirm the presence of the arrhythmia . if the synchronization sequence is successful , then defibrillation discharge 214 is delivered synchronized to a sensed cardiac event . if the synchronization sequence is unsuccessful , then defibrillation discharge 214 is delivered at the timing out of synchronization time 216 . in addition during synchronization time 216 , device re - inhibits skeletal muscle stimulation in order to permit reliable sensing of any intrinsic cardiac events . fig6 is a timing diagram showing the relationship between muscle stimulation and cardiac events of an alternate embodiment . in particular , in an alternate embodiment , if synchronization is unsuccessful , then the device delivers an asynchronous muscle stimulation burst 322 immediately prior to defibrillation discharge 214 , as best seen in fig6 . muscle stimulation burst 322 is intended to cause the heart to be squeezed by the skeletal muscle graft and achieve roughly a systolic position when defibrillation discharge 214 is delivered . because the volume of the heart in such a position is decreased the defibrillation threshold is likewise decreased . turning again to fig5 once defibrillation discharge 214 is delivered , then device enters into vt / vf termination detection state 42 to thereby confirm heart has returned to normal sinus rhythm . fig7 depicts an alternate muscle stimulation burst which may be used with the present system . these muscle stimulation bursts may be used at any suitable time within the present system , and are not limited to only use prior to delivery of the defibrillation therapy . as seen muscle stimulation burst 300 occurs after qrs 303 in the amount of a synchronization delay 305 . in the preferred embodiment synchronization delay 305 is programmable and is undertaken in order to synchronize the muscle stimulation burst 300 with the ventricular contraction . muscle stimulation burst 300 has essentially two sections , first section 301 and second section 302 , often referred to as &# 34 ; muscle catch &# 34 ; and &# 34 ; muscle pulse train &# 34 ; respectively . as seen , first section 301 has a smaller interpulse interval 304 within the burst , i . e . a higher frequency . in comparison second section 302 has a relatively larger interpulse interval 304 within the burst , i . e . a relatively smaller frequency . the higher frequency first section 301 increases the velocity and force of the skeletal muscle graft contraction . in the preferred embodiment interpulse interval 304 and number of pulses in the catch may be selected by the physician . the pulse waveform , amplitude 308 and width of the muscle catch are the same for the remainder of the burst . fig8 depicts an alternate embodiment of the muscle catch stimulation which may be used with the present system . as seen all parameters of the muscle stimulation burst 300 are the same as that described above with respect to fig7 but for the amplitude of second section 302 . fig9 depicts an alternate embodiment of the muscle catch stimulation which may be used with the present system . as seen all parameters of the muscle stimulation burst 300 are the same as that described above with respect to fig7 but for the amplitude of second section 302 . in particular amplitude of each burst within second section 302 decreases . the rate of decrease of pulse amplitude within each burst decreases as a function of rate , i . e . the faster the rate of muscle stimulation , the greater the decrease of pulse amplitude within the pulse train . as discussed above , the mechanically induced cardiac output augmentation of the present invention during vf ( which is associated with loss of cardiac output ) leads to maintaining defibrillation thresholds during prolonged episodes of fibrillation , thus resulting in longer battery life or smaller device size or both . it also permits a longer charging interval without the concern of a dangerously low or temporarily lost cardiac output . while the present invention has been described in detail with particular reference to a preferred embodiment , it will be understood variations and modifications can be effected within the scope of the following claims . such modifications may include substituting elements or components which perform substantially the same function in substantially the same way to achieve substantially the same result for those described herein .

a device and algorithm for a combined cardiomyostimulator and a cardiac pacer - cardioverter - defibrillator . in particular the present device operates , in a first embodiment , to deliver stimulation to a skeletal muscle grafted about a heart ; sense depolarizations of a patient &# 39 ; s heart ; measure the intervals separating successive depolarizations of the patient &# 39 ; s heart ; define first and second interval ranges ; determine the number of the measured intervals falling within the first and second interval ranges ; inhibit the delivery of stimulation to a skeletal muscle grafted about a heart upon the sensing of a depolarization within the first or second interval range ; detect the occurrence of a first type of arrhythmia when the number of the measured intervals falling within the first interval range equals a first predetermined value ; detect the occurrence of a second type of an arrhythmia when the number of the intervals falling within the second interval range equals a second predetermined value ; deliver a first type of arrhythmia therapy in response to the detection of the first arrhythmia ; and deliver a second type of arrhythmia therapy in response to the detection of the second arrhythmia , the second type of arrhythmia therapy having a cardiac stimulation component and a skeletal muscle component .

specific , non - limiting embodiments of the present invention will now be described with reference to the drawings . it should be understood that such embodiments are by way of example and are merely illustrative of but a small number of embodiments within the scope of the present invention . various changes and modifications obvious to one skilled in the art to which the present invention pertains are deemed to be within the spirit , scope and contemplation of the present invention as further defined in the appended claims . fig1 a - 1b depicts a basic structure of an embodiment of the accommodating intraocular lens ( iol ) 100 . the iol 100 is depicted as comprising an elastically deformable lens chamber 110 , a base lens 150 , and a lens periphery 170 coupling the lens chamber 110 and the base lens 150 . the elastically deformable lens chamber 110 provides most , if not all , of the accommodative power by deforming or changing in curvature in response to the radially compressive forces that are exerted onto the iol 100 during accommodation . the base lens 150 provides most , if not all , of the corrective refractive power that is required by a particular patient and is not required to deform or change in shape or curvature . thus , the lens chamber 110 and the base lens 150 cooperate to restore both a patient &# 39 ; s vision and natural range of accommodation . the lens chamber 110 is made of an elastically deformable material and comprises opposing sides 112 and 114 that are joined together at the periphery of the lens chamber 110 to define a bi - convex exterior shape and an internal enclosed cavity 120 . each of the opposing sides 112 and 114 comprise a central region 112 a , 114 a and a peripheral region 112 b , 114 b and a gradient of thickness that increases radially from the peripheral region 112 b , 114 b to the central region 112 a , 114 a . this thickness profile is intended to encourage deformation of the opposing sides 112 , 114 away from one another and to permit the opposing sides to bulge and increase its curvature in opposing directions along an optical axis a - a without causing the membrane to buckle about the central region 112 a , 114 a . thus , while the conventional wisdom suggests that a greater degree of deformation and outward bulging would be achieved with the opposite thickness profile ( e . g ., a thickness profile that decreases radially from the peripheral region 112 b , 114 b to the central region 112 a , 114 a ), such a thickness profile is more likely to cause the lens chamber 110 to buckle or collapse inwardly about the central region 112 a , 114 a upon the application of a radially compressive force once implanted in a patient &# 39 ; s eye . during accommodation , the application of radially compressive forces may cause an internal vacuum to develop inside the lens chamber 110 , thereby causing the opposing sides 112 , 114 to buckle inwardly . thus , in a particularly preferred embodiment , the opposing sides have a gradually increasing thickness from the peripheral regions 112 b , 114 b , to the central region 112 a , 114 a . in a preferred embodiment , the central region 112 a , 114 a , as measured along the optical axis a - a , has a thickness that is two times or more , preferably three times or more , and most preferably four times or more than the thickness of the peripheral region 112 b , 114 b , as measured just adjacent to the area where the opposing sides 112 , 114 join at the peripheral region . in another preferred embodiment , the point of greatest thickness in the central region 112 a , 114 a and the point of least thickness in the peripheral regions 112 b , 114 b is characterized as having a thickness ratio of 2 : 1 or greater , preferably 3 : 1 or greater , and most preferably 4 : 1 or greater . in one embodiment , the central region 112 a , 114 a , as measured along the optical axis a - a , comprises an area of thickness that is about 100 microns , preferably about 200 microns , and the peripheral region 112 b , 114 b comprises an area of thickness that is about 50 microns as measured just adjacent to the area where the opposing sides 112 , 114 join at the peripheral region . while the thickness profile is described in relation to fig1 a - 1b , it is understood that the same or a substantially similar thickness profile may be provided for all of the iol devices depicted and described herein . the base lens 150 is coupled to the lens chamber 110 via a lens periphery 170 . the base lens 150 may be a positive lens that provides convergent power , such as a bi - convex , plano - convex or a positive meniscus lens . alternatively , the base lens 150 may be a negative lens that provides divergent power , such as a bi - concave , plano - concave or a negative meniscus lens . the base lens 150 depicted in fig1 a - 1b is a positive meniscus lens . the base lens 150 is preferably more rigid than the opposing sides 112 , 114 of the lens chamber 110 . the greater rigidity may be imparted by providing a base lens 150 having a thickness that is significantly greater than the thicknesses of the opposing sides 112 , 114 of the lens chamber 110 . alternatively or in addition to providing a greater thickness , the base lens 150 may be made of a different or stiffer material having a higher elastic young &# 39 ; s modulus as compared to the lens chamber 110 . the base lens 150 preferably does not substantially change its shape and curvature in response to the radially - compressive accommodative force applied onto the peripheral edge 180 of the lens periphery 170 . instead , the radially compressive accommodative forces are transferred onto the lens chamber 110 to cause the desired deforming changes . in a preferred embodiment , the base lens 150 is substantially thicker than one of the opposing sides 112 , 114 of the lens chamber 110 , as measured along the optical axis a - a . in a preferred embodiment , the thickness of each one of the opposing sides 112 , 114 of the lens chamber 110 , as along the optical axis a - a depicted in fig1 a - 1b and 9 , is less than ½ , preferably less than ⅓ , preferably less than ¼ , and most preferably less than ⅕ of the thickness of the base lens 150 at the central optical axis a - a . because the base lens 150 is substantially thicker than either one of the opposing sides 112 , 114 of the lens chamber 110 , the base lens 150 has an effective young &# 39 ; s modulus that is substantially greater than either one of the opposing sides 112 , 114 of the lens chamber 110 . while fig1 a - 1b and 9 depict the relative thickness of the opposing sides 112 , 114 of the lens chamber 110 and the base lens 150 for iol 100 , it is understood that all of the iol devices disclosed herein may have the same or similar thickness profile with respect to the lens chamber 110 and the base lens 150 . the lens chamber 110 and the base lens 150 are coupled together by a lens periphery 170 . the lens periphery 170 comprises a circumferential edge 180 configured to engage a circumferential region of the capsular bag of the eye . as depicted in fig1 a - 11c , the circumferential region 52 is where the capsular bag 40 is coupled to the zonules 50 , generally at a location where the density of the zonules 50 is the greatest . the zonules 50 , in turn , couple the capsular bag 40 to the ciliary muscles 60 which contract and relax to provide a range of accommodation . while fig1 b and 11c depict a particularly preferred embodiment in which an iol 100 is implanted with the lens chamber 110 being oriented anteriorly within the lens capsule 40 of the eye , it is understood that the iol 100 may also be implanted with the lens chamber 110 being oriented posteriorly within the lens capsule 40 of the eye . the lens periphery 170 comprises a radial portion 172 and a circumferential hinge 174 that cooperate together to transmit a significant portion , if not most , of the radially compressive forces exerted onto the circumferential edge 180 onto the lens chamber 110 and away from the base lens 150 . referring back to fig1 a - 1b , the radial portion 172 extends radially inwardly from the lens periphery 170 to the lens chamber 110 and the hinge 174 is disposed between the lens periphery 170 and the base lens 150 . both the radial portion 172 and the hinge 174 cooperate to maximize the extent to which the radially - compressive accommodative forces applied to the peripheral edge 180 are transmitted to the lens chamber 110 . the greater the force transmitted to the lens chamber 110 , the greater the deformation and change of curvature of the opposing sides 112 , 114 of the lens chamber 110 . the lens periphery 170 may be solid and thickened as compared to the base lens 150 , as depicted in fig1 a - 1b and 9 . alternatively , the lens periphery 170 may comprise a hollow space or a circumferential channel to reduce the delivery profile of the iol , as depicted in fig2 a , 3b , 4 , 6 , 7 , and 8 . because the iol 100 is implanted into a relatively small incision size , it must be rolled up to assume a delivery profile that is at least as small as the incision size . the circumferential hinge 174 is provided as a thinned or grooved area disposed in the lens periphery 170 and surrounding the base lens 150 . the circumferential hinge 174 permits the lens periphery 170 to pivot radially inwardly towards the lens chamber 110 such that the radially compressive forces applied to the circumferential edge 180 are directed substantially along the radial portion 172 and applied to the lens chamber 110 , as opposed to being applied to the base lens 150 , which is configured to generally resist deformation ( see fig1 c ). thus , the radial portion 172 is itself preferably sufficiently rigid in order to substantially transmit the radial compressive force onto the lens chamber 110 . in a preferred embodiment , the hinge 174 is provided both peripherally and circumferentially around the base lens 150 as a thinned area or as a groove . fig1 b and 11c depicts the configuration of the iol 100 in the absence of a radial compressive force applied to the circumferential peripheral edge 180 ( fig1 b , an unaccommodated eye ) and in the presence of a radial compressive force applied to the circumferential peripheral edge 180 ( fig1 c , an accommodated eye ) in which the peripheral edge 180 tilts in the direction c about the hinge 174 , transmitting the radial compressive forces onto the lens chamber 110 , and thereby causing the opposing sides 112 , 114 of the lens chamber 110 to be displaced apart from one another and increase in curvature . the features described herein which are intended to maximize the extent to which the radially compressive forces are transmitted to a lens chamber 110 and thus provide a large range of accommodation . the iols described herein may further be made of a material that does not resist deformation or is characterized as having a low young &# 39 ; s modulus . the iols may be made of a single material or , alternatively , different portions of the iol may be made of different materials having differing young &# 39 ; s modulus ( see fig1 a - 10b ). in one preferred embodiment , at least the opposing sides 112 , 114 of the lens chamber 110 is made of a material of sufficient mechanical strength to withstand physical manipulation during implantation , but is of sufficiently low young &# 39 ; s modulus so as to minimize its resistance to deformation . in a preferred embodiment , the opposing sides 112 , 114 of the lens chamber 110 is made of a polymer having a young &# 39 ; s modulus of 100 psi or less , preferably 75 psi or less , and most preferably 50 psi or less . in one preferred embodiment , the remaining portions of the iol 100 ( e . g ., the base lens 150 , the peripheral portion 170 ) has a young &# 39 ; s modulus that is greater than the young &# 39 ; s modulus of the walls 112 , 114 , of the lens chamber 110 . the walls 112 , 114 of the lens chamber 110 may be a polymer , preferably a silicone polymer and , more preferably a phenyl siloxane , such as a vinyl - terminated phenyl siloxane or a vinyl - terminated diphenyl siloxane . in order to impart sufficient mechanical strength , the polymer may be crosslinked , reinforced with fillers , or both . the fillers may be a resin or silica that have been functionalized to react with the polymer . the opposing sides 112 , 114 of the lens chamber 110 defines an enclosed cavity 120 that is filled with a fluid or gel having specific physical and chemical characteristics to enhance the range of refractive power provided by the iol during accommodation . the fluid or gel is selected such that it cooperates with the walls 112 , 114 of the lens chamber 110 in providing a sufficient range of accommodation of up to at least 3 diopters , preferably up to at least 5 diopters , preferably up to at least 10 diopters and most preferably up to at least 15 diopters . in a preferred embodiment , the enclosed cavity 120 is filled with the fluid or gel before implantation of the iol 100 into the capsular bag 40 of the eye and , in a more preferred embodiment , the cavity 120 is filled with the fluid or gel in the manufacture of the iol 100 . in one preferred embodiment the enclosed cavity 120 is filled with a fluid , such as a gas or a liquid , having low viscosity at room temperature and a high refractive index . in a preferred embodiment , the fluid is a liquid having a viscosity of 1 , 000 cp or less at 23 ° c . and a refractive index of at least 1 . 46 , 1 . 47 , 1 . 48 , or 1 . 49 . the fluid may be a polymer , preferably a silicone polymer , and more preferably a phenyl siloxane polymer , such as a vinyl - terminated phenyl siloxane polymer or a vinyl - terminated diphenyl siloxane polymer . preferably , in embodiments where the fluid is made of a polymer , the polymer is preferably not crosslinked and that the polymer may be linear or branched . where the fluid is a vinyl - terminated phenyl siloxane polymer or diphenyl siloxane polymer , the vinyl groups may be reacted to form other moieties that do not form crosslinkages . in accordance with one embodiment , fluid may be a polyphenyl ether (“ ppe ”), as described in u . s . pat . no . 7 , 256 , 943 , entitled “ variable focus liquid - filled lens using polyphenyl ethers ” to teledyne licensing , llc , the entire contents of which are incorporated herein by reference as if set forth fully herein . in accordance with another embodiment , the fluid may be a fluorinated polyphenyl ether (“ fppe ”). fppe has the unique advantage of providing tunability of the refractive index while being a chemically inert , biocompatible fluid with low permeability in many polymers . the tunability is provided by the increasing or decreasing the phenyl and fluoro content of the polymer . increasing the phenyl content will effectively increase the refractive index of the fppe , whereas increasing the fluoro content will decrease the refractive index of the fppe while decreasing the permeability of the fppe fluid through the walls 112 , 114 of the lens chamber 110 . in another preferred embodiment , the enclosed cavity 120 is filled with a gel . the gel preferably has a refractive index of at least 1 . 46 , 1 . 47 , 1 . 48 , or 1 . 49 . the gel may also preferably have a young &# 39 ; s modulus of 20 psi or less , 10 psi or less , 4 psi or less , 1 psi or less , 0 . 5 psi or less , 0 . 25 psi or less and 0 . 01 psi or less . in a preferred embodiment , the gel is a crosslinked polymer , preferably a crosslinked silicone polymer , and more preferably a crosslinked phenyl siloxane polymer , such a crosslinked vinyl - terminated phenyl siloxane polymer or a vinyl - terminated diphenylsiloxane polymer . other optically clear polymer liquids or gels , in addition to siloxane polymers , may be used to fill the cavity 120 and such polymers may be branched , unbranched , crosslinked or uncrosslinked or any combination of the foregoing . a gel has the advantages of being extended in molecular weight from being crosslinked , more self - adherent and also adherent to the walls or opposing sides or walls 112 , 114 of the lens chamber 110 than most liquids . this makes a gel less likely to leak through the walls 112 , 114 of the lens chamber 110 . in order to obtain the combination of accommodative power with relatively small deformations in the curvature of the walls 112 , 114 of the lens chamber 110 , the gel is selected so as to have a high refractive index while being made of an optically clear material that is characterized as having a low young &# 39 ; s modulus . thus , in a preferred embodiment , the gel has a refractive index of 1 . 46 or greater , preferably 1 . 47 or greater , 1 . 48 or greater and most preferably 1 . 49 or greater . at the same time , the gel preferably has a young &# 39 ; s modulus of 10 psi or less , preferably 5 psi or less , and more preferably 1 psi or less . in a particularly preferred embodiment , the gel has a young &# 39 ; s modulus of 0 . 5 psi or less , preferably 0 . 25 psi or less , and most preferably 0 . 01 psi or less . it is understood that at lower young &# 39 ; s modulus , the gel will present less resistance to deformation and thus the greater the deformation of the walls 112 , 114 of the lens chamber 110 for a given unit of applied force . in particularly preferred embodiment , the gel is a vinyl - terminated phenyl siloxane that is produced based on one of the four formulas provided as follows : 100 parts 20 - 25 mole % vinyl terminated diphenylsiloxane - dimethylsiloxane copolymer ( gelest pdv 2335 ). 3 ppm platinum complex catalyst 0 . 35 pph of phenyl siloxane hydride crosslinker ( nusil xl - 106 ) young &# 39 ; s modulus of elasticity = 0 . 0033 psi 100 parts 20 - 25 mole % vinyl terminated diphenylsiloxane - dimethylsiloxane copolymer ( gelest pdv 2335 ). 3 ppm platinum complex catalyst 0 . 4 pph of phenyl siloxane hydride crosslinker ( nusil xl - 106 ) young &# 39 ; s modulus of elasticity = 0 . 0086 psi 100 parts 20 - 25 mole % vinyl terminated diphenylsiloxane - dimethylsiloxane copolymer ( gelest pdv 2335 ). 3 ppm platinum complex catalyst 0 . 5 pph of phenyl siloxane hydride crosslinker ( nusil xl - 106 ) young &# 39 ; s modulus of elasticity = 0 . 0840 psi 100 parts 20 - 25 mole % vinyl terminated diphenylsiloxane - dimethylsiloxane copolymer ( gelest pdv 2335 ). 3 ppm platinum complex catalyst 0 . 6 pph of phenyl siloxane hydride crosslinker ( nusil xl - 106 ) young &# 39 ; s modulus of elasticity = 2 . 6 psi the walls 112 , 114 of the lens chamber 110 and the fluid or gel contained within the lens cavity 120 are preferably selected so as to prevent or reduce the likelihood of the fluid or gel migrating outside of the walls 112 , 114 of the lens chamber 110 . thus , in a preferred embodiment , one or both of the walls 112 , 114 of the lens chamber 110 and the fluid or gel is / are selected from biocompatible materials that optimize the resistance to permeability of the fluid or gel across the walls 112 , 114 of the lens chamber 110 . one method of decreasing the permeability of the gel contained inside the cavity 120 across the walls 112 , 114 of the lens chamber 110 is to provide a gel that is cross - linked . the degree of cross - linking , however , must be selected and controlled such that , on the one hand , the walls 112 , 114 of the lens chamber 110 and the gel have a sufficiently low young &# 39 ; s modulus to minimize the resistance of the walls 112 , 114 of the lens chamber 110 to deformation and , on the other hand , to minimize the permeation of the gel across the walls 112 , 114 of the lens chamber 110 . thus , in a preferred embodiment , longer chain polymers that are lightly cross - linked , such as those used for silicone gels , starting with monomers having molecular weights that are greater than 35 , 000 daltons , preferably greater than 50 , 000 daltons and , most preferably , at least 70 , 000 daltons are desired . in another preferred embodiment , a gel is used having low permeability extractables . such gels may be formulated by using long chain polymers that are branched . in a preferred embodiment , one or both of the lens chamber walls 112 , 114 and the gel is made of homo - or co - polymers of phenyl - substituted silicones . for the lens chamber walls 112 , 114 , the crosslinked homo - or co - polymers preferably have a diphenyl content of 5 - 25 mol %, preferably 10 - 20 mol % and more preferably 15 - 18 mol %. alternatively , for the lens chamber walls 112 , 114 , the homo - or co - polymers preferably have a phenyl content of 10 - 50 mol %, preferably 20 - 40 mol %, and more preferably 30 - 36 mol %. for the gel , the homo - or co - polymers preferably have a diphenyl content of 10 - 35 mol %, preferably 15 - 30 mol % and more preferably 20 - 25 mol %. alternatively , for the gel , the homo - or co - polymers preferably have a phenyl content of 20 - 70 mol %, preferably 30 - 60 mol % and more preferably 40 - 50 mol %. in a particularly preferred embodiment , the lens chamber walls 112 , 114 are made of a crosslinked phenyl siloxane having a diphenyl content of about 15 - 18 mol % or a phenyl content of about 30 - 36 mol % and the gel is made of a phenyl siloxane having a diphenyl content of about 20 - 25 mol % or a phenyl content of about 40 - 50 mol %. the lens chamber walls 112 , 114 are understood to be more crosslinked than the gel . in a particularly preferred embodiment , the lens chamber walls 112 , 114 are made of a vinyl - terminated phenyl siloxane , most preferably a crosslinked vinyl - terminated phenyl siloxane . reinforcing agents , such as silica , may also be included in a range 10 - 70 mol %, preferably 20 - 60 mol % and most preferably 30 - 50 mol %. the walls 112 , 114 of the lens chamber 110 and the fluid or gel contained within the lens cavity 120 are also preferably selected so as to increase the range of accommodative power that is provided by the lens chamber 110 . in one preferred embodiment , the walls 112 , 114 of the lens chamber 110 are made of a material having a lower refractive index than the fluid or gel contained in the enclosed cavity . in one preferred embodiment , the refractive index of the lens walls 112 , 114 of the chamber 110 is 1 . 38 and the refractive index of the gel or fluid is 1 . 49 . the differential refractive indices provided by the lens chamber walls 112 , 114 and the gel or liquid contained within the chamber 120 may be provided by the differences in the materials or the composition of the materials used for the lens chamber walls 112 , 114 and the gel or liquid . in one embodiment , both the lens chamber walls 112 , 114 and the gel or liquid is made of a phenyl siloxane having different diphenyl or phenyl content . in a preferred embodiment , the lens chamber walls 112 , 114 has a diphenyl or phenyl content that is less than that for the gel or liquid . in another preferred embodiment , the walls 112 , 114 of the lens chamber 110 may be made of a cross - linked vinyl - terminated phenyl siloxane having a diphenyl content of 15 - 18 mol % or a phenyl content of 30 - 36 mol % and the gel contained within the walls 112 , 114 of the lens chamber 110 may be made of a vinyl - terminated phenyl - siloxane having a diphenyl content of 20 - 25 mol % or a phenyl content of 30 - 36 mol %. in another embodiment , the differential refractive indices may be provided by providing a dimethyl siloxane for the lens chamber walls 112 , 114 and the gel may be a phenyl siloxane having a high diphenyl or phenyl content . in a preferred embodiment , the diphenyl content is at least 20 mol %, at least 25 mol %, at least 30 mol %, at least 35 mol %, and at least 40 mol %. alternatively , the phenyl content is at least 40 mol %, at least 50 mol %, at least 60 mol %, at least 70 mol %, and at least 80 mol %. in a further embodiment , the differential refractive indices may be provided by a crosslinked fluoro siloxane , such as a 3 , 3 , 3 - trifluoropropylmethyl siloxane and the gel may be a phenyl siloxane having a high diphenyl or phenyl content . in a preferred embodiment , the diphenyl content is at least 20 mol %, at least 25 mol %, at least 30 mol %, at least 35 mol %, and at least 40 mol %. alternatively , the phenyl content is at least 40 mol %, at least 50 mol %, at least 60 mol %, at least 70 mol %, and at least 80 mol %. now turning back to fig1 a - 1b , a main cavity 130 is defined between the lens chamber 110 , the base lens 150 and the lens periphery 170 . the main cavity 130 is preferably filled with a fluid or gel . the fluid or gel in the main cavity 130 may be the same as the fluid or gel contained in the enclosed cavity 120 . in a preferred embodiment , the fluid is a saline solution and the main cavity 130 is filled with the saline solution after implantation of the iol in the capsular bag of the eye . filling the main cavity 130 after implantation of the iol into the capsular bag will permit the iol to take on a significantly smaller delivery profile such that the iol may be rolled up and inserted through a relatively small incision . in a preferred embodiment , the incision size is less than 6 mm , preferably less than 5 mm , most preferably less than 4 mm and even most preferably less than 3 mm . in embodiments where the main cavity 130 is filled with a fluid or gel after implantation , a valve ( not shown ) is preferably disposed on the iol to permit injection of the fluid or gel into the main cavity 130 after implantation . the valve may be a one - way valve that permits injection of fluid or gel into the main cavity 130 but prevents the fluid or gel from exiting the main cavity 130 . the valve is preferably disposed on the surface of the iol that is facing in the anterior direction after it has been implanted in the eye . it is understood that the valve , however , is preferably not disposed on either one of the opposing sides 112 , 114 so as to avoid disrupting the integrity of the lens chamber 110 which may house the same of different fluid or gel . in a preferred embodiment , the fluids or gels in the respective enclosed cavity 120 and the main cavity 130 are completely segregated from one another . in one preferred embodiment , the enclosed cavity 120 and the main cavity 130 may have a different fluid and / or gel . in another preferred embodiment , one of the enclosed cavity 120 and the main cavity 130 may comprise one of a fluid or gel and the other one of the enclosed cavity 120 and the main cavity 130 may comprise the other one of a fluid or gel . in a preferred embodiment , there is no fluid exchanged between the enclosed cavity 120 and the main cavity 130 . the iol 100 is intended to be implanted in a capsular bag 40 of the eye and centered about an optical axis a - a ( see fig1 a - 11c ). the lens chamber 110 and the base lens 150 are dimensioned to extend to or beyond the effective optical zone b - b as defined about the optical axis a - a of a patient &# 39 ; s eye . the effective optical zone b - b is generally the largest possible opening through which light can enter the eye and thus is controlled by the largest effective diameter of the pupil 30 when completely dilated . this diameter is typically about 4 - 9 mm . therefore , in a preferred embodiment , the diameters of the lens chamber 110 and the base lens 150 is preferably at least 4 mm , at least 5 mm , at least 6 mm , at least 7 mm , at least 8 mm and at least 9 mm . as previously indicated , either one or both of the enclosed cavity 120 of the lens chamber 110 and / or the main cavity 130 is / are filled with a fluid or gel . the fluid may be a gas , a liquid . the fluid or gel preferably is characterized as having a sufficiently high refractive index such that the lens chamber 110 provides a range of accommodation in response to small changes in the curvature of the opposing sides 112 , 114 . because the iol 100 is resiliently biased such that the opposing sides 112 , 114 of the lens chamber 110 are substantially flat or have minimal curvature , small changes in the curvature of the opposing sides 112 , 114 will lead to proportionately greater changes in the refractive power of the lens . thus , the lens chamber 110 , in combination with the base lens 150 , can provide a change in the optical power of up to at least 3 diopters , preferably up to at least 5 diopters , preferably up to at least 10 diopters and most preferably up to 15 diopters in response to the accommodative forces ( e . g ., radially compressive forces ) exerted on the implanted iol . fig2 depicts another embodiment of the iol 200 . the iol 200 is similar in many respects with the iol 100 of fig1 a - 1b in that it comprises a lens chamber 210 , a base lens 250 and a lens periphery 270 joining the lens chamber 210 and the base lens 250 . the lens periphery 270 further comprises a circumferential edge 280 . the iol 200 differs from iol 100 in that iol 200 comprises a plurality of holes 202 disposed circumferentially along the top surface of the iol 200 and externally around the lens chamber 210 and a circumferential channel 240 disposed within the lens periphery 270 . the holes 202 are intended to provide a fluid exchange channel between the circumferential channel 240 , the main cavity 230 and the exterior of the iol 200 . the accommodative forces of the eye &# 39 ; s capsular bag will cause the iol 200 to radially expand and compress which , in turn , will cause the aqueous fluid to enter and exit the main cavity 230 through the holes 202 . in a preferred embodiment , the holes 202 are disposed symmetrically about the top surface of the iol 200 . fig3 a - 3b depict another embodiment of the iol 300 which comprises a plurality of through - holes 302 around the circumferential periphery of the iol 300 . the through - holes 302 differ from the holes 202 in fig2 in that the through - holes are provided through both sides of the iol 300 and the iol 300 does not comprise a circumferential channel , whereas the holes 202 of the iol 200 of fig2 are only provided on the top surface of the iol 200 . the provision of through - holes 302 increase the efficiency with which the aqueous fluid fills and exits the main cavity 330 . moreover , the through - holes 302 are dimensioned to be as large as can fit between the space between the circumferential edge 380 and the lens chamber 310 . one advantage in the provision of numerous large through - holes 302 about the circumferential periphery is that it reduces the material bulk of the iol 300 and permits it to take on a smaller delivery profile when it is folded and inserted into the capsular bag of the eye during implantation surgery . thus , the iol 300 will require a smaller incision for implantation into the capsular bag of the eye . it is understood , however , that the spacing 301 between the through - holes 302 must be sufficient to permit the transfer of force applied to the circumferential edge 380 onto the lens chamber 310 . in a preferred embodiment , the spacing 301 is no more than ¼ , preferably no more than ½ , and most preferably no more than ¾ of the diameter of the through - holes 302 . fig4 depicts another embodiment of the iol 400 also comprising through - holes 402 , except that the through - holes 402 do not provide a fluid exchange between the main cavity 430 and the exterior of the iol 400 . the iol 400 is thus similar to the iol 100 of fig1 a - 1b in that a valve is required such that the main cavity 430 of the iol 400 may be filled after implantation into the capsular bag of the eye . the main function of the through - holes 402 in this embodiment is to reduce the bulk of the iol 400 so as to provide a smaller delivery profile . thus , once implanted , the fluid or gel in the lens cavity 420 and the main cavity 430 remain contained and the iol 400 does not permit for fluid exchange between the fluid in the exterior of the iol 400 and the fluid or gel in the main cavity 430 . fig4 differs from the iols depicted in the preceding figures ( fig1 - 3 ) in that it depicts the shape of the iol 400 when a radial force is applied to the peripheral edge so as to cause a the opposing sides of the cavity 420 to bulge apart from one another . it is noted that the iol 400 must be dimensioned such that the lower wall of the lens cavity 420 does not contact the base lens 450 within a range of the radial force that would be expected during the accommodation of the eye . fig5 a - 5b depict yet a further embodiment of the iol 500 which comprises a plurality of arc - shaped cutouts 502 . the arc - shaped cutouts 502 are configured to function to provide a fluid exchange between the main cavity 530 and the exterior of the iol 500 . the iol 500 comprises radial arms 504 between the arc - shaped cutouts 502 to couple and support the base lens 550 to the lens periphery 570 . in a preferred embodiment , the radial arms 504 comprise a hinge between the peripheral portion 570 and the base lens 550 that permits the radial arms 504 to bend or rock inwardly upon application of a force upon the circumferential edge 580 so that the force is transferred to radially compressing the lens chamber 510 . the hinge may simply be a groove or an area of reduced material thickness that is disposed either on the internal , external or both internal and external surfaces of the radial arms 504 . as with the other iols described herein , the iol 500 returns to a radially - expanded state in the absence of a force applied upon the circumferential edge 580 . the iol 500 is resiliently biased to a flatter configuration as shown in fig5 a in the absence of radially - compressive forces being exerted on the circumferential edge 580 , as when the eye is unaccommodated . the iol 500 is radially compressible to reduce the overall diameter of the lens chamber 110 and thus cause opposing sides 512 , 514 of the lens chamber 510 to increase its curvature upon the application of a radially compressing force onto the circumferential edge 580 , as when the eye is accommodated . see , e . g ., fig4 . fig6 a - 6b depicts yet a further embodiment of the iol 600 which comprises an internal circumferential channel 640 in addition to the enclosed cavity 620 and the main cavity 630 . the circumferential through - holes 602 permit aqueous fluid flow into and out of the circumferential channel 640 and the arc - shaped cutouts 604 permit aqueous fluid flow into and out of the main cavity 630 . radial arms 606 couple the base lens 650 to the peripheral portion 670 and a hinge is disposed on the radial arm between the base lens 650 and the peripheral portion 670 . again , the presence of the internal circumferential channel 640 is intended to reduce the material bulk and thus to permit insertion of the iol 600 through relatively smaller incisions . the iols described herein are intended for implantation in a capsular bag of a patient &# 39 ; s eye following performance of a capsulorhexis , in which a circular portion is removed from the anterior portion of the capsular bag . fig1 a depicts the eye 10 following performance of a capsulhorexis and before implantation of an iol . the eye 10 is depicted as comprising a cornea 20 through which the surgical incision is made to access the capsular bag 40 . the diameter of the circular portion b - b removed from the capsular bag 40 depends upon each person &# 39 ; s individual anatomy is typically in the range of from about 4 mm to about 9 mm . here , the diameter 32 of the circular portion b - b removed from the capsular bag 40 corresponds roughly to the diameter of the pupil 30 . preferably , as much of the capsular bag 40 and its zonular connections 50 are maintained as possible . the zonules 50 couple the capsular bag 40 with the ciliary muscle 60 and transmit the accommodative forces to effectuate the curvature or shape changes of the capsular bag 40 . once the crystalline lens material is removed from the capsular bag 40 , the iol may be inserted and implanted such that the circumferential edge substantially engages the zonules 50 attached to the capsular bag 40 . additionally , the iol is substantially centered along the optical axis a - a and engagement of the iol with the zonules 50 is preferred to reduce the likelihood of decentration . in embodiments of the iol comprising holes and through - holes , it is preferable that the holes and through - holes be located outside of the optical zone b - b . moreover , the holes and through - holes should have rounded edges so as to prevent the perception of glare by the recipient . fig7 a - 7b and 8a - 8b depict an iol 700 which is configured with raised protrusions 790 or troughs 795 adjacent to the through - holes 702 to create a space between the capsular bag and the through - holes 702 and to thereby ensure the free flow of the aqueous fluid in and out of the main cavity 730 and the circumferential channel 740 . the iol 700 comprises three enclosed chambers : an enclosed lens chamber 720 , a main cavity 730 and an internal circumferential channel 740 . a plurality of circumferentially disposed through - holes 702 are sized to provide fluid exchange between both the main cavity 730 and the internal circumferential channel 740 , on the one hand , and the exterior of the iol 700 , on the other hand . the fluid or gel in the lens chamber 720 remains contained within the lens chamber 720 . the iol 700 further comprises arc - shaped cut - outs 704 and radial arms 706 disposed to couple the base lens 750 to the peripheral portion 770 , in the same manner as depicted in fig6 a - 6b . the significant feature of iol 700 is the presence of raised protrusions 790 ( fig7 a - 7b ) or troughs 795 ( fig8 a - 8b ) adjacent the through - holes 702 . the raised protrusions 790 or troughs 795 are configured to ensure that the capsular bag does not form a seal over the through - holes 702 so as to impede or prevent the aqueous fluid from flowing freely in and out of the main cavity 730 and the circumferential channel 740 . as discussed above , the iols described herein are configured to transmit most , if not all , of the radially compressive forces exerted on the circumferential edge onto the lens chamber . in contrast to the elastically deformable lens chamber , the base lens is not configured to deform or change its curvature in response to the radially compressive forces exerted on the circumferential edge . the transfer of the radially compressive forces onto the lens chamber may be accomplished by incorporating one or more of the following features in the iol : ( 1 ) the opposing sides of the lens chamber having a reduced thickness as compared to the base lens , ( 2 ) a hinge disposed between the base lens and the peripheral portion , ( 3 ) utilizing materials having different elastic moduli for the lens chamber and the base lens ; and ( 4 ) the variation of refractive indices provided for the opposing sides of the lens chamber and the fluid or gel contained therein . fig1 a and 10b depict an iol 800 which is constructed of at least two different elastomeric materials having different young &# 39 ; s modulus of elasticity , with at least the base lens 850 being made of a material having a higher young &# 39 ; s modulus than the lens chamber 810 . fig1 a depicts the iol 800 as being constructed by assembling at least five ( 5 ) separately molded pieces , 801 a , 802 a , 803 a , 804 a , and 850 . thus , in addition to the two halves 801 a , 803 a of the lens chamber 810 , the peripheral portion of the iol 800 is provided in two ring portions 802 a , 804 a . the first ring portion 802 a surrounding the lens chamber 810 has a higher elastic young &# 39 ; s modulus than the second ring portion 804 a surrounding the base lens 850 . in a preferred embodiment , the two halves 801 a , 803 a of the lens chamber 810 and the second ring portion 803 a has a young &# 39 ; s modulus of 100 psi or less , preferably 75 psi or less , and most preferably 50 psi or less and the base lens 850 and the first ring portion 802 has a young &# 39 ; s modulus of more than 100 psi , preferably more than 250 psi , and most preferably more than 350 psi . in a particularly preferred embodiment , the young &# 39 ; s modulus of the first ring portion 802 a may be up to 500 psi . fig1 b depicts the iol 800 as being constructed by assembling at least three ( 3 ) separately molded pieces 801 b , 802 b and 803 b . the first lens chamber 810 and the surrounding peripheral portion is provided by assembling 801 b and 802 b and the base lens portion 850 and the surrounding peripheral portion is provided by assembling 803 b to the underside of 802 b . the assembled first lens chamber 810 and surrounding peripheral portion ( 801 b , 802 b ) has a lower elastic young &# 39 ; s modulus than the base lens portion 850 and the surrounding peripheral portion ( 803 b ). in a preferred embodiment , portions 801 b , 802 b has a young &# 39 ; s modulus of 100 psi or less , preferably 75 psi or less , and most preferably 50 psi or less and the base lens portion 803 b has a young &# 39 ; s modulus of more than 100 psi , preferably more than 250 psi and , most preferably , more than 350 psi . in a particularly preferred embodiment , the young &# 39 ; s modulus of the base lens portion 803 b may be up to 500 psi . the invention described and claimed herein is not to be limited in scope by the specific preferred embodiments disclosed herein , as these embodiments are intended as illustrations of several aspects of the invention . indeed , various modifications of the invention in addition to those shown and described herein will become apparent to those skilled in the art from the foregoing description . such modifications are also intended to fall within the scope of the appended claims .

an intraocular lens device comprising a first lens , a second lens and a circumferential haptic . the first lens comprises a pair of opposing and deformable surfaces and a cavity defined therebetween . the first lens has a first lens diameter . the second lens has a second lens diameter . the circumferential haptic has an outer peripheral edge and couples the first lens and the second lens . a main iol cavity is defined by the circumferential haptic , the first lens and the second lens . the iol device is resiliently biased to an unaccommodated state , characterized by the iol device having a first diameter d 1 in the absence of radial compressive forces exerted on the outer peripheral edge . the iol device actuates to an accommodated state being characterized by a second diameter d 2 in response to radial compressive forces exerted on the outer peripheral edge , wherein d 1 & gt ; d 2 .

the present invention relates to an edible composition having a salty taste which consists essentially of an admixture selected from the group consisting of ( 1 ) lysine monohydrochloride and potassium chloride , and ( 2 ) the lysine monohydrochloride , the potassium chloride and succinic acid each of which are food grade , wherein the weight ratio of the lysine monohydrochloride to potassium chloride is between about 1 to 9 and 3 to 2 and wherein the ratio of lysine monohydrochloride to succinic acid is between about 3 to 1 and 13 to 1 and the composition has a ph between about 5 . 5 and 6 . 3 . the present invention also relates to a method for imparting a salty taste to a food which comprises providing an edible composition in the food which consists essentially of an admixture selected from the group consisting of ( 1 ) lysine monohydrochloride and potassium chloride , and ( 2 ) the lysine monohydrochloride , the potassium chloride and succinic acid which are food grade , wherein the ratio of the lysine monohydrochloride to potassium chloride is between about 1 to 9 and 3 to 2 and wherein the ratio of lysine monohydrochloride to succinic acid is between about 3 to 1 and 13 to 1 and the composition has a ph between about 5 . 5 and 6 . 3 . the composition is easily prepared by simple mixing of the ingredients . in order to mask the bitter aftertaste of the potassium chloride there must be between 10 % to 60 % of the lysine monohydrochloride . when crystals of lysine monohydrochloride are physically mixed with crystals of potassium chloride , the resulting mixture has the appearance of , and taste intensity of , table salt , without the characteristic taste of the potassium ion . lysine monohydrochloride can also be co - crystallized with potassium chloride from a solution in which they are soluble ( such as water ) to produce a salty crystalline mixture . the succinic acid produces a more salty taste in amounts between about 0 . 1 and 10 percent by weight in the composition . in the most preferred compositions the weight ratio of lysine monohydrochloride to potassium chloride is between 2 and 3 to 7 . when succinic acid is present , the weight ratio of lysine monohydrochloride to potassium chloride is 2 and 2 . 99 to 7 and the succinic acid is included in an amount between 0 . 1 and 10 percent by weight of the composition . lysine is an essential amino acid and thus is a dietary supplement . potassium chloride is commonly used as a salt substitute to avoid sodium intake . succinic acid is a common food acid . thus , the composition fulfills dietary as well as taste needs . table 1 shows the results of taste tests by a taste panel of 3 people of various compositions incorporating lysine monohydrochloride ( lysmhc ) lysine monohydrate ( lysmh ) potassium chloride ( kcl ) and an acid ( hcl ) or base ( koh ). table 1______________________________________salt molar ratio ofname lys / cl / k solution comp . sol . ph taste______________________________________1 2 : 4 : 2 lysmhc + kcl 5 . 55 salty +++ 2 2 : 3 : 1 lysmhc + kcl 5 . 66 salty - acid3 2 : 2 : 1 lysmhc + lysmh + kcl 9 . 34 salty4 4 : 3 : 1 lysmhc + lysmh + kcl 9 . 48 salty - sweet5 2 : 2 : 1 lysmhc + koh 9 . 50 salty - metallic6 2 : 6 : 2 lysmhc + kcl + hcl 1 . 00 acidic______________________________________ * the salt + tastes saltier than salty and salty - tastes less saltier than salty . ** the water used was double distilled water . a crystallized dry salt product composed of lysmhc and kcl ( 1 ) with a molar ratio of 2 : 4 was found to possess the desired salty taste . table 2 shows the results of taste tests by a taste panel of 3 people for various mixtures of lysine monohydrochloride ( lysmhc ) and kcl mixtures as dry salts and in solution . table 2______________________________________weight % sol ./ 2 glysmhc / kcl dry mixture water ph______________________________________0 / 100 ( 25 %) irritates irritates 7 . 6210 / 90 salty ++++* salty ++++ 6 . 2320 / 80 salty +++ salty ++++ 6 . 2130 / 70 salty ++ salty +++ 6 . 1240 / 60 salty ++ salty +++ 6 . 0150 / 50 salty + salty + 5 . 9960 / 40 salty salty 5 . 9770 / 30 salty - salty + 5 . 8780 / 20 salty -- salty + 5 . 8390 / 10 salty --- salty -- 5 . 71100 / 0 ( 33 %) salty - sweet salty - sweet 5 . 75100 % dd ** water -- -- 5 . 70______________________________________ * the salt + tastes saltier than salty and salty - tastes less saltier than salty . ** double distilled water . as can be seen from table 2 mixtures including 10 to 60 % of the lysine monohydrochloride with potassium hydrochloride had the desired taste both in dry form and in solution . these mixtures also had an acid ph between about 5 . 5 and 6 . 3 depending upon the amount of lysine monohydrochloride . table 3 shows different concentrations of a thirty weight percent ( 30 %) lysine monohydrochloride to potassium chloride mixture ( dry ) mixed which is then dissolved in water used in taste tests by a taste panel of 3 people . as can be seen , the mixture can be used in an amount up to about 30 % by weight in water to produce the desired salty taste . table 3______________________________________30 wt % lys / kclcont . in water ph taste comment______________________________________10 6 . 04 salty clear sol . 20 6 . 02 salty + clear sol . 30 6 . 02 salty ++ clear sol . 40 5 . 90 irritates saturated25 % ( 100 % kcl ) 7 . 62 irritates clear sol . 25 % ( 100 % 7 . 11 standard blurrednacl ) sol . ______________________________________ no other amino acid tested ( including glutamic acid , glutamic acid monohydrochloride , glycine , glycine monohydrochloride , and lysine monohydrate ) provided the masking of the potassium taste . the optimal concentration of lysine monohydrochloride in the mixture was about thirty percent ( 30 %) by weight in example 3 based upon taste tests . a preference test was conducted in which 38 panelists participated and tasted four dry samples in random order . the samples were : 1 . 70 / 30 wt % potassium chloride / crystalline lysine monohydrochloride , which is the subject of the current application . 2 . commercially available morton salt substitute ( containing potassium chloride , fumaric acid , tri - and mono - calcium phosphate ). 3 . example 1 of u . s . pat . no . 2 , 829 , 056 ( containing lysine dihydrochloride , mono - potassium glutamate , potassium chloride and tricalcium phosphate ). the results of this test indicated the composition no . 1 of the invention was preferred to no . 2 and no . 3 . the ranking of samples no . 1 , no . 2 and no . 3 were 61 , 75 , and 86 , respectively , with the lowest number being preferred . the ranking was determined as follows : there was statistically difference at the 95 % level between no . 1 and no . 3 ( u . s . pat . no . 2 , 829 , 056 ), but the difference between no . 1 and no . 2 was not statistically significant . taste trials were performed to assess the intensity of the composition no . 1 of the invention in aqueous solution . in these trials a fifth sample was added to those of example 4 . a 4 % solution was prepared of each sample and the rank scores were 16 , 49 , 50 , 55 , and 55 for samples no . 4 , no . 5 , no . 2 , no . 3 and no . 1 , respectively . this test indicates that the samples no . 1 and no . 5 were about 50 % the intensity of regular table salt . succinic acid ( sa ) was added to physical mixtures of potassium chloride ( kcl ) and lysine monohydrochloride ( lysmhc ). the results are shown in the following table 4 . table 4______________________________________wt % kcl / lysmhc / sa dry mixture taste 4 % solution taste______________________________________70 / 30 / 00 salty very mild salty70 / 15 / 15 very acidic , irritates very acidic , irritates70 / 20 / 10 very acidic acidic70 / 25 / 05 salty acidic salty acidic70 / 27 . 5 / 2 . 5 very good salty mild salty45 / 45 / 10 salty acidic very little saltiness______________________________________ these data indicate that there is a taste improvement by addition of a small amount of succinic acid . the ratio of lysine monohydrochloride to succinic acid that gives this advantage is 10 : 1 as in application ser . no . 08 / 376 , 395 , filed jan . 23 , 1995 . preferably between about 2 . 5 and 2 . 9 percent of the composition is succinic acid and the remainder is potassium chloride . it is intended that the foregoing description be only illustrative of the present invention and that the present invention be limited only by the hereinafter appended claims .

a physical mixture which consists essentially of compositions of lysine monohydrochloride and potassium chloride alone or admixed with small amounts of succinic acid , in particular weight ratios , and which has a salty taste comparable to table salt . the mixture masks the bitter aftertaste of the potassium chloride and can provide dietary lysine which is an essential amino acid .

in fig1 the torso and head of a patient are shown along with the patient &# 39 ; s heart h , esophagus e and stomach s . the stomach is located posterior and spaced from the ventricle v . the esophageal - stomach displacement electrode shown extends through the patient &# 39 ; s mouth , through the esophagus and into the stomach with its distal end located relatively close to the ventricle v . the present invention enables the distal end of the esophageal - stomach displacement electrode to displace angularly within the stomach and subsequently be pulled slightly back out of the esophagus , or alternatively , further angularly displaced , upwardly into pressurized contact with the stomach wall to position the wall closer than normal to the heart ( see fig4 ) and thereby place the stomach displacement electrode in closer proximity to it . this is illustrated in fig2 and 3 and 4 . the electrode includes a semi rigid plastic tube 10 made of nylon or other suitable material which may be approximately 20 inches long and approximately 3 / 16 inch in diameter . the tube should be semi rigid , much like a gastric tube , and be relatively torque free . the distal end 12 of the tube carries an electrode 14 , preferably spherical in shape and having a stem 16 that fits within the distal end of the tube . the electrode may be pressed in place or suitably fastened by other means . in the preferred form , the electrode 14 is 1 / 4 inch in diameter , which just exceeds the diameter of the tube 10 so that the ball will make positive contact with the stomach wall when the distal end 12 of the tube 10 is displaced . the distal end 12 may be then further displaced or the complete electrode pulled back out of the esophagus to cause a bulge 50 ( fig4 ) in the stomach wall to place the wall and the electrode 14 closer to heart ventricle v . at this point , the electrode is prevented from further displacement by resistance of the stomach wall . the tube 10 is carried by a control mechanism 20 shown in fig4 which is connected to a displacement mechanism 22 disposed in the tube . the control mechanism is located at the proximal end of the tube outside the mouth when the esophageal - stomach displacement electrode is placed in the stomach as shown in fig1 . the tube 10 is crimped as suggested at 26 in fig2 and 4 so as to form a hinge 27 in the tube , which enables it to bend readily at that point . in the wall 25 of the tube 10 , ports 28 and 30 are formed on opposite sides of the hinge 27 , each spaced approximately an inch therefrom . while in the embodiment shown , each of the two ports is approximately one inch from the crimp 26 , that dimension as well as others given may be varied to suit the particular application , as is more fully described below . a rigid pin 32 is disposed in the tube 10 and extends generally parallel to the tube axis . the pin may be made of metal , rigid plastic , or any other material having sufficient rigidity to prevent the tube 10 from bending at the crimped area 26 when the pin spans the hinge . a pair of cords 34 and 36 are connected to the proximal and distal ends 38 and 40 , respectively , of pin 32 and extend proximally in the tube 10 out its proximal end 42 and into the control mechanism 20 . cord 34 extends directly from the proximal end of the pin 32 within the tube 10 to the control mechanism 20 , while cord 36 extends from the distal end 40 of the pin , out the tube 10 through port 28 and from that point it extends proximally externally of the tube , spanning the crimped portion 26 to the port 30 where the cord reenters the tube 10 and extends in the tube to the control mechanism 20 . as is evident from fig2 and 4 , the location of the pin 32 may readily be changed by pulling one or the other of the cords 34 or 36 in a proximal direction . pin 32 is somewhat shorter than the distance between the crimped portion 26 of the tube and the lower port 28 . travel of the pin 32 in the tube 10 in a distal direction is limited by the location of port 28 . the size of pin 32 is such that it cannot be drawn through port 28 and , therefore , when the pin 32 reaches its lowermost point and a continued pull is exerted on cord 36 , the distal portion of the tube 10 is caused to deflect ( in this example approximately 135 °) from the position shown in fig2 to that shown in fig3 . at this point the tube must still be further deflected or pulled back out of the stomach to place it into pressurized contact with the stomach wall to cause a bulge 50 as shown in fig4 . while the tube 10 is displaced or bent about the hinge 27 by pulling on cord 36 when pin 32 has reached its lowermost position , merely by releasing tension on the cord 36 , the natural bias of the tube 10 to the configuration of fig1 and 2 will cause it to return to the shape shown therein . the control mechanism 20 shown in fig5 is connected to the distal ends of the cords 34 and 36 to operate the displacement mechanism 22 by taking up one cord and playing out the other . the control mechanism 20 includes a sleeve 50 , rectangular in cross section in the embodiment shown , and containing a slide 52 . a bracket 54 is secured to the bottom wall 56 of sleeve 50 and retains the proximal end 42 of tube 10 in place . the bracket 54 includes a bar 62 and clamping plate 58 that sandwich the tube end , and the plate 58 is secured to the bar 62 by screws 60 . the cords 34 and 36 enter the sleeve 50 through a port 64 in bottom wall 56 , aligned with the proximal end 42 of the tube 10 when the tube is secured to the bracket 54 . the proximal ends 66 and 68 of the cords are respectively connected to flanges 70 and 72 carried by the slide 52 . in fig5 slide 52 is shown in the position that places the pin 32 in the tube in the position shown in fig2 . when the slide is moved to the right as viewed in fig5 the pin 32 moves to its lowermost position in tube 10 and the tube is deflected , as shown in fig3 . because the slide 52 is generally u shaped with an opening 74 in its bottom wall 76 that rests upon the bottom wall 56 of sleeve 50 , movement of the slide 52 in the sleeve 50 does not in any way interfere with the movement of the cords 34 and 36 in response to displacement of the slide . the electrode typically may be used in the following manner . assume that the electrode is part of a pacing mechanism as shown in u . s . pat . no . 4 , 735 , 206 , supra . the tube 10 is inserted into the esophagus either through the mouth or the nasal passage to a depth wherein the electrode 14 is disposed out the lower end of the esophagus into the stomach at a depth sufficient to enable displacement of the tube &# 39 ; s distal end 12 to approximately 135 degrees from its straighten or insertion position as shown in fig3 . the external electrode also forming part of the pacer is mounted on the chest of the patient and the controls , etc . are properly set . in order to reduce the amount of electrical energy required to effect pacing , the operator moves the slide 52 to the right as shown in fig5 which will cause the pin 32 to move downwardly in the tube 10 so that its distal end 40 is immediately adjacent the port 28 . further movement of the slide 52 in that direction will cause the distal portion of the tube 10 to deflect and place the electrode 14 in proximity to the upper stomach wall near the heart ventricle v ., as shown in fig3 . further deflecting the distal end 12 or pulling back the tube 10 at its proximal portion then places the electrode 14 in pressurized displacable contact with the upper stomach wall causing a bulge that places the electrode closer to the ventricle v ( fig4 ). with the electrode in the displaced position of fig4 the pacing pulses are imposed across the electrodes . when the procedure is completed , the operator may move the slide 52 back to the position of fig5 which will relieve the tension on the cord 36 and allow the tube 10 to return to the position of fig2 . thereafter the tube 10 may be withdrawn . from the foregoing description , those skilled in the art will appreciate that the present invention provides a very convenient means of enabling an operator to place the esophageal stomach displacement electrode very close to the heart or other organ by means of a noninvasive procedure and thereby reduce the energy required to carry out the particular procedure such as pacing or defibrillation upon the patient . it will also be appreciated that while a specific embodiment is shown in the drawings , modifications may be made thereof without departing from this invention . for example , while a pin is shown as applying the bending force to the interior of the tube , other configurations for the device may be employed . any structure which will not pass through the lower port 28 and will not interfere with the action of the hinge 27 will cause the tube 10 to deflect when the cord attached to it and exiting the tube through the port 28 is tensioned . it should , if necessary , also stiffen the hinge portion of the tube when it is being inserted in the esophagus and stomach . the member which applies the bending force must be capable of moving freely in the tube under the operation of the control 20 so as to be readily movable in response to actuation of the control . the tube 10 could , of course , carry more than one electrode . for example , in the earlier patents , supra , a number of spaced contact rings are shown carried by the tube . because modifications may be made of the invention without departing from its spirit , it is not intended that the scope of this invention be limited to the specific embodiment illustrated and described . rather , the scope of this invention is to be determined by the appended claims and their equivalents .

an esophageal - stomach displacement electrode comprises a flexible tubular member designed to be inserted through the esophagus into the stomach . an electrode is carried by the tube in the region of its distal end . the tube is hinged near the distal end which enables that end of the tube to displace angularly in the stomach and displace the stomach wall . the stomach wall displacement may occur by angularly displacing the distal end or by otherwise pulling the tube partially out of the esophagus after its distal end partially displaced toward the stomach wall . a displacement mechanism is disposed in the tube in the region of the hinge and is controlled from a point externally of the body for causing the distal end of the tube to displace angularly , and to be positioned to engage and displace the stomach .

the present invention is a board game intended to simulate the life at a lake . much of the interest in the game lies in experiencing the ups and downs of life on , at , adjacent , or near a lake , and includes the acts of acquiring , selling , mortgaging and improving properties , such as lake areas , dams and boat dealerships associated with lakes . while the preferred embodiment set forth below involves particular properties , such as lake areas , boat dealerships on , adjacent , or relating to various lakes , those skilled in the art will understand that the invention is not limited to only lake areas , boat dealerships and dams . other types of lake - related properties are within the scope of the invention . as best illustrated in fig1 a , the game includes a generally square - shaped game board 10 including a total of eight portions b , c , d , e , f , g , h , i positioned about a periphery of the board . each of the portions b , c , d , e , f , g , h , i includes five delineated , sequential spaces . as seen in fig1 a , each of portions b , c , d , e , f , g , h , i are contiguous with two other portions b , c , d , e , f , g , h , i , thus forming a continuous path of delineated spaces adjacent a periphery of board 10 . as best illustrated in fig2 a through 2c , tokens 20 represent the identities of the players . tokens 20 are moved across the path according to a throw of dice by the token &# 39 ; s owner . for example , if a total of seven results from the owner &# 39 ; s dice throw , that player moves his or her token seven spaces along the path . while only three exemplary tokens 20 are depicted , those skilled in the art will appreciate that the invention is not limited to such examples . other examples of configurations include those in the shape of a captain &# 39 ; s wheel , a life preserver , a boat trailer , a cigarette boat , a cabin cruiser , a drag boat , a cruise liner , a jet ski , a ski boat , a fishing boat , an open bow boat , a day cruiser , and a sailboat . moreover , the number of players is not limited to three . while any reasonable number of players may play , a preferred number of players is four to nine . portion b includes a go space 100 , which serves as a starting point for the players on the board &# 39 ; s continuous path . portion b further includes two spaces corresponding to lake areas , namely bear lake 110 and jump off joe lake 130 . sunken chest space 120 , and waterfront taxes due space 140 make up the remainder of portion b . lake areas in the game are organized into groups . each of the lake areas in a given group has a common color that identifies their association as a group . for example , a purple bar on each of bear lake 110 and jump off joe lake 130 may be used to identify them as belonging to one group of lake areas . portion c includes three lake areas , namely , medical lake 160 , clear lake 180 , and waitts lake 190 . a bluish - green bar may be used to identify these areas as making up another associated group of lake areas . portion c further includes sun runner boat dealership space 160 and makin a wake space 170 . portion d includes an in jail / just visiting space 200 , which has a in jail portion 204 and a just visiting portion 205 . portion d also includes three spaces corresponding to another group of associated lake areas , namely , liberty lake 210 , marshal lake 230 , and rock lake 240 . orangish - red bars are preferably included on lake areas 210 , 230 , 240 to indicate their association . spokane falls dam space 220 completes the amount of spaces in portion d . portion e includes three spaces corresponding to yet another group of associated lake areas , namely , deer lake 260 , silver lake 280 and loon lake 290 . bars colored orange may be used to indicate their association as a group . searay dealership space 250 and sunken chest space 270 complete the number of spaces in portion d . portion f includes a free boat launch space 300 and three spaces corresponding to yet another group of associated lake areas , badger lake 310 , sprague lake 330 , and thomson lake 340 , each of which preferably has a red bar thereon to indicate their group association . makin a wake space 320 completes portion f . portion g includes three spaces to form yet another group of associated lake areas , namely , lake cocolala 360 , spirit lake 370 , and long lake 390 . they preferably have yellow bars indicating their association . a bayliner space 350 and a grand coulee dam space 380 complete portion g . portion h includes go to jail space 400 . lake sachine 410 , priest lake 420 , lake roosevelt 440 make up still another group of associated lake areas . they preferably have colored bars , in this case green , to indicate their association . sunken chest space 430 completes portion h . finally , portion i includes two spaces corresponding to a last group of associated lake areas , namely , lake pend oreille 470 and lake couer d &# 39 ; alene 490 . an association between them as a group is preferably indicated by dark blue bars thereon . portion i is completed by donzi dealership space 450 , makin a wake space 460 and boat tab renewal space 480 . the game is played with scrip money , preferably in denominations of $ 1 , $ 5 , $ 10 , $ 20 , $ 50 , $ 100 , and $ 500 . at the beginning of the game , the players should be given equal amounts of scrip , which in a preferred embodiment of the game is $ 1 , 500 . if the number of players exceeds the amount of preferred $ 1 , 500 multiples of scrip in the bank , then each share of scrip may be accordingly decreased and a credit against the decreased amount be maintained for the player against the bank . the game also utilizes a plurality of makin a wake cards 500 , 505 , 510 , 515 , 520 , 525 , 530 , 535 , 540 , 545 , 550 , 555 , 560 , 565 , 570 , 575 , as individually shown in fig3 a through 3d , that are stacked face down and piled at space 30 , as illustrated in fig1 a . similarly , a plurality of sunken chest cards 600 , 605 , 610 , 615 , 620 , 625 , 630 , 635 , 640 , 645 , 650 , 655 , 660 , 665 , 670 , 675 , individually illustrated in fig3 e through 3i , are stacked face down and piled at space 40 , again as shown in fig1 a . the game also includes a predetermined amount of lake cabins 50 and marinas 60 , as shown in fig2 d and 2e , respectively , for placement upon lake areas . the game may be played by two or more players , one of whom serves as banker . the banker handles all receipt and payment of scrip on behalf of the bank . the bank is the original owner of all of the lake areas , boat dealerships , and dams , as described above . play of the game is organized into turns for each player . on each player &# 39 ; s turn , he or she operates one or more elements for randomly determining movement of the tokens over the path . preferably , two such elements are dice . based upon the amount shown on the element ( s ), such as dice , the player moves his or her token the indicated number of spaces along the continuous path in a clockwise direction . those skilled in the art will appreciate that the invention is not limited to the use of dice , but that any chance - determining element may be used . for example , a spinner may be used to determine the number of spaces advanced by a player &# 39 ; s token during his or her turn . if , as a result of a player &# 39 ; s throw of the dice , his or her token lands upon one of the lake areas , boat dealerships , or dams , he or she may purchase it from the bank if it is not already owned . the price for the lake area , boat dealership or dam in question is preferably displayed on the associated space . exemplary prices for the lake areas may be found in table i , while exemplary prices for each of boat dealerships and dams may be found in table ii . as seen in tables i and ii , prices for the lake areas vary greatly , just as they do around lakes in reality . table i preferred prices for lake areas lake area price ($) bear lake 110 60 jump off joe lake 130 60 medical lake 160 100 clear lake 180 100 waitts lake 190 120 liberty lake 210 140 marshal lake 230 140 rock lake 240 160 deer lake 260 180 silver lake 280 180 loon lake 290 200 badger lake 310 220 sprague lake 330 220 thomson lake 340 240 lake cocolala 360 260 spirit lake 370 260 long lake 390 280 lake sachine 410 300 priest lake 420 300 lake roosevelt 440 320 lake pend oreille 470 350 lake couer d &# 39 ; alene 490 400 [ 0065 ] table ii preferred prices for boat dealerships and dams boat dealership or dam price ($) sun runner dealership , 150 200 spokane falls dam , 220 150 searay dealership , 250 200 bayliner dealership , 350 200 grand coulee dam , 380 150 donzi dealership , 450 200 as best shown in fig4 a through 4n , one title deed card 113 , 133 , 163 , 183 , 193 , 213 , 233 , 243 , 263 , 283 , 293 , 313 , 333 , 343 , 363 , 373 , 393 , 413 , 423 , 443 , 473 , 493 is associated with each one lake area . similarly , a title deed card 153 , 253 , 353 , 453 , 223 , 383 , is associated with each individual boat dealership 150 , 250 , 350 , 450 and each individual dam 220 , 380 , respectively . after payment of scrip money to the bank , the player purchasing a property receives the associated title deed card as proof of ownership . preferably , each of the title deed cards associated with a lake area has a colored bar displayed thereon to match the corresponding lake area on board 10 . if the player landing upon an unowned property does not wish to purchase it , the banker , upon preagreed rules , may auction off the property to the highest bidder among the remaining players . the winning bidder receives the associated title deed card after receipt of payment to the bank . once a property has been sold , the associated title deed card is displayed face side up by that player in order to indicate that it is not mortgaged . preferably , each of the boat dealership spaces 150 , 250 , 350 , 450 , and title deed cards 153 , 253 , 353 , 453 associated therewith includes a picture 154 , 254 , 354 , 454 , respectively , that is illustrative of life at a lake . for example , each of pictures 154 , 254 , 354 , 454 can be an ornamental design for a boat , such as one commonly used on a lake . similarly , each of the dam spaces 220 , 380 , and title deed cards 223 , 383 , includes a picture 224 , 384 illustrative of life at a lake . for example , each of pictures 224 , 384 can be an ornamental design of a waterfall plunging over a dam at the edge of a lake . if the property landed upon is already owned by another player , the player landing , or “ trespassing ”, upon the property must pay a rental fee to the owner if the owner demands the same in a timely manner such as , for example , before the next player rolls the dice . in the case of boat dealerships or dams , the rental fee will depend upon how many boat dealerships or dams are owned by the owner of the landed upon space at the time of the trespass . if the player &# 39 ; s token is trespassing upon a dam space , the player must throw the dice and pay a multiple of the dice throw in scrip to the owner of the dam as a rental payment . the multiple used depends upon how many dams are owned by the player owning the dam in question , and is indicated on the title deed to the dam . for example , in a preferred embodiment the player whose token lands upon a dam must pay four times the amount resulting from the dice throw if only one dam is owned , and ten times the amount if two dams are owned . similarly , if a player &# 39 ; s token lands upon a boat dealership that is owned by another player , the player trespassing must also pay the owner a rental fee based upon the number of boat dealerships owned by the player whose boat dealership was landed upon . however , the rental fee is not dependent upon a throw of the dice , but is instead displayed on the associated title deed card . in a preferred embodiment , the trespasser must pay $ 25 if the owner owns only a single boat dealership , $ 50 if the owner owns two dealerships , $ 100 if the owner owns three dealerships and $ 200 if the other player owns all the dealerships . if a player &# 39 ; s token lands upon a lake area that is already owned by another player , the rental fee due will depend upon whether all the lake areas in the group are commonly owned and whether the lake area landed upon has been improved , i . e ., whether lake cabin ( s ) and / or a marina have been erected upon the lake area landed upon . the particular rental fee may be read from the information displayed on the associated title deed card . if one player owns all the lake areas in a given group , the rental payment is twice the amount displayed on the associated title deed card if the lake area is not improved , i . e ., no lake cabins or marinas have been erected thereon . for example , the rental payment for trespassing upon the thomson lake area 340 ( and the other lake areas 310 , 330 in the group are not commonly owned ) in an unimproved condition is only $ 20 , as best shown in fig4 i . the rental payment for trespassing on an unimproved thomson lake area 340 increases to $ 40 if the owner also happens to own both the other lake areas 310 , 330 associated therewith . the rent for trespassing increases with the number of lake cabins and marinas built upon the trespassed upon lake area . for example , with reference to fig4 i , rent for one lake cabin on the thomson lake area 340 costs $ 100 , rent for three lake cabins costs $ 750 , and rent for one marina costs $ 1 , 100 . as described above , the lake areas are organized into groups . if a player acquires all the lake areas within an associated group , the player is allowed to improve one or more of his or her lake areas in the associated group on his or her turn by erecting lake cabins and / or marinas . the player may erect up to four lake cabins on each lake area in the group . once four lake cabins have been erected on each lake area in the group , the player may then erect up to one marina each on one or more of the lake areas in the associated group . when a marina is erected , the lake cabins must be returned to the bank . thus , the rental payment for trespassing on a lake area with a marina does not include any additional rent for the four lake cabins previously , i . e ., the rental payment is not cumulative for all improvements . the costs for erecting lake cabins and marinas is displayed on the title deed card associated with the lake area that is being improved . for example , with reference to fig4 i , the erection of each lake cabin on lake thomson 340 costs $ 150 , while the marina costs an additional $ 150 . as in purchases of lake areas from the bank , the costs for improving a lake area are payable to the bank . because the number of lake cabins and marinas is limited , they may not be available from the bank at the time a player wishes to buy them . if so , that player must wait until another player sells or returns one or more of them back to the bank , a subject that is described in greater detail below . a player improving his or her lake areas in an associated group must do so in an even manner upon the lake areas within that group . for example , while a player may erect one house at a time upon any one of the lake areas in an associated group , he or she may not erect , for example , two houses on one lake area and no houses on another lake area within the same group , or for example , three houses on one lake area and one or no houses on another lake area within the same group . the board includes several other lake - related spaces , spaces which do not have corresponding title deed cards and which may not be owned . these spaces include waterfront taxes due space 140 , in jail / just visiting space 200 , free boat launch 300 , boat tab renewal space 480 , and go space 100 . waterfront taxes due space 140 represents the relatively higher amount of taxes paid by a person owning a lot adjacent a lake shore . if a player &# 39 ; s token lands upon waterfront taxes due space 140 , that player must pay the bank his or her choice of 10 % of his or her scrip on hand , or $ 200 . boat tab renewal space 480 represents a boat owner &# 39 ; s requirement to renew his or her boat trailer &# 39 ; s registration , a process evidenced by a new tab . if a player &# 39 ; s token lands upon boat tab renewal space 480 , that player must pay the bank $ 75 in scrip . preferably , waterfront taxes due space 140 includes a picture 144 illustrative of home on a lakefront that is subject to , of course , waterfront taxes . desirably , boat tab renewal space 480 includes a picture 484 illustrative of a boat trailer and money . free boat launch 300 space represents a boat launch open to the public without any fees . free boat launch space 300 indicates that no rental is due for any player landing his or her token upon the space . similarly , free boat launch space 300 also includes a picture 340 , which in this case , is preferably illustrative of a boat launch site . if a player &# 39 ; s token lands upon go to jail space 400 , that player must place his or her token in an in jail portion 204 of in jail / just visiting space 200 . a player whose token is in the in jail portion 204 must remain in that space until a dice throw on his or her next turn ( or his third turn ) is a “ double ”. if no such double is thrown by the player &# 39 ; s third consecutive turn , he or she must pay a $ 50 fine to the bank to be freed . a “ double ” is a dice throw in which each die results in the same number . for example , one type of “ double ” includes the situation when a “ 3 ” is displayed by each of two dice . once freed from the in jail portion 204 , the player moves his or her token to the just visiting portion 205 of the space 200 . when a player lands upon the in jail / just visiting space 200 in the ordinary course of play , the player places his or her token in a just visiting portion 205 of the in jail / just visiting space 200 to indicate that he or she is “ just visiting ”, and is not subject to imprisonment as described above . a player &# 39 ; s token is also placed in the in jail portion 204 if he or she rolls doubles thrice in succession during a turn or draws a “ go to jail ”- type sunken chest or makin a wake card , each of which is described in greater detail below . at the beginning of the game , players start moving their tokens from go space 100 . as the continuous path wraps around and reaches go space 100 , players will inevitably either land upon , or pass over , go space 100 , thus completing a full circuit of the path . because the path is continuous , there is no point along the board at which play terminates or a player wins . instead , the termination of play is determined by other facets of the game , the details of which are discussed below . if a player &# 39 ; s token lands upon , or passes over , go space 100 , that player collects $ 200 from the bank . the makin a wake spaces 170 , 320 , 460 and sunken chest spaces 120 , 270 , 430 represent some of the ups and downs of life on a lake . metaphorically speaking , a wake from a boat may sometimes tip a boat over , while at other times lift a boat high up in the air . similarly , a chest found at the bottom of a lake may hold a surprise or two for a person opening it up . if a player &# 39 ; s token lands upon one of the makin a wake spaces 170 , 320 , 460 or sunken chest spaces 120 , 270 , 430 , he or she must draw a card from the appropriate one of two piles stacked face down at the respective spaces 30 , 40 , as illustrated in fig1 a . as best illustrated in fig3 a through 3d , each of the makin a wake cards 500 , 505 , 510 , 515 , 520 , 525 , 530 , 535 , 540 , 545 , 550 , 555 , 560 , 565 , 570 , 575 has indicia thereon announcing one of a benefit , a penalty and an instruction to move the drawing player &# 39 ; s token 20 to a particular space on the board 10 . similarly , as best shown in fig3 e through 3i , each sunken chest card 600 , 605 , 610 , 615 , 620 , 625 , 630 , 635 , 640 , 645 , 650 , 655 , 660 , 665 , 670 , 675 has indicia thereon announcing one of a benefit , a penalty and an instruction to move the drawing player &# 39 ; s token 20 to a particular space on the board 10 . preferably , a plurality of the makin a wake cards 500 , 505 , 510 , 515 , 520 , 525 , 530 , 535 , 540 , 545 , 550 , 555 , 560 , 565 , 570 , 575 and / or sunken chest cards 600 , 605 , 610 , 615 , 620 , 625 , 630 , 635 , 640 , 645 , 650 , 655 , 660 , 665 , 670 , 675 have lake - related indicia associated with a penalty , benefit or instruction . after following the instructions indicated by the indicia printed thereon , the drawing player returns the card face down to a bottom of the appropriate pile at the respective space 30 , 40 . as best illustrated in fig1 b , 1c , 1 e , 1 f , 1 h and 1 i , in a preferred embodiment , each of the makin a wake spaces 170 , 320 , 460 , and sunken chest spaces 120 , 270 , 430 includes a picture 174 , 324 , 464 and 124 , 274 , 434 , respectively , illustrative of life at a lake . for example , the sunken chest picture 124 , 274 , 434 can be an ornamental illustration of a treasure chest , and the makin a wake picture 174 , 324 , 464 can be a scene of a boat traveling fast enough to create a wake in the water . moreover , as best illustrated in fig3 a through 3i , each makin a wake card 500 , 505 , 510 , 515 , 520 , 525 , 530 , 535 , 540 , 545 , 550 , 555 , 560 , 565 , 570 , 575 and sunken chest card 600 , 605 , 610 , 615 , 620 , 625 , 630 , 635 , 640 , 645 , 650 , 655 , 660 , 665 , 670 , 675 will either grant a particular benefit , assign a particular penalty , or instruct the drawing player to move his or her token to a particular space , and a picture 501 , 506 , 511 , 516 , 521 , 526 , 531 , 536 , 541 , 546 , 551 , 556 , 561 , 566 , 571 , 576 , 601 , 606 , 611 , 616 , 621 , 626 , 631 , 636 , 641 , 646 , 651 , 656 , 661 , 666 , 671 , 676 illustrative of the benefit , penalty or instruction is also born thereon . more preferably , they are illustrative of the associated benefit , penalty or instruction . more preferably , they are illustrative of a benefit or penalty associated with life at a lake . descriptions for preferred pictures 501 , 506 , 511 , 516 , 521 , 526 , 531 , 536 , 541 , 546 , 551 , 556 , 561 , 566 , 571 , 576 , 601 , 606 , 611 , 616 , 621 , 626 , 631 , 636 , 641 , 646 , 651 , 656 , 661 , 666 , 671 , 676 may be found in tables iii through vi . obviously , the invention scope includes any and all illustrations , pictures , designs , schematics , etc . that represent life on a lake . table iii makin a wake cards description of benefit or penalty description of picture “ skier down : go back illustration of a ski boat three spaces .” speeding away from a water skier flailing in the water , 501 . “ ticket for no life illustration of a judge preserver : pay $ 15 .” holding a gavel while sitting at a desk between two flags , 506 . “ set sail to liberty lake . illustration of a sailboat if you pass go , collect $ 200 .” sailing on a lake , 511 . “ take a walk on the lakeshore : illustration of a boardwalk advance token to beautiful lake extending around a marina , couer d &# 39 ; alene .” 516 . “ skier down : go back three illustration of a ski boat spaces .” speeding away from a water skier flailing in the water , 521 . “ you overpay interest on your illustration of a first hand boat loan : bank pays you $ 50 .” handing over paper money to a second hand , 531 . “ water ski to thomson lake . if illustration of a person you pass go , collect $ 200 .” water skiing on a lake , 526 . “ pull up anchor and race to go : illustration of a boat collect $ 200 .” speeding across a lake , 536 . “ go to jail . do not pass go . illustration of a coast guard do not collect $ 200 .” boat with a flasher towing a smaller boat , 541 . “ make a wake to sun runner ™ illustration of a sun runner dealership .” boat , 551 . “ get out of jail freel !“ illustration of birds peacefully flying across a sunlit sky , 546 . “ if dealership is unowned , you illustration of a boat on a may buy it from the bank .” lake , 556 . [ 0081 ] table iv additional makin a wake cards description of benefit or penalty description of picture “ win fishing derby : collect illustration of a person on a $ 150 .” lakeshore holding up a fish larger than himself , 561 . “ set sail to the nearest dam . illustration of a dam , 571 . if unowned , you may buy it from the bank . if owned , throw the dice and pay the owner ten times the amount shown .” “ set sail to the nearest illustration of a boat , 566 . dealership and pay the owner twice the rental to which he or she is entitled .” “ set sail for the nearest illustration of a boat , 576 dealership and pay the owner twice what he or she is entitled .” [ 0082 ] table v sunken chest cards benefit or penalty description of picture “ sell vintage cris craft ™, illustration of one hand collect $ 200 .” handing paper money to another hand , 606 . “ your boat broke its prop : pay illustration of a boat on a $ 40 .” lake that has just lost its prop to the bottom of the lake , 601 . “ you have won second place at illustration of a boat lake pend oreille poker run : speeding across a lake , 611 . collect $ 100 .” “ buy new camping gear for illustration of campsite , weekend at lake roosevelt : pay volleyball court and $ 150 .” treeline adjacent a lakeshore , 616 . [ 0083 ] table vi additional sunken chest cards benefit or penalty description of picture “ complete boating safety course illustration of a person and enjoy insurance discount : wearing a graduation - style collect $ 20 .” cap and gown in front of a boat on a trailer , 626 . “ restored ski boat wins 1 st illustration of a first prize in boat show : collect $ 50 place ribbon and a boat , from each player .” 631 . “ you won the long lake poker illustration of a boat run : collect $ 25 from every speeding across a lake , 636 . player .” “ take a cruise to go : collect illustration of a cruise $ 200 .” ship sailing on a lake , 641 . “ boat needs repairs : pay $ 200 .” illustration of a outboard boat motor and a pipe wrench , 651 . “ go to jail . do not pass go . illustration of a coast do not collect $ 200 .” guard boat with a flasher towing a smaller boat , 656 . “ overcharged for boat repair : illustration of a person collect $ 25 .” smiling and receiving paper money from another person , 661 . “ win fishing bet by catching illustration of a person on prize steelhead in lewiston : a lakeshore holding a fish collect $ 100 from the player on larger than himself and of a your right .” hand handing over paper money , 671 . “ sell old boat trailer : collect illustration of a boat $ 45 .” trailer attached to a truck , 676 . a roll of doubles allows a player , after completing any actions associated with the space their token is moved to , to roll the dice again without having to wait for a next turn . in this fashion , a player may roll doubles twice or thrice during a single turn . if , however , a player rolls doubles three times in succession during a turn , they must to jail and place their token in the in jail portion 204 of the in jail / just visiting space 200 . the object of the game is to force all the other players to quit the game because of their inability to meet their financial obligations that develop as the game proceeds . because each player &# 39 ; s token will from time to time land upon a lake area , boat dealership or dams owned by another player , the trespassing player will incur rental charges . moreover , a player &# 39 ; s token will inevitably land upon other spaces exacting some sort of financial penalty . if unable to pay his or her obligations in scrip on hand , the player must dispose of his or her property , i . e ., lake areas , boat dealerships , dams , lake cabins , and marinas . lake areas , boat dealerships and dams may be given to the creditor in satisfaction of the rental payment , sold to any other player , auctioned to the highest bidder , or mortgaged to the bank in order to raise enough scrip to satisfy the rental payment . lake cabins and marinas may not be sold to other players , but may be sold back to the bank at half the purchase price listed on the associated title deed card . as mentioned above , lake areas , boat dealerships and dams may be mortgaged to the bank for a mortgage amount listed on the associated title deed card . once one of the above is mortgaged , the mortgaging player must turn the title deed card face down to indicate that it is mortgaged . if the player wishes to later pay off the mortgage , he must pay back to the bank the amount of the mortgage principal , plus , according to preferred rules of the game , ten percent interest . if a mortgaged property is transferred to another player without first lifting the mortgage , the new owner must pay ten percent interest immediately upon transfer . in order to lift the mortgage , the receiving player must pay the mortgage principal and an additional ten percent interest . according to preferred rules , no player may mortgage a lake area without first selling back to the bank all of his or her lake cabins and marinas erected upon that lake area . as a result of mortgaging a property , no rental payment may be demanded for it if another player trespasses upon that property . if the trespassing player is unable to meet his or her obligations by selling , transferring or mortgaging lake areas , boat dealerships , dams , lake cabins and marinas , he or she is declared bankrupt and must quit the game . all of the bankrupt player &# 39 ; s scrip must be given to his or her creditor . all of the bankrupt player &# 39 ; s lake cabins and marinas must be sold back to the bank at half price and the scrip given to his or her creditor . all of the bankrupt player &# 39 ; s remaining lake areas , boat dealerships and dams must then be sold by the bank to the highest bidder ( s ), or if no bid on a property is made , given to his or her creditor . the scrip resultant from the sale goes to the creditor . if the creditor receives a mortgaged property , the creditor must immediately pay a ten percent interest charge on the mortgage to the bank as described above , and may optionally pay off the mortgage principal at that time . if the principal is not paid at that time , an additional ten percent interest will be due at the time the principal is actually paid . play of the game continues until all but one of the players is bankrupt . thus , the remaining player is declared the winner . it is to be understood that the present invention is not limited to the embodiment described above , but encompasses any and all embodiments within the scope of the following claims .

a game includes : a playing board ; a plurality of tokens representing identities of players playing the game ; a plurality of title deed cards ; a plurality of game pieces ; a source of scrip ; a plurality of cards each one of which bears indicia related to one of a penalty , an award and a direction ; and at least two elements operable by the players in turn for randomly determining movement of the tokens upon the board . the playing board includes a plurality of successive , contiguous spaces defining a continuous path about a periphery of the board . first second and third sets of the spaces identify properties , such as lake areas , dams and boat dealerships , that may be purchased with scrip by a player landing upon the respective space . title deeds bear indicia indicating a rental payment .

fig1 shows one embodiment of the apparatus according to the invention . the dressing is sealed to the wounded tissue by means of a pliable polymer sheet . treatment fluid contained in a pliable bag reservoir is connected to the supply port of the dressing by way of flexible tubing , while a suction pump is connected by tube to a drainage port . fluid bag and horizontal level meter are placed on a rest which is movable along a pole in a vertical direction , and can be fixed in a position which is level with the wound . the pole is fixed on a base which holds a suction pump with canister . more specifically , patient 1 is being treated with an open polymer dressing pad 2 sealed to the wounded tissue by means of a pliable polymer sheet 3 . the means for accomplishing fluid flow comprises a pliable bag filled with treatment fluid 4 which is placed on rest 5 . this bag connects by its outlet 6 to a drip chamber 7 which is followed by a flexible supply tube 8 comprising a fluid rate controlling device 9 and injection port 10 before connecting with the supply port 11 of the dressing 2 . a rest 5 which is sloping in the area of the fluid bag is shown . the bag 4 is positioned on rest 5 with outlet 6 dependently , facilitating complete drainage and displacing eventual contained air upwards . the rest 5 can maintain fluid bag 4 in a flat or inclined plane in a range between 0 ° and 30 °, allowing full fluid evacuation without , or with minimal , height difference between full and empty bag . a dressing drainage port 12 is connected by tube 13 to suction pump 14 . suction pump 14 and / or its fluid canister 15 may be connected to the line of suction anywhere — including on rest 5 — where it may effectively drain fluid and prevent build - up of significant hydrostatic pressure within said tube 13 . canister 15 may be fitted with a scale 16 to allow determination of fluid volumes . the suction pump 14 may be fixed to the base 17 , pole 18 or rest 5 by means of a screw , clamp or elastic strap . rest 5 is movable in vertical directions along pole 18 and fixed by means of a clamp 19 in a position where the fluid surface in bag 4 and the supply port 11 of the dressing are level , i . e . the hydrostatic pressure at port 11 is at or near zero . this adjustment may be accomplished using a height indicator means 20 which may be connected with said rest 5 . the means 20 may constitute for instance a horizontal level meter fixed either to a rewindable cord or to the proximal end of tube 8 , or alternatively a telescopic pole or low energy red laser pointer connected with rest 5 . the base 17 may be fitted with wheels 21 . the rest 5 , pole 18 , and base 17 can for instance be made of aluminium , stainless steel or polycarbonate . rest 5 can be moved along pole 18 manually , and locked at a suitable level by said clamp 19 , or the pole may be height adjustable , constituted for instance of telescoping tubular sections which can be locked by screws at required length . the disclosed base 17 with pole 18 and rest 5 may be adapted for self - assembly . fig2 shows an embodiment of an apparatus according to the invention , which rids the rest 5 and its pole 18 of contact with the floor . in this device the footboard 22 of the bed is used as base . the construction minimizes the area of working - space occupied by the treatment devices and tubing . rest 5 with u - shaped pole 18 is fastened to the footboard 22 by means of a hook - like structure 23 which may comprising elastic polymer or metal . the u - shape of pole 18 may allow positioning of rest 5 within a vertical range corresponding to the combined length of the two parallel vertical parts of pole 18 , allowing the total length of pole 18 to be minimized . immobilization of pole 18 is achieved by means of clamps 19 and 24 . the fluid bag 4 , placed on rest 5 with its outlet 6 dependent , is kept in place by vertical bars 25 . an ultrasound distance sensor 26 is fixed to hook 23 — for instance by means of an elastic or rewindable cord 27 — and used for determining the horizontal level by measuring distances from wound and fluid bag to the roof . the device according to fig2 may also be adapted for self - assembly . the straight pole 18 shown in fig1 may fit in clamp 24 shown in fig2 and used as an alternative to the u - shaped pole . fig3 shows an embodiment of an apparatus according to the invention , which may allow automatic movement and fixation of a horizontal rest 5 at a height along said pole 18 corresponding to the level of the wounded tissue at the press of a button . this may be accomplished by means of a unit comprising a computer 28 connected electronically with ultrasound sensors 26 and 29 and an electrical motor 30 . the said motor 30 operates a cog - wheel 31 which meshes with another toothed part 32 extending along pole 18 . wire - based or hydraulic mechanisms may also be used . once the said computer 28 receives for instance telemetric input on the distance from the wounded tissue to the roof from sensor 26 after activation by the therapist , computer 28 activates sensor 29 and moves rest 5 vertically to the same level . the said rest 5 may maximally be moved vertically in a range from 10 cm to 200 cm above floor level , which corresponds approximately to that of a lower leg wound on a sitting or standing patient and a wound on the head of a standing patient . the range of movement may also be restricted to fit patients lying or sitting in bed , with a range from 30 cm to 150 cm above floor level . fig4 shows an embodiment of an apparatus used according to the invention for administering treatment fluid from a fluid bag in a sloping or horizontal position . it comprises a transparent drip chamber 7 with an angulated entry channel 33 between the spike 34 and chamber 7 . said angulated entry channel 33 may be rigid or elastic , bendable to a chosen angle , and preferably made of polymer material . the chamber 7 is made of rigid polymer material . tube 8 is made of pliable polymer material whose walls may be luer format . the tube is fitted either with a roller clamp 9 or other mechanically or electronically operated device for controlling the flow rate — accomplished either by external compression of tube 8 or another known means of lumen reduction — and finally includes a connector 35 to the dressing supply port 11 . the angulated entry channel 33 permits the chamber 7 to be approximately vertically positioned with the connected fluid bag placed on sloping or horizontal rest 5 . this allows drops to fall freely in the chamber , permitting secure reading of the drip rate . drip chambers of interest allow 40 - 80 drops per ml when exposed to negative pressures as high as 150 mmhg . standard luer format of tube 8 , roller clamp 9 and connector 35 may be used but not obligatorily . the connector 35 to be fitted on the dressing port tube may alternatively constitute an elastic tube . fig5 shows a further embodiment of apparatus according to the invention to administer treatment fluid from a fluid bag . it differs from that described in fig4 by including a horizontal level meter 36 and a tubular injection port connector 37 . the latter may include tap 38 for directional control . the tubular connector 37 may be substituted by an elastic injection membrane . said level meter 36 , comprising for example a small gas bubble enclosed in a transparent glass tube filled with liquid fluid , is connected with the tube 8 for instance by arms 39 embracing tube 8 . the level meter 36 should preferably be positioned near the drip chamber 7 to allow the meter 36 to be read while adjusting the height of the fluid bag 4 on rest 5 to match that of dressing 2 . connector 37 may be used for adding a drug dose to pad 2 during ongoing continuous supply and suctioning . to achieve optimal drip rate readability in chamber 7 of the embodiments shown in fig4 and 5 , the combined angle of entry channel 33 and rest 5 for the fluid bag should be 90 °. both the supply tube 8 and suction tube 13 may be thick - walled and / or corrugated at the inside to withstand kinking and compression , with inner diameter of approximately 3 mm . the suction tube 13 and canister 15 may be manufactured in pliable polymer materials . the sensor which measures fluid supply rate is suitably connected with an alarm . in special situations , in particular associated with low - flow tissue culturing applications using pressure pumps , monitoring of volume rates of fluid supply and drainage may be included , as may pump head pressure and inadvertent gravity free flow . the propulsing force or head of the pressure pump should be just sufficient to achieve fluid flow . the pump should suitably be connected with a pressure sensor in the tube 8 or pad 2 to allow detection and adaption to a pump - related pressure disturbance . computerized alarms concerning start / stop , occlusion , overflow and air - leak conditions may be applied . known pressure and / or ultrasonic transducers or optical sensors may be used . a drip - sensing device may be attached to drip chamber 7 . a timer - activated clamp may allow the fluid supply tube of a drip set to open and close at user - defined intervals , and a timer may control the start - stop function of the suction pump . fig6 shows an example of an open pore dressing with its pad 2 placed on the wound 40 and covered by a pliable , adhesive film or sheet 3 , which is adhered to the adjacent skin 41 . one supply port 11 and one drainage port 12 are adhered to the sheet 3 at a distance from each other . each port is fitted with a tubular member , which allows the port to be connected to known supply or drainage tubes . corresponding to these ports , apertures through the said sheet 3 allow access to pad 2 for fluid supply and suction drainage respectively . flexible tubes are connected airtightly with the said ports 11 and 12 , for instance by means of luer lock or elastic tube being forced over a conical rigid and tubular end - piece . the said sheet 3 , ports 11 , 12 and tubing 8 , 13 provide a seal which allows the negative pressure within pad 2 and on the surface of wound 40 to be contained at a predefined level at least during operation of the suction pump . pad 2 may comprise cell material with open pores or spatia like polyurethane or polyester foam or polyester fibers , and the latter may be matted . pad 2 may include layers in which the pores and / or spatia have different dimensions . a thin dressing layer sandwiched between pad 2 and the wound surface may comprise knit or woven biofiber like cotton , wool or silk containing capillary functioning pores . this layer may be cut to fit sensitive areas of the wound where blood vessels and nerves are superficial or exposed . the sheet 3 may be fluid - or air - impermeable and is typically produced in polymer material ( minnesota mining and manufacturing , st . paul , minn . 55144 ). pad , ports and tubes may be assembled either during fabrication , or bedside by the user . in a method according to the invention intended for treatment of wounds by means of the dressing shown in fig6 , the pressure at the supply port of the dressing is typically 0 mmhg , including correction for tube friction . this level of pressure is combined with suctioning at the drainage port ranging between − 20 mmhg and − 200 mmhg . this treatment may be applied intermittently or continuously for variable periods of time . the maximal suction applied under these circumstances is − 760 mmhg . fluid is supplied according to the invention at rates which may vary between 100 ml / 24 h and 2 , 000 ml / 24 h and loading doses for filling the dressing with drug solution may vary between 1 ml and 500 ml . this treatment may be undertaken on a continuous or intermittent basis . an injection port device can be used for adminstering treatment fluid intermittently to the complete wound surface underneath dressing pad 2 . this administration is always accomplished during ongoing suctioning through the drainage port 12 . this apparatus , shown in fig7 , comprises an elastic membrane 42 which must have qualities which allow maintainment of occlusion after being perforated repeatedly by a needle . membrane 42 may be connected adhesively to sheet 3 , and the construction may or may not include a hole in said sheet 3 corresponding to the center of membrane 42 . in connection with injection by needle through said membrane 42 , the elastic qualities of membrane 42 should prevent formation of needle holes which could result in elimination of the vacuum in dressing pad 2 . the membrane device may also be available as a separate unit with an adhesive rim at its circumference , the latter covered by removable protective paper , whereby said device can be applied adhesively around a hole in a dressing sheet 3 in a known manner . finally , an adhesive , reusable and pliable lid may be placed on membrane 42 to maintain sterility between injections . fig8 shows an injection port apparatus according to fig7 which is integrated in a pre - fabricated dressing sheet 3 intended for self - assembly , such that the dressing becomes complete by inclusion of dressing pad 2 and drainage port 12 . fig9 exemplifies another embodiment of the said injection port apparatus , and comprising a rigid frame 43 which may be circular , and which is adhesively connected with the edges of a hole made in flexible sheet 3 covering the pad 2 . the frame is likewise airtightly connected with elastic membrane 42 . frame 43 may be fitted with a lid 44 , a handle 45 , a joint 46 and a flange 47 . when the device is not in use , lid 44 is closed over membrane 42 . in this process , flange 47 enters a slit 48 in frame 43 to maintain secure occlusion . the membrane may optionally be protected by an adhesive tape patch 49 when not in use . underneath the said membrane 42 is a rigid impermeable plate 50 which is connected by side walls 51 to said frame 43 , and said walls 51 are fitted with apertures 52 . the plate 50 may prevent the needle from inadvertently entering the wounded tissue in situations where the pad is thin . the membrane of the device according to fig9 can suitably be manufactured in natural or synthetic rubber or elastic polymer including silicone . the frame , lid and plate structures may be manufactured in , for example , known , rigid polymer materials , and plate 50 may contain metal to prevent needle penetration . in operation during ongoing suctioning the lid 44 is opened by its handle 45 , the piece of tape 49 is removed . a needle connected with a fluid - filled syringe is advanced through said membrane 42 while the membrane 42 is stabilized by holding lid 44 . the fluid is slowly injected , allowing it to become distributed throughout the dressing by suction and capillary force . the supply of fluid may be terminated once fluid appears in the drainage tube . after injection the needle is removed and tape 49 and lid 44 are repositioned . fig1 shows an embodiment of an apparatus according to the invention comprising a drainage port which facilitates drainage of debris through a capillary - active dressing pad . it comprises a drainage port tube 53 with flange 54 sealed to pad 2 by means of an adhesive sheet 3 . an open grid 55 adhered to the flange covers the entry to the opening 56 in the flange in order to avoid obstruction of dressing material against the edges of said opening 56 . the grid is preferably manufactured of semi - flexible or rigid cells with open pores or spatia made of polymer materials , for instance polyester , polyurethane or steel wool , all typically less compressible to suction than dressing pad 2 . fig1 shows an apparatus and method according to the invention comprising an open polymer pad 2 overlying a tissue culturing scaffold 57 used for regenerating skin tissue in a wound 40 . the adhesive cover sheet 3 , the supply port 11 and suction drainage port 12 are indicated . depending on which type of tissue is to be regenerated , the scaffold may comprise biological and / or non - biological material . a biological scaffold may comprise collagen or dermis , hyaluronic acid or fibrin . when regenerating bone the scaffold may comprise bioactive ceramics or glass . non - biological polymer fiber scaffolds may be biodegradable and comprise , for example , poly - glycolic acid polyester ( pga ) or related substances . the optimal pore size of the scaffold may vary with the phase in the growth process . passage by diffusion of all relevant nutrients and growth substances is obligatory throughout the regenerative process , and cell and vascular structures will have to be accommodated as they develop . the scaffold may thus include a range of more narrow pores which allow passage of molecules including peptides and proteins , as well as a range of wider pores allowing passage of cells , and this pore ratio may vary with the degree of tissue development . antibacterial substances , analgesics , enzymes , growth factors , growth media and cells , including stem cells , fetal cells and genes , may be supplied . in a method for accomplishing tissue regeneration in vivo or in vitro , see fig1 , the positive and negative pressures applied to pad 2 should be minimized in order to leave diffusional and cellular processes in the growth zone of the underlying tissue scaffold undisturbed . the forces governing the passage of fluid through the scaffold should be determined mainly by diffusion and minimal suction . this is accomplished in a controlled way by combining zero hydrostatic pressure or minimal pump head pressure in the dressing with at most weak suction at the drainage port . the hydrostatic pressure in the dressing can be 0 mmhg including compensation both for tube and open pore and / or tissue scaffold resistance . the suction pressures can range , for example , from − 0 mmhg to − 30 mmhg . the fluid supply rates may typically vary between 20 ml / 24 h and 400 ml / 24 h and loading doses for filling the dressing with drug solution may vary between 1 ml and 100 ml . this treatment may be undertaken on a continuous or intermittent basis . the pad 2 may be substituted for a tissue scaffold when the porosity of the scaffold allows passage of treatment fluid under flow and pressure conditions as defined above . fig1 shows an apparatus according to an embodiment of the invention for detecting bleeding from the wound during ongoing suctioning by a simple weighing technique . canister 15 is immobilized in a tight - fitting receptacle 58 placed over load sensor 59 , which in turn is connected to computer 60 , display and control - panel 61 , loudspeaker 62 and telemetric unit 63 , all constructed according to the state of the art , and being part of the basal part 64 of the said apparatus . elastical force or movement in suction tube 13 , or movement in the pump 14 in operation , is prevented from being propagated to canister 15 by means of tubular buffer organs 64 and 65 , each comprising a rigid and a pliable part . the rigid part constitutes in this example two closely fitting openings in the rigid receptacle wall 66 . the pliable tubular part 67 is designed to further minimize movement and elastic force . the rigid part of each buffer organ may comprise polymer or metal . the pliable tubular part can be made of elastic polymer fitted with an inner discontinuous “ skeleton ” of rigid material to prevent collapse and occlusion . the pump 14 is additionally isolated with regard to vibration by means of elastic layer 68 placed between the base of the pump 14 and the basal part of the apparatus containing the computer and control means . this part of the apparatus can be made of metal to avoid vibration and increase stability . the scale 59 may be operated by a load cell according to the state of the art . the computer 61 measures the weight of fluid in the canister 15 at pre - set intervals , and stores and displays the data using simple state of the art technology . the computer 61 first determines the baseline rate and variability of the therapeutic fluid formation over time based on measurements for instance at 2 - 5 min intervals . the smallest rate of fluid formed in addition to the therapeutic rate , which is to be considered as sign of a bleeding , is decided by the user and fed into the computer 61 . the computer 61 then subtracts incoming rates from baseline serially and gives an audible , visual and possibly telemetric alarm once bleeding is detected . a bleeding in the wound may manifest itself 1 ) as a stepwise increase in liquid fluid weight 2 ) as a linear increase or 3 ) as an exponential increase . in a more advanced design , such patterns may also be identified and used by the computer as additional signs of bleeding . the computer can also warn of overflow of fluid in canister 15 . fluid flow rates in the dressing were studied in vitro as a function of the negative pressure applied at the suction port . the flow resistance was unchanged throughout . table i . rate - limited fluid flow vs suction pressure in occlusively applied open polymer dressing with supply and drainage ports , studied in vitro . the dressing comprising polyester fibers ( 11 × 13 cm ) covered occlusively by polymer film and fitted with supply and drainage ports at opposing ends . the dressing was positioned horizontally . the hydrostatic pressure at the supply port was 0 mmhg and the flow resistance in the supply was unchanged during the experiments . fluid flow at the entry to the dressing and pump pressure were measured according to the state of the art . in this situation with unchanged resistance to entry of fluid into the porous dressing , fluid flow rate and suction pressure were close to linearly related . the negative pressure and degree of hydration in the dressing were studied in vitro as functions of the negative pressure at the drainage port . table 2 . in vitro assessment of pore gas pressure and fluid saturation during treatment according to the invention . the dressing comprising polyester fibers ( 11 × 13 cm ) covered occlusively by polymer film and fitted with supply and drainage ports at opposing ends . the dressing was positioned horizontally . the hydrostatic pressure at the supply port was zero . fluid flow was unchanged throughout the experiment . pressure was measured in the drainage port and on the surface of the dressing pad . dressing fluid saturation was measured by weighing , and calculated as percentage of the total saturable volume under influence of negative pressure as indicated . suction pressures at the drainage port and within the pad were correlated over a pressure range of therapeutic interest . the dressing pad was partially saturated with fluid ( mean : 44 percent , range : 35 - 52 percent ). clinically , a wound would thus be exposed dynamically to a combination of wetting and suction . the drainage capacity of a dressing exposed to fluid loading was studied in vitro . in vitro assessment of the drainage capacity of a dressing exposed to fluid loading . the dressing comprising polyurethane foam ( 10 × 7 . 5 cm ) covered occlusively by polymer film and fitted with supply and drainage ports at opposing ends . the dressing was positioned horizontally . fluid supply was increased from 20 drops / min to 100 drops / min in steps of 20 drops . the hydrostatic pressure at the supply port was zero . the suction pressure applied at the drainage port was − 50 mm hg . the thickness of the dressing was used as a measure of its compressed volume , and measured at each step . dressing fluid saturation was assessed in the last step of the experiment , and determined as the percentage between the fluid contained in the dressing ( assessed by weighing ) and the total saturable volume assessed volumetrically during maximal suctioning . the height of the dressing at each step of the experiment was compressed to approximately 7 mm . the dressing fluid saturation at 100 drops / min ( equal to 7 , 200 ml / 24 h ) was 50 / 63 ml , and the maximal saturation thus 80 %. this small format dressing remains partially saturated even when fluid is supplied at a rate as high as 7 , 200 ml / 24 h . the results indicate that drainage capacity and hence a local suctioning effect is functional in a wide volume range at a pressure of − 50 mmhg . in one embodiment , an apparatus for treating and regenerating tissues , covering a wound , combining liquid fluid supply and suction , comprises a pole , a rest , said rest being movable in vertical directions along said pole and having a clamp for securing said rest at a height corresponding to the height of the tissue , at least one fluid reservoir placed on said rest , connected to the tissue , and means for controlling the fluid supply and suction . the rest can form an angle , for example , in the range 0 - 30 ° to the horizontal . the rest can be hinged , and immobilized in any angle from horizontal to vertical . the range of vertical movement of the rest can be , for example , approximately 10 - 200 cm , including for example 30 - 150 cm . a horizontal level meter can used for securing said rest at a height corresponding to the height of the tissue . the level meter such as a telescopic pointer , laser pointer or ultrasound sensor , can be connected with said rest directly or by means of a cord . the fluid reservoir can comprise a pliable and flexible bag filled with treatment fluid . the fluid supply can be connected with the tissue by means of a tube . the controlling means can include a drip chamber and a roller clamp connected with said tube . the controlling means include a drip chamber with an angulated spike connected with said tube . the controlling means can include a level meter connected with said tube . the controlling means can include an injection port connected with said tube . the means controlling the fluid supply can comprise an electronically operated valve . the means controlling the fluid supply can comprise a kink - resistant supply tube . the apparatus can further comprise at least a drop - sensitive sensor for assessing the flow rate . the suction means can comprise a suction pump placed on the platform and connected to the tissue by means of a tube . the inner wall of said tube can be corrugated . the suction pump can be connected to a canister whose liquid fluid content can be determined by means of a scale or by weighing . the suction means can comprise a suction pump is placed on the floor . the suction means can comprise a pump is fixed to the pole by means of a clamp . the pole is , for example , u - shaped and fixed by means of a clamp to a hook which can be fastened to the footboard of a bed . the pole can be straight and fixed to a base . the pole can comprise telescoping parts which can be locked in position by means of screws , clamps or by a hydraulic mechanism . the apparatus can farther comprise a motor which moves said rest in a vertical direction and which is operable by means of a computer . the apparatus can also comprise ultrasound level meters , one fixed and one movable , and both connected to said computer . the apparatus can further comprise a pump used for administering the fluid supply . the pressure head of the said pump can be monitored by means of a sensor in the supply tube . the fluid flow can be controlled by means of timer activated clamps . in one embodiment , apparatus for treating and regenerating tissues allowing administration of a restricted amount of fluid to the supply port of an occlusively applied porous dressing pad during exposure of said pad to continuous suctioning through a separate drainage port , comprising a restricting means preventing free fluid flow , a means to prevent ingress of air through said supply port in connection with said fluid administration , and a drainage port . the supply port can comprise of an injection membrane airtightly connected with a polymer sheet . the supply port can comprise a plate at the side of the dressing pad which can prevent a needle used for injecting treatment fluid through said membrane from penetrating into the dressing and to the wound . the apparatus can further comprise a roller clamp that provides additional restricting means . the friction between piston and syringe wall can provide additional restriction means . in another embodiment , a method for treating and regenerating tissues allowing administration of a restricted amount of saline or drug solution to the supply port of an occlusively applied porous dressing pad during exposure of said pad to continuous suctioning , comprises : applying continuous suction to the drainage port in the range between 30 and 200 mmhg ; applying an injection needle airtightly to a syringe or fluid bag filled with saline or drug solution ; avoiding a fluid bag hydrostatic load ; perforating said supply port elastic injection membrane with the needle during ongoing suction at the drainage port of said dressing pad ; injecting the content of the syringe into the dressing pad in 1 - 5 minutes during ongoing suctioning at said drainage port ; stopping the injection once injected fluid becomes visible through the suction tube wall as it exits the drainage port of the dressing pad ; and withdrawing the said needle from the elastic membrane . in yet another embodiment , a method for non - regenerative tissue treatment by means of combined fluid supply and suction drainage to a porous dressing , comprises : eliminating hydrostatic pressure in the fluid supply port by positioning the fluid bag at the level required for neutralizing supply tube flow resistance ; maintaining the tissue hydrostatic pressure at the supply port at 0 mmhg ; maintaining the fluid flow in a range between 100 ml / 24 / h and 2 , 400 ml / 24 h ; providing a seal which allows negative pressure to be distributed over the tissue and to be maintained at a predetermined level at least during operation of the suction ; maintaining the suction normally in a range between − 20 mmhg and − 200 mmhg , maximally − 760 mmhg ; utilizing loading doses in the range between 1 ml and 500 ml ; and applying steps a - f continuously or intermittently . in yet another embodiment , a method for regenerative treatment by means of combined fluid supply and suction drainage to a tissue scaffold , comprises : eliminating hydrostatic pressure by positioning the fluid bag at a level just sufficient to overcome both supply tube and / or open pore scaffold flow resistance ; maintaining the fluid flow in the range between 20 ml / 24 / h and 400 ml / 24 h ; providing a seal which allows negative pressure to be distributed over the tissue and to be maintained at a predetermined level at least during operation of the suction ; maintaining the suction in the range between − 0 mmhg and − 30 mmhg ; utilizing loading doses in the range between 1 ml and 100 ml ; and applying steps a - e continuously or intermittently . in yet another embodiment , a method for regenerative treatment allowing artificial circulation to a tissue scaffold , comprises : eliminating hydrostatic pressure by positioning the fluid bag at a level just sufficient to overcome supply tube , porous pad and / or scaffold flow resistance ; controlling fluid supply rate by interposing a pump in the supply line ; monitoring the pressure head in the supply port ; monitoring the pressure in the porous pad or scaffold ; maintaining the tissue hydrostatic pressure at the supply port at 0 mmhg ; maintaining the fluid flow in the range between 20 ml / 24 / h and 400 ml / 24 h ; providing a seal which allows negative pressure to be distributed over the tissue and to be maintained at a predetermined level at least during operation of the suction ; maintaining the suction in the range between − 0 mmhg and − 30 mmhg ; utilizing loading doses in the range between 1 ml and 100 ml ; and applying steps a - i continuously or intermittently . in another embodiment , an apparatus for treating and regenerating tissues by means of an occlusively applied dressing pad , comprises a drainage port with means to counteract occlusion of the underlying open pores of the pad when said pad is exposed to continuous suction . the drainage port means can comprise an open grid consisting of interconnected or separate units which form a pattern covering the whole underside of the port abutting the dressing pad . the grid can include the opening in the flange . in another embodiment , an apparatus for detecting bleeding from a wound during continuous suctioning treatment comprises a receptacle , a scale , a canister , movement buffer organs , a computer , visual display , audible alarm and telemetry . in another embodiments , a method for detecting bleeding from a wound during continuous suctioning treatment , comprises : determining the baseline rate and variability of therapeutic fluid formation over time based on measurements of net weights of fluid in the canister at 2 - 5 min intervals ; determining of the minimal rate of fluid formed in addition to said baseline rate which is to be considered as a sign of bleeding , and feeding this information to the computer ; making the computer subtract incoming rates of fluid formation from baseline serially , and giving an audible , visual and telemetric alarm once bleeding is detected .

hydrostatic pressure of aqueous solutions — supplied from reservoir under rate control through tube to port of airtightly applied open pore dressing pad — is eliminated by levelling reservoir placed on rest with pad . dressing pad may overlie a tissue culturing scaffold . a drip chamber with angulated channel permits drops to fall freely and be counted . injection port elastic membrane prevents air inlet to pad while suction is applied at port , permitting fluid given under rate control through membrane to distribute evenly in pad . a drainage port flange , wholly covered by an open grid , is described . acute wound bleeding is detected by computer - controlled serial weighing of a movement - stabilized drainage fluid canister with warning of abnormal flow rate increase .

referring now to the figures , set forth is the corpectomy device 10 in a compressed position with the pivoting endplate 12 angled forward . the corpectomy implant device 10 is defined by a base member 14 telescopingly received into an expansion member 16 . the base member 14 is formed from a housing having a lower end 15 with a first 17 and second 19 side walls extending from said lower end 15 . said base member include end walls 21 and 23 positioned between said first and second side walls 17 , 19 each having a centrally disposed u - shaped slot 18 formed therein extending from the lower end along a length of the end walls with a first edge 20 of said slot 18 non - engaging and a second edge 22 lined with an engaging edge , preferably directional ratchet teeth 22 . lower endplate 12 can be inserted into the open end of the base member 14 , the lower endplate having a surface 11 for use in bone engagement . the expansion member 16 is formed from housing having first and second side walls 25 and 27 and first and second end walls 29 and 31 , the four walls constructed and arranged to encompass said base member walls . side wall 25 includes an aperture 24 sized to permit insertion of pinion tool 30 having a shoulder 32 that allows ease of rotation by bearing upon the side wall 25 with a pinion for engagement of the ratchet teeth 22 . rotation of the pinion tool 30 provides extension of the expansion member 16 from the base member 14 as the pinion tool is limited in movement with the expansion member 16 by the size of the aperture 24 . positioned with the base member is a spring loaded biasing ratchet assembly 36 having a pair of engagement prongs 38 and 40 that engage the ratchet teeth 22 . the biasing ratchet assembly 36 includes having a biasing member 41 that engages an inner surface of the base member 14 expanding the engagement prongs 38 and 40 against the ratchet teeth 22 wherein the spacing of the extension member from the base member is unidirectional to prohibit compression of the structure once positioned . the expansion member 16 permits the device to expand relative to the base member 14 and overall longitudinal dimension of the device . upper endplate 42 can be inserted into the open end of the expansion member 16 , the upper endplate having a surface 44 for use in bone engagement . the endplates 12 and 42 may be interchangeably connected or permanently attached , such as laser welded , to the corpectomy device . these endplates may be of any desired shape , size or thickness . for example , the endplate 42 of fig1 is substantially flat with engagement teeth 44 forming a pattern allowing bone growth material to pass through . in fig1 - 3 the endplate 12 can be moved at an angle that will allow the implant to restore the normal curvature of the spine after the corpectomy device is installed . moreover , the shape may or may not correspond to the cross - sectional shape and size ( foot - print ) of the base . in those instances where the patient presents unusual physiology , such as curvature of the spine ( lordosis or kyphosis ), additional physiology compensating members may be interposed with the respective endplates . these compensating members allow the corpectomy implant device 10 to take on a more arcuate shape thereby conforming more closely with the existing spinal configuration . fig2 is a side view of the corpectomy implant device 10 in a compressed position having expansion member 16 placed over the insert of base member 14 with the pivoting endplate 12 angled backward . fig3 is a side view of the corpectomy implant device 10 in a raised position with the pivoting endplate 12 centered . fig4 is the opposite side view of fig3 depicting the pinion driver 30 inserted into aperture 24 . fig5 is the reverse perspective view illustrating the biasing ratchet mechanism 36 for use in locking the base member 14 and the expansion member 16 in a raised position . fig6 - 8 and 13 are pictorial views depicting the corpectomy implant device 10 between vertebra 100 and 102 in a compressed position . fig9 - 11 depict the device in an expanded state with the pinion driver 30 used to raise the expansion member 16 over the base member 14 . accordingly , in preferred embodiments , a corpectomy device comprises a base member , an expansion member , an upper or lower endplate . in another preferred embodiment , the base member comprises a slot having a first side wall and a second side wall , wherein the first side wall is smooth and the second side wall comprises one or more teeth , spikes or jagged edges . in another preferred embodiment , the expansion member comprises an aperture for receiving a pinion tool having a first shoulder wherein the first shoulder is smooth , and a second shoulder for engagement of the base member . in yet another preferred embodiment , the corpectomy device comprises a ratchet , the ratchet comprising at least one engagement prong , a biasing member or combinations thereof . in yet another preferred embodiment , the upper and lower endplates are interchangeable and comprise patterns , dimensions , shapes , smooth surfaces , grooved surfaces , rough surfaces , or mobility for engaging a vertebra . embodiments of the invention are also directed to methods for manipulating the distance between vertebrae in a patient in need thereof . accordingly , in a preferred embodiment , a method of manipulating the distance between adjacent vertebrae in a patient , comprising surgically inserting an expandable corpectomy device into an intervertebral cavity , the corpectomy device comprising an upper endplate , a lower endplate , a base member wherein the base member is telescopingly receivable into an expansion member ; the base member comprising a slot having a first side wall that is smooth and a second side wall lined with teeth ; the expansion member having an aperture for receiving a pinion tool for increasing longitudinal distances of the expansion member relative to the base member . in some preferred embodiments , the distances between the teeth in the second side wall of the base member aperture are sized so that the expansion can occur by desired increments . in another preferred embodiment , the corpectomy device comprises a spring loaded biasing ratchet having a pair of engagement prongs for engaging the second side wall of the aperture of the base member and a biasing member for engaging an inner surface of the base member . in other preferred embodiments , the upper endplate is insertable into an open end of the expansion member , the upper endplate having a surface for bone engagement . preferably , the upper and lower endplates are interchangeable and comprise patterns , dimensions , shapes , smooth surfaces , grooved surfaces , rough surfaces , or mobility for engaging a vertebra . unless otherwise defined , all terms ( including technical and scientific terms ) used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs . it will be further understood that terms , such as those defined in commonly used dictionaries , should be interpreted as having a meaning that is consistent with their meaning in the context of the relevant art and will not be interpreted in an idealized or overly formal sense unless expressly so defined herein . as used herein , the singular forms “ a ”, “ an ” and “ the ” are intended to include the plural forms as well , unless the context clearly indicates otherwise . furthermore , to the extent that the terms “ including ”, “ includes ”, “ having ”, “ has ”, “ with ”, or variants thereof are used in either the detailed description and / or the claims , such terms are intended to be inclusive in a manner similar to the term “ comprising .” it is to be understood that while a certain form of the invention is illustrated , it is not to be limited to the specific form or arrangement herein described and shown . it will be apparent to those skilled in the art that various changes may be made without departing from the scope of the invention and the invention is not to be considered limited to what is shown and described in the specification and any drawings / figures included herein . one skilled in the art will readily appreciate that the present invention is well adapted to carry out the objectives and obtain the ends and advantages mentioned , as well as those inherent therein . the embodiments , methods , procedures and techniques described herein are presently representative of the preferred embodiments , are intended to be exemplary and are not intended as limitations on the scope . changes therein and other uses will occur to those skilled in the art which are encompassed within the spirit of the invention and are defined by the scope of the appended claims . although the invention has been described in connection with specific preferred embodiments , it should be understood that the invention as claimed should not be unduly limited to such specific embodiments . indeed , various modifications of the described modes for carrying out the invention which are obvious to those skilled in the art are intended to be within the scope of the following claims .

the instant invention is a longitudinally adjustable corpectomy device which fits within the intervertebral distracted channel . a ratchet mechanism allows for an extendable member to adjust to a longer length to accommodate a distracted channel . the ratchet type mechanism allows the members to move in a unidirectional movement to prevent the two members from contracting once expanded .

referring now to the drawings wherein the showings are for the purpose of illustrating the preferred embodiments of the invention only , and not for purpose of limiting same , fig2 - 4 show a wound shield 30 including a hollow tubular inflatable dam 32 , and a clear plastic window 34 attached to the dam 32 . dam 32 is formed of an inner peripheral surface or wall 42 which defines and surrounds a central opening 50 . dam 32 also includes an outer peripheral surface or a wall 44 connected to inner peripheral surface 42 by a rear or bottom body - engaging surface 48 and a front or top surface 46 . dam 32 is provided with an irrigation aperture 52 extending from outer peripheral surface 44 through inner peripheral surface 42 . aperture 52 is adapted to receive or otherwise couple with an irrigation tube for providing communication between an irrigation system and central opening 50 . typically , the irrigation system provides an irrigation solution with medicinal characteristics for continuous or frequent cleansing of the wound . a drying aperture 54 is provided , which is adapted to receive or otherwise couple with a drying tube connected to an associated air supply . drying aperture 54 provides communication between the air supply and central opening 50 for continuous or selective intermittent drying of the wound after irrigation . the drying aperture is also useful for connection to an associated source of vacuum ( not shown ) for use with vac devices to apply a vacuum to the wound . a drainage aperture 56 is provided , preferably on a side of the dam opposite from the irrigation and drying apertures as shown . the drainage aperture is adapted to receive or otherwise couple with a drainage tube . the drainage tube could be connected to a pump , a collecting device , or a like device , to facilitate the removal of the irrigation solution , and dead skin and blood discharged from the wound . both apertures 52 and 56 extend through the dam 32 from outer peripheral surface 44 through inner peripheral surface 42 . these apertures can be plugged using suitable stoppers or the like when used as a vac , when the patient is ambulatory , or as desired . it is to be appreciated that any of the apertures can be adapted for connection with an associated source of vacuum . dam 32 is preferably manufactured using a rotational casting or a rotational molding such as slush molding . the mold is typically made of aluminum but could be made of a variety of other metals . dam 32 is formed from a soft liquid plastic , preferably vinyl , and the apertures are formed by extending a core pin through the mold , and removing the core pin after the liquid plastic cures . dam 32 further includes a soft self - sealing plug 40 preferably molded into the outer wall 44 . self - sealing plug 40 is adapted to receive a hypodermic needle used to inflate the dam 32 with air . the needle is inserted through the self - sealing plug 40 and the bulb is compressed to force air into the dam until the desired firmness of the dam 32 is obtained . the needle can be withdrawn at any time from the self - sealing plug 40 without any leakage of the air after removal . the self - sealing plug also allows for addition or removal of air at any time . self - sealing plug 40 is preferably made of nitriale rubber . window 34 is made of a semi - hard clear plastic vinyl and has a generally flat planar bottom surface 33 and a generally flat top planar surface 35 . in the embodiment illustrated , the window has an overall generally rectangular shape . preferably , bottom planar surface 33 is attached to front surface 46 of the dam 32 using ultra - violet curable adhesive . however , various other types of adhesives could be used . window 34 completely encloses central opening 50 of the dam 32 so that central opening 50 can remain airtight when the wound shield 30 is placed on the body of the patient , except for apertures 52 , 54 , and 56 . it is preferred that window 34 encompass outer peripheral surface 44 of the dam 32 to increase the rigidity of the wound shield 30 . a pair of spaced apart connector assemblies 64 are disposed on top planar surface 35 of window 34 at opposite sides of the window . connector assemblies 64 include a set of spaced apart co - axial tubes 66 holding a rod 68 that is connected to a set of eyelets 70 . tubes 66 are preferably made of plastic and could be bonded to top planar surface 35 of the window 34 or could be formed during the molding of window . rods 68 and eyelets 70 are placed in tubes 66 prior to bonding or molding . rod 68 and eyelet 70 are pivotable about an axis parallel to top planar surface 35 , so that movement or twisting of the patient does not cause wound shield 30 to move from its position on the body of the patient . further , connector assemblies are placed at a location outside central opening 50 to ensure that even pressure is applied to the entire perimeter of dam 32 when wound shield 30 is on the body of a patient . rods 60 and eyelets 70 are preferably made of metal , but could be made of plastic or the like . the rods 68 extend completely across the face of the would shield 30 and in that way help prevent the shield from buckling in the middle during use such as along the line defined by section a — a in fig2 . a pair of belts 36 and 38 are provided for holding wound shield 30 at a fixed location on the patient , so that central area 50 surrounds the wound . belts 36 and 38 are preferably made of an elastic material , such as latex or neoprene foam , and are preferably non - absorbent and easy to clean . each belt includes a first and a second connecting end 58 . each connecting end 58 includes a connecting portion 60 attached to the belt , and a hook portion 62 adapted to engage eyelet 70 . it should be appreciated that in some circumstances , the wound shield may only need one belt because of the size or location of the wound . further , the belt could be fixed at one end to a fixed connector on the wound shield , and be pivotable at the other end . it also should be appreciated that the releasable engagement of the belt and the connector assembly could employ connector types other than the preferred eye and hook arrangement . with particular reference now to fig3 , dam 32 includes a ridge 72 extending angularly from inner peripheral surface 42 beyond and away from the bottom body - engaging surface 48 . dam 32 also includes a ridge 74 extending angularly from outer peripheral surface 44 beyond and away from the bottom body - engaging surface 48 . ridges 72 and 74 cooperate in holding wound shield 30 in a fixed position on the patient &# 39 ; s body , even during movement and twisting of the patient . further , ridges 72 and 74 seal central opening 50 and prevent any fluids or vacuum from escaping , and prevent contaminants from entering central area 50 . ridges 72 and 74 also alleviate the need to apply skin adhesives to the skin of the patient prior to applying the front body - engaging surface of the wound shield , while adding substantially to the cross - sectional rigidity of the dam 32 . with continued reference to fig3 , dam 32 preferably also includes a ridge 76 extending angularly from inner peripheral surface 42 beyond and away from top surface 46 and a ridge 78 extending angularly from outer peripheral surface 44 beyond and away from top surface 46 . ridges 76 and 78 aid in the adhesion process of front surface 46 to the back surface 33 of window 34 . additionally , ridges 76 and 78 increase the cross - sectional rigidity characteristic of dam 32 , which helps prevent the center of the wound shield 30 from buckling after securing wound shield 30 on the body of a patient . it should be appreciated that in some cases , such as in stubborn wounds , more pressure is necessary for irrigation of the wound . it also should be appreciated that it is not always necessary to place irrigation aperture , drying aperture , and drainage aperture through the dam . for example , fig5 shows a wound shield 77 having a dam 79 attached to a window 81 . a first hole 75 is cut out of window 81 and covered over by a piece of adhesive tape 80 or plug . a second hole 82 is cut out of window 81 and covered by a piece of adhesive tape 84 or plug . the holes 75 , 82 are adapted to receive the tip of an asepto syringe . adhesive tape 80 or plug can be removed and irrigation solution can be communicated to the wound through hole 75 via large syringe , or the like . further , an air source could be used to communicate air to the wound through hole 75 for drying the wound . adhesive tape 84 or plug can be removed to provide drainage of irrigation solution , dead skin , and blood from central area 50 . after cleansing , drying , and drainage , tape 80 and 84 or plug can be placed back over holes 75 and 82 , respectively , protecting the wound from outside dirt or bacteria . it should be noted that the shape of the wound shield could take on many forms , and the connector assemblies could be disposed on the window in a variety of different orientations . for example , fig6 shows a wound shield 30 ′ having an overall smaller size than the shield 30 shown in fig2 - 4 . only a single belt 36 ′ is needed to receive the shield 30 ′ to a patient . this type of wound shield could be useful for a wound near the groin area of an individual , such as one that would occur in a hernia operation or catheterization procedure . the wound shield 30 ′ is formed and functions substantially identical to the shield 30 described above . like parts are indicated in fig6 with a primed (′) suffix . the foregoing descriptions are specific embodiments of the present invention . it should be appreciated that these embodiments are described for purposes of illustration only , and that numerous alterations and modifications may be practiced by those skilled in the art without departing from the spirit and scope of the invention . it is intended that all such modifications and alterations be included insofar as they come within the scope of the invention as claimed or the equivalents thereof .

an irrigation dressing is provided including a hollow inflatable tubulardam with a central opening adapted to surround the wound of the individual . a semi - hard resilient clear plastic window is attached to the dam , such that the central opening is completely enclosed on a front surface of the dam . the dressing includes an inner peripheral ridge and an outer peripheral ridge extending beyond a bottom or back body - engaging surface of the dam which facilitates drawing a vacuum . a plurality of connectors are attached to a front planar face surface of the clear plastic window . at least one connector is pivotable about an axis parallel to the front planar surface of the window . a self - sealing plug is disposed inside the dam so that the dam can be inflated to selected pressures using an associated hypodermic needle or the like .

alopecia ( baldness ) a deficiency of either normal or abnormal hair , is primarily a cosmetic problem in humans . it is a deficiency of terminal hair , the broad diameter , colored hair that is readily seen . however , in the so - called bald person although there is a noticeable absence of terminal hair , the skin does contain vellus hair which is a fine colorless hair which may require microscopic examination to determine its presence . this vellus hair is a precursor to terminal hair . in accordance with the invention as described herein , compounds represented by wherein r 1 , r 2 , a , b , z and x are defined above , can be used to stimulate , such as stimulating the conversion of vellus hair to growth as terminal hair as well as increasing the rate of growth of terminal hair . in the course of treating patients having glaucoma , treatment may only be appropriate in one eye . within the course of daily practice it was discovered that a patient who been treated with bimatoprost has lashes that were longer , thicker and fuller in the treated eye than in the non - treated eye . on examination the difference was found to be very striking . the lashes were longer and had a more full dense appearance in the treated eye . the lash appearance on the lids of the treated eye would have appeared quite attractive if it represented a bilateral phenomenon . because of its asymmetric nature , the long lashes on one side could be construed as disturbing from a cosmetic standpoint . because of the very unusual appearance a systematic examination of other patients who were taking bimatoprost in only one eye was made . it soon became apparent that this altered appearance was not an isolated finding . comparison of the lids of patients who were taking bimatoprost in only one eye revealed subtle changes in the lashes and adjacent hairs of the bimatoprost - treated side in several patients . definite differences could be identified to varying degrees in the lashes and adjacent hairs of all patients who were taking the drug on a unilateral basis for longer than 6 months . these findings were totally unexpected and surprising . minoxidil is thought to stimulate hair growth by its ability to cause vasodilation suggesting that agents with such a capability may be uniquely effective in stimulating hair growth . the finding that bimatoprost , which , as explained below , is not a prostaglandin derivative , such as latanoprost stimulates hair growth is especially surprising and unexpected . the changes in the lashes were apparent on gross inspection in several patients once attention was focused on the issue . in those with light colored hair and lashes , the differences were only seen easily with the aid of the high magnification and lighting capabilities of the slit lamp biomicroscope . in the course of a glaucoma follow up examination , attention is generally immediately focused on the eye itself . because of the high power magnification needed only one eye is seen at a time and the eye is seen at a high enough power that the lashes are not in focus . at these higher powers , any lash asymmetry between the two eyes is not likely to be noticed except by careful systematic comparison of the lashes and adjacent hairs of the eyelids of the two eyes . observed parameters leading to the conclusion that more robust hair growth occurred in the treated area following administration of bimatoprost were multiple . they included increased length of lashes , increased numbers of lashes along the normal lash line , increased thickness and luster of lashes , increased auxiliary lash - like terminal hair in transitional areas adjacent to areas of normal lash growth , increased lash - like terminal hairs at the medial and lateral canthal area , increased pigmentation of the lashes , increased numbers , increased length , as well as increased luster , and thickness of fine hair on the skin of the adjacent lid , and finally increased perpendicular angulation of lashes and lash - like terminal hairs . the conclusion that hair growth is stimulated by bimatoprost is thus supported not by evidence of a difference in a single parameter but is based on multiple parameters of hair appearance in treated vs . control areas in many subjects . this finding is entirely unexpected and represents a previously unrecognized effect of bimatoprost on stimulation of hair follicles . the modified hairs of the lashes normally turn over slowly and are in their resting phase longer than hair on , for example , the scalp . the ability to cause differences in appearance of lashes , the ability to stimulate conversion of vellus or intermediate hair to terminal hairs in transitional areas and the ability to stimulate growth of vellus hair on the skin indicates that bimatoprost is a diversely effective and efficacious agent for the stimulation of hair growth . thus , the present invention provides a treatment by bimatoprost of hair of the scalp , eyebrows , beard and other areas that contain hair that results in increased hair growth in the corresponding areas . patients that are treated in or around the eye with compounds of the invention , such as bimatoprost , regularly develop hypertrichosis including altered differentiation , numbers , length , thickness , curvature and pigmentation in the region of treatment . some examples of representative compounds useful in the practice of the present invention include the compounds shown in table 1 : one presently preferred compound for use in the practice of the present invention is cyclopentane n - ethyl heptanamide - 5 - cis - 2 -( 3α - hydroxy - 5 - phenyl - 1 - trans - pentenyl )- 3 , 5 - dihydroxy , [ 1 α , 2 β , 3 α , 5 α ], also known as bimatoprost and sold under the name of lumigan ® by allergan , inc ., calif ., usa . this compound has the following structure : the synthesis of the above compounds described above has been disclosed in u . s . pat . no . 5 , 607 , 978 . this patent also shows , particularly in examples 1 , 2 , 5 and 7 that these compounds are not prostaglandins , in that they do not behave as prostaglandins in art - recognized assays for prostaglandin activity . the invention thus relates to the use of the above compounds , or prodrugs of the active compounds , for treatment for the stimulation of hair growth . as used herein , hair growth includes hair associated with the scalp , eyebrows , eyelids , beard , and other areas of the skin of animals . in accordance with one aspect of the invention , the compound is mixed with a dermatologically compatible vehicle or carrier . the vehicle which may be employed for preparing compositions of this invention may comprise , for example , aqueous solutions such as e . g ., physiological salines , oil solutions or ointments . the vehicle furthermore may contain dermatologically compatible preservatives such as e . g ., benzalkonium chloride , surfactants like e . g ., polysorbate 80 , liposomes or polymers , for example , methyl cellulose , polyvinyl alcohol , polyvinyl pyrrolidone and hyaluronic acid ; these may be used for increasing the viscosity . furthermore , it is also possible to use soluble or insoluble drug inserts when the drug is to be administered . the invention is also related to dermatological compositions for topical treatment for the stimulation of hair growth which comprise an effective hair growth stimulating amount of one or more compounds as defined above and a dermatologically compatible carrier . effective amounts of the active compounds may be determined by one of ordinary skill in the art but will vary depending on the compound employed , frequency of application and desired result , and the compound will generally range from about 0 . 0000001 to about 50 %, by weight , of the dermatological composition , preferably from about 0 . 001 to about 50 %, by weight , of total dermatological composition , more preferably from about 0 . 1 to about 30 %, by weight of the composition . the present invention finds application in all mammalian species , including both humans and animals . in humans , the compounds of the subject invention can be applied for example , to the scalp , face , beard , head , pubic area , upper lip , eyebrows , and eyelids . in animals raised for their pelts , e . g ., mink , the compounds can be applied over the entire surface of the body to improve the overall pelt for commercial reasons . the process can also be used for cosmetic reasons in animals , e . g ., applied to the skin of dogs and cats having bald patches due to mange or other diseases causing a degree of alopecia . the pharmaceutical compositions contemplated by this invention include pharmaceutical compositions suited for topical and local action . the term “ topical ” as employed herein relates to the use of a compound , as described herein , incorporated in a suitable pharmaceutical carrier , and applied at the site of thinning hair or baldness for exertion of local action . accordingly , such topical compositions include those pharmaceutical forms in which the compound is applied externally by direct contact with the skin surface to be treated . conventional pharmaceutical forms for this purpose include ointments , liniments , creams , shampoos , lotions , pastes , jellies , sprays , aerosols , and the like , and may be applied in patches or impregnated dressings depending on the part of the body to be treated . the term “ ointment ” embraces formulations ( including creams ) having oleaginous , water - soluble and emulsion - type bases , e . g ., petrolatum , lanolin , polyethylene glycols , as well as mixtures of these . typically , the compounds are applied repeatedly for a sustained period of time topically on the part of the body to be treated , for example , the eyelids , eyebrows , skin or scalp . the preferred dosage regimen will generally involve regular , such as daily , administration for a period of treatment of at least one month , more preferably at least three months , and most preferably at least six months . for topical use on the eyelids or eyebrows , the active compounds can be formulated in aqueous solutions , creams , ointments or oils exhibiting physiologically acceptable osmolarity by addition of pharmacologically acceptable buffers and salts . such formulations may or may not , depending on the dispenser , contain preservatives such as benzalkonium chloride , chlorhexidine , chlorobutanol , parahydroxybenzoic acids and phenylmercuric salts such as nitrate , chloride , acetate , and borate , or antioxidants , as well as additives like edta , sorbitol , boric acid etc . as additives . furthermore , particularly aqueous solutions may contain viscosity increasing agents such as polysaccharides , e . g ., methylcellulose , mucopolysaccharides , e . g ., hyaluronic acid and chondroitin sulfate , or polyalcohol , e . g ., polyvinylalcohol . various slow releasing gels and matrices may also be employed as well as soluble and insoluble ocular inserts , for instance , based on substances forming in - situ gels . depending on the actual formulation and compound to be used , various amounts of the drug and different dose regimens may be employed . typically , the daily amount of compound for treatment of the eyelid may be about 0 . 1 ng to about 100 mg per eyelid . for topical use on the skin and the scalp , the compound can be advantageously formulated using ointments , creams , liniments or patches as a carrier of the active ingredient . also , these formulations may or may not contain preservatives , depending on the dispenser and nature of use . such preservatives include those mentioned above , and methyl -, propyl -, or butyl - parahydroxybenzoic acid , betaine , chlorhexidine , benzalkonium chloride , and the like . various matrices for slow release delivery may also be used . typically , the dose to be applied on the scalp is in the range of about 0 . 1 ng to about 100 mg per day , more preferably about 1 ng to about 10 mg per day , and most preferably about 10 ng to about 1 mg per day depending on the compound and the formulation . to achieve the daily amount of medication depending on the formulation , the compound may be administered once or several times daily with or without antioxidants . a study is initiated to systematically evaluate the appearance of lashes and hair around the eyes of patients who are administering bimatoprost in only one eye . the study involves 10 subjects , 5 male , 5 female , average age 70 years , ( ranging from 50 - 94 years ). all patients have glaucoma . each subject is treated daily by the topical application of one drop of bimatoprost at a dosage of 1 . 5 . mu . g / ml / eye / day ( 0 . 03 %, by weight , ophthalmic solution , sold under the name lumigan ® by allergan , irvine , calif ., u . s . a .) to the region of one eye by instilling the drop onto the surface of the eye . the region of the fellow control eye is not treated with bimatoprost and served as a control . in the course of treatment with eye drops , there is typically spontaneous tearing , and excess fluid from the drops and associated tears gathers at the lid margins . in the course of wiping the drug containing fluid from the lid margins and adjacent lid , a thin film of the fluid is routinely spread to contact the adjacent skin of the lid area . this widespread exposure of the skin around the lid to the effect of drops is regularly demonstrated in patients who develop a contact dermatitis . typically the entire area of the upper and lower lid are involved with induration , erythema and edema demonstrating the regular extensive exposure of the ocular adnexa to the influence of topically applied drugs . the study is limited to subjects who have administered bimatoprost to one eye for more than 3 months . the mean duration of exposure to bimatoprost prior to assessing the parameter of lash growth between the control and study eye is 129 days ( range 90 - 254 days ). observations are made under high magnification at the slit lamp biomicroscope . documentation of differences between the control and treatment areas is accomplished using a camera specially adapted for use with the slit lamp biomicroscope . length of lashes : increased length of eyelashes is regularly observed on the side treated with bimatoprost . the difference in length varies from approximately 10 % to as much as 30 %. number of lashes : increased numbers of lashes are observed in the treated eye of each patient . in areas where there are a large number of lashes in the control eye , the increased number of lashes in the bimatoprost - treated eye gave the lashes on the treated side a more thickly matted overall appearance . auxiliary lash - like hair growth : several patients have an apparent increase in lash - like hair in transitional areas adjacent to areas of normal lash distribution . these prominent robust appear lash - like hairs appeared to be of comparable length to the actual lashes . these long , thick lash - like hairs were present in the central portion of the lids of several patients in a linear arrangement just above the lash line . hairs are present at similar locations in the control eyes but are by contrast thinner or more fine in appearance , have less luster and pigment and are more flat against the skin of the lid typical of vellus or intermediate hairs . in several patients , lash - like terminal hairs grow luxuriantly in the medial canthal area in the treated eye . in the corresponding control eye , vellus hairs are seen at the same location . lash - like hairs are also present in the lateral canthal area of the treated eye but not the control eye in several subjects . large lashes are not normally present at the lateral canthus and the area is generally free of all but a few occasional very fine lashes or vellus hairs . increased growth of vellus hair on lids : fine microscopic vellus hair is present on the skin of the lids and is easily seen with the slit lamp biomicroscope . this vellus hair is typically denser adjacent to and below the lateral portion of the lower lids . while remaining microscopic , vellus hairs are increased in number , appear more robust and are much longer and thicker in treated than in control eyes in the areas below and lateral to the lower lid . perpendicular angulation of hairs : in areas where there are lash - like hairs above the lash line and in the medial and lateral canthal areas , the hairs are much longer , thicker and heavier . they also leave the surface of the skin at a more acute angle , as though they are stiffer or held in a more erect position by more robust follicles . this greater incline , pitch , rise or perpendicular angulation from the skin surface gives the appearance of greater density of the hairs . the foregoing observations clearly establish that bimatoprost can be used to increase the growth of hair in man . this conclusion is based on the regular and consistent finding of manifestations of increased hair growth in treated vs . control areas in human subjects . the conclusion that the drug bimatoprost is capable of inducing increased robust growth of hair is based not on a single parameter , i . e ., length , but is based on multiple lines of evidence as described in the results . detailed examination and description of multiple parameters of differences in hair is greatly facilitated by the ability to examine the hairs at high magnification under stable conditions of fixed focal length and subject position utilizing the capabilities of the slit lamp biomicroscope . the figure shows the actual results on the eyelashes of a patient treated for glaucoma with lumigan ® bimatoprost for 6 months . a topical cream is prepared as follows : tegacid and spermaceti are melted together at a temperature of 70 - 80 ° c . methylparaben is dissolved in about 500 gm of water and propylene glycol , polysorbate 80 , and bimatoprost are added in turn , maintaining a temperature of 75 - 80 ° c . the methylparaben mixture is added slowly to the tegacid and spermaceti melt , with constant stirring . the addition is continued for at least 30 minutes with additional stirring until the temperature has dropped to 40 - 45 ° c . finally , sufficient water is added to bring the final weight to 1000 gm and the preparation stirred to maintain homogeneity until cooled and congealed . a topical cream is prepared as follows : tegacid and spermaceti are melted together at a temperature of 70 - 80 ° c . methylparaben is dissolved in water and propylene glycol , polysorbate 80 , and bimatoprost are added in turn , maintaining a temperature of 75 - 80 ° c . the methylparaben mixture is added slowly to the tegacid and spermaceti melt , with constant stirring . the addition is continued for at least 30 minutes with additional stirring until the temperature has dropped to 40 - 45 ° c . finally , sufficient water is added to bring the final weight to 1000 gm and the preparation stirred to maintain homogeneity until cooled and congealed . the composition is applied to bald human scalp once daily to stimulate the growth of hair . an ointment containing 2 % by weight bimatoprost is prepared as follows : white petrolatum and wool fat are melted , strained and liquid petrolatum is added thereto . the bimatoprost , zinc oxide , and calamine are added to the remaining liquid petrolatum and the mixture milled until the powders are finely divided and uniformly dispersed . the mixture is stirred into the white petrolatum , melted and cooled with stirring until the ointment congeals . the foregoing ointment can be applied topically to mammalian skin for increased rate of hair growth , and can be prepared by omitting the zinc oxide and calamine . a dermatological ophthalmic ointment containing 10 % by weight bimatoprost is prepared by adding the active compound to light liquid petrolatum . white petrolatum is melted together with wool fat , strained , and the temperature adjusted to 45 - 50 ° c . the liquid petrolatum slurry is added and the ointment stirred until congealed . suitably the ointment is packaged in 30 gm tubes . the foregoing ointment can be applied to the eyelid to enhance the growth of eyelashes . similarly the composition can be applied to the brow for eyebrow growth . an aqueous solution containing 5 %, by weight , bimatoprost is prepared as follows . bimatoprost is dissolved in water and the resulting solution is sterilized by filtration . the solution is aseptically filled into sterile containers . the composition so prepared can be used in the topical treatment of baldness by application to the scalp daily . a sample of bimatoprost is dissolved in the vehicle of n - methyl pyrrolidone and propylene glycol . the composition can be used for application to dogs or cats having hair loss due to mange or alopecia of other causes . an aerosol containing approximately 0 . 1 % by weight bimatoprost is prepared by dissolving the bimatoprost in absolute alcohol . the resulting solution filtered to remove particles and lint . this solution is chilled to about minus 30 ° c . to the solution is added a chilled mixture of dichlorodifluoromethane and dichlorotetrafluoroethane . thirteen ml plastic - coated amber bottles are cold filled with 11 . 5 gm each of the resulting solution and capped . the composition can be sprayed on the scalp daily to stimulate the growth of hair . a powder of the compound bimatoprost is prepared by mixing in dry form with talcum powder at a weight / weight ratio of 1 : 10 . the powdered mixture is dusted on the fur of minks or other commercially valuable fur bearing animals and show animals for increased rate of hair growth . following the procedure of the preceding examples , compositions are similarly prepared substituting an equimolar amount of a compound of table 1 for the bimatoprost disclosed in the preceding examples . similar results are obtained . while the preferred embodiment of the invention has been illustrated and described , it will be appreciated that various changes can be made therein without departing from the spirit and scope of the invention . the embodiments of the invention in which an exclusive property or privilege is claimed are defined as follows :

methods and compositions for stimulating the growth of hair are disclosed wherein said compositions include a cyclopentane heptanoic acid , 2 - cycloalkyl or arylalkyl compound represented by the formula i wherein the dashed bonds represent a single or double bond which can be in the cis or trans configuration , a , b , z , x , r 1 and r 2 are as defined in the specification . such compositions are used in treating the skin or scalp of a human or non - human animal . bimatoprost is preferred for this treatment .

the following is a description of the preferred embodiment of the invention . it is clear that there may be variations in the size and the shape of the gravity driven wheeled vehicle , in the materials used in the construction and in the orientation of the components . most importantly , the teaching of the wheeled version of the gravity driven vehicle is applicable to the version having skis or pans mounted in place of some or all of the wheels and which is used as a gravity driven vehicle on snow or ice covered downhill terrain . the stability in the absorbing of shock from uneven surface conditions and the stability and performance while making turns while going downhill derives from the combination of the steering and suspension geometry and the inherent shape of the skis mounted in place of the wheels and tires . in order to most simply and clearly characterize the essential features of the invention reference is made to drawing fig1 a , 1 b , 2 , 3 , 6 and 10 in which the essential elements of the invention are identified by numerals ( not in a circle ). fig4 , 7 , 8 and 9 are details of various elements which are well known to the ordinary skilled artisan . it is also important to note that the instant vehicle invention may have one wheel in front and one wheel in the rear . it is also possible to have three wheels with the single wheel either in the front or in the rear of the vehicle . steering may be effected by using either the front wheel ( s ) or the rear wheel ( s ) or both . braking combinations are likewise possible — front wheel , rear wheel or both . with reference now to particularly fig1 , 3 , 6 , 10 , 14 a , 14 b , 15 a and 15 b there is illustrated a four wheeled gravity driven steerable wheeled vehicle 10 . there is a chassis 12 having chassis front portion 12 a , chassis rear portion 12 b , chassis underside 12 c and chassis top side 12 d . a rider riding surface 14 is on chassis top side 12 d and is configured to cause a rider on rider riding surface 14 to be oriented in a prone , face down , face forward position . there is provided a means for attaching , 16 , a rear axle assembly 16 a substantially at chassis rear portion 12 b . there is also means for mounting , 18 , a front axle assembly 18 a substantially at chassis front portion 12 a . provided also is a means for steering , 20 , gravity driven steerable wheeled vehicle 10 or three - wheeled vehicle 40 by the rider when the rider is positioned on rider riding surface 14 . there are rear wheel hub and spindle assemblies 22 integral with rear axle assembly 16 a . wheels and tires 23 are normally mounted to the wheel hub . front wheel hub and spindle assemblies 24 are integral with front axle assembly 18 a . a braking system or means for causing deceleration and halting of motion 26 of vehicle 10 when vehicle 10 ( or 40 ) has motion is provided . braking system 26 may be hydraulic , mechanical or a combination of the two and braking may be of all wheels or some of the wheels . in order to help the rider stay on vehicle 10 or 40 , there is a means for harnessing 28 the rider onto and into rider riding surface 14 when the rider is positioned on the vehicle . to provide additional comfort for the rider and to improve the stability of the vehicle while moving , there may be provided means for absorbing shock 20 exerted on each of the front wheels and tires 23 attached to each of the two front wheel hub and spindle assemblies 24 thereby damping shock caused by vehicle 10 passing over rough terrain , between front wheels and tires 23 and front axle assembly 18 a . there may also be means for absorbing shock 32 exerted on each of the rear wheels and tires 23 attached to each of the two rear wheel hub and spindle assemblies 22 thereby further damping shock . in order to get wheeled vehicle 10 or 40 or ski equipped vehicle 10 a or 40 a up a ski slope for example , there is provided a combination rear roll bar and transport bail 34 . when the rider is on the vehicle , bar 34 is in the lowered position providing the rider with a roll bar and an object against which pressure may be applied when the rider is in a sharp turn . bar 34 is placed in a second position which permits attachment to a lift such as a ski lift . in order to discuss some of the engineering features , reference is again made to the drawings including fig4 - 19 . the drawings show simply the preferred embodiments of the wheeled and the ski equipped vehicle which have the following preferred specifications : fig1 shows a top , side , and front plan view of the vehicle , illustrating the body curvatures , the rider inclined riding surface / bed including the 11 ″ diameter high speed pneumatic , tubeless tires in the preferred embodiment of the vehicle , which are designed for motor vehicle racing at speeds in excess of 100 mph and which provide excellent traction and a soft but firm ride . advanced four wheel “ a ” arm air spring , oil damped suspension — independent four wheel suspension with air / oil shocks or with coil / oil shocks is provided and yields a smooth , stable ride over surfaces with irregularities ranging from wash board to large bumps . however , not all four wheels need have suspension , possibly only the front wheels might have suspension . also , the vehicle could be made in either a four - wheeled or three wheeled embodiment . in either embodiment , the suspension is not essential . fig3 illustrates a three ( 3 ) wheeled embodiment of the vehicle . fig4 shows a detail view of the assembly axle with an air / oil shock used in the wheel suspension , and fig5 shows a detail view of the assembly axle with a coil / oil shock used in the wheel suspension . independent hydraulic braking is provided from dual , real wheel , hydraulic disk brakes , designed for motor vehicle racing at speeds to 150 mph and operated with a single hand lever . these brakes give smooth , uniform and powerful braking capability whether with a four or three - wheeled embodiment . the braking system could be modified for a three - wheeled embodiment . fig6 is a detail view of the hydraulic rear wheel brake system . for the detail of the braking system used with the ski equipped version of the vehicles 10 a or 40 a , reference is made to fig1 - 19 . particularly , fig1 a and 16b illustrates in the partial top plan view in shadow front skis 70 a assembled to the front a - arm 32 a and also illustrating in shadow the steering linkage , the front brake system 80 including brake return system 88 and the front suspension system 30 and particularly in fig1 b is illustrated the “ canting ” of the skis 70 a ; fig1 shows the attachment of a rear ski assembly 70 a i . e , the ski assembly having ski brake assembly 80 as a part of ski assembly 70 and also shows , in shadow , the “ unloaded ” attitude of ski assembly 70 a and the relative positions of the suspension components and the fully loaded shock absorber 32 b compressed attitude of the ski and the relative positions of the suspension components , i . e ., a - arm 32 a and the piston of absorber 32 b ; fig1 shows a left rear ski 70 a attached to means for absorbing shock 32 which is attached to the rear axle 31 , the manner of the a - arm 32 a attachment to the ski post 72 , the a - arm pivot point 32 a 3 on the axle 31 , the connection of the a - arm shock attachment end 32 a 2 to the shock absorber end 32 b 1 which shock absorber is attached to the axle at the shock absorber pivot location 32 b 2 and also showing the brake blade 84 , brake arm 82 , and the brake cylinder 81 . fig1 is a view of the ski assembly 70 a of the invention , which shows , in shadow , the change in position of the brake components of the braking assembly 80 . fig1 a is a top view of section aa which illustrates the detail of the brake return spring assembly 88 along with return springs 88 a . there is provided a combination rear roll bar and transport bail . this bar is hinged so that locked in the folded down position , it tends to confine the legs of the rider and further resists overturning of the vehicle . when this bar is in the unfolded or up position it is useful as a tow or lift bar which may be attachable to a ski lift as an example of use . however , it is possible to have an embodiment of the vehicle without this feature . fig1 illustrates detail of the tow - bar assembly which also is a part of the rider restraint system . the prone ( lying down ) low center of gravity design provides control and good visibility . it is also possible that this low position may add to the level of safety for the rider . the extremely low center of gravity provides a relatively stable and safe ride — overturning is nearly impossible . there is provided a safety harness which enhances control , stability and rider safety , and which is shown illustrated in fig2 and 3 . the shoulder harness provides rider stability and contributes to rider safety by keeping the rider in place on the vehicle . there is also an automatic brake which actuates upon release of the hand grips for operation and parking safety . this feature is not essential to the basic embodiment of the invention , however this is an important additional feature . with this safety braking mechanism , the vehicle will be stopped if the rider were to fall off of the vehicle at some point during the operation of the vehicle . additional to the automatic brake system there may also be a means for causing the vehicle to go into a constant tight turn mode of operation if the rider loses control or if the rider fall from the vehicle while in motion . the surface of the vehicle on which the rider lays is comprised of a closed cell body pad for rider comfort . there is an elevated chest rest and thick foam mat which provide additional rider comfort and visibility . in the preferred embodiment , the body and chassis of the vehicle is made from light weight foam core fiberglass reinforced construction . the strong , rigid , impact resistant foam filled fiberglass body with aluminum inserts provides a single framework for attachment of all components . fiberglass body , plated steel parts , and extensive use of aluminum provide optimum protection from the elements , and from impact damage . the steering and braking mechanism is a ball bearing bicycle style steering and braking assembly which is positive , responsive and familiar to all to control , thus making learning to ride , and riding the vehicle easier and more comfortable . fig7 and 15a provide , in combination a detail view showing the prone steering linkage . substantially the same steering system as shown is fig7 and 15a is also used in the ski equipped vehicles as shown in fig1 a , 12 a , 13 a and 16 a . there are provided precision bearings on all four axles in one embodiment . independent rear axles provide maximum maneuverability in a four wheeled embodiment . the vehicle may be provided with precision wheel hubs , with pre - lubricated ball bearings , which are maintenance free . in a preferred embodiment the suspension and steering spindle bearings are formed of woven teflon or nomex and are designed to withstand high impact forces and hostile environments , and provide long life with no maintenance . fig2 shows a top , side , and front plan view of the vehicle showing , in shadow , the axle , steering , and wheel spindles . also , fig8 and 9 show a detail view showing the right rear wheel spindle and a detail view showing the right front wheel spindle . the preferred steering post ball bearings and linkage ball rod ends provide maintenance free , smooth , zero back lash response . each vehicle may be provided with elastomer bumper strips in the front and the rear which provide impact protection for the vehicle and rider . the preferred steering post , wheel , and front and rear axle assemblies can be removed intact should maintenance be required , thus reducing time and cost of any necessary maintenance . in a preferred embodiment , the vehicle chassis has a ramp - shaped underbody and detachable covers which offer protection for axles , steering linkage , and suspension from road obstacles . each vehicle in the preferred embodiments has strong , impact resistant fiberglass fenders which protect the rider from track dirt and contact with the wheels or skis when riding . following is a general description of the many technical features and the advantages achieved by the presently disclosed invention . it is material provided to further enhance the level of disclosure and present all of the presently known advantages achieved because of the technical features of the invention . a . the gravity driven vehicle with skis or combination of skis and wheels or slide pan while much of the following description is presented as a description of a wheeled vehicle similar to the vehicle of the present invention as described above but which has been retrofitted or specially constructed to result in the vehicle for use on snow covered terrain . it is important to note that the vehicle basically as described above but modified for use on snow may be custom made rather than created from a wheeled version by means for retrofitting the wheeled version . all of the disclosure above is applicable to the disclosure of the ski version of the vehicle except of course that portion which relates to the specifics of the braking system and some aspects of the steering systems . the retrofit kit is used in conjunction with the gravity driven wheeled vehicle of the present invention or other like products to make the product easily adaptable for use in snow covered conditions . the details of the systems described below apply as a retrofit package or basically describe the components and the function when applied to a gravity driven vehicle custom designed and dedicated for use only on snow . i . e ., a wheeled vehicle may be retrofitted with the combination of skis or slide pans or custom designed and built in the same manner . fig1 - 13 and 16 illustrate the vehicle with skis in the front and wheels to the rear , skis both front and rear , and skis in front and a slide pan with braking to the rear respectively . it should further be noted that the use of skis and slide pan or slide pans is interchangeable in that they both provide the sliding surface upon which the vehicle rides when in descent on a snow covered surface . a slide pan or ski may be used in any combination in the front in the rear or both front and rear locations of the vehicle . a unique discovery during the course of the development efforts to create the winter or snow covered terrain version of the gravity driven vehicle occurred in the integration of the skis onto the existing single swing arm suspension design of the wheeled product . as a consequence of the advanced four wheel “ a ” arm air spring , oil damped suspension — independent four wheel suspension with air / oil shocks or with coil / oil shocks as illustrated in at least fig4 , and the multiple views of fig1 - 16 there achieved a smooth , stable ride over surfaces with irregularities ranging from wash board to large bumps . with the mounting of skiis to the a - arm or the wishbone portion of the suspension system , the position or attitude of the outer edge of all skis due to the single arm geometry when there is no rider on the sled and the shocks are operating properly , causes the outer edge of all skis to be constantly engaged with the ground or snow surface . when the sled is being ridden the loading of the shocks , depending on how they are set , causes the skis to change to a more flat or level attitude relative to the snow or to the ground surface . this attitude only reaches a substantially flat attitude if there is extreme loading on the sled body and does so to absorb shock to the sled and rider . after such levels of loading and impulse types of shocks to the sled , the sled always returns to the outer edge engagement posture . substantially because of this characteristic of ski attitude or the inward canting of the skis when the sled is being ridden , on a modest downhill terrain put in particular when travelling on steeper downhill and upon initiation of turns , the lower or downhill ski becomes more heavily loaded tending to increase the flatness orientation relative to the snow surface yet still resulting in the outer edge carving into the snow . i . e ., the outer edge of the ski carves into the snow and as it becomes increasingly loaded the suspension slightly counters the digging or carving action but continues to engage the snow surface . the upper ski or uphill ski , particularly the outer edge , with the lesser loading while in the turn it is still partially canted inwardly , carves as well and even more aggressively because of this canted attitude of the uphill ski in the turn . alternatively described , the uphill ski acts somewhat as an anchor as this engagement becomes more unloaded in an aggressive turn , the a - arm extends its full travel maintains constant engagement with the snow due to the fact the lower or downhill ski is flattening allowing the attitude of the uphill ski to remain in constant contact with the snow . this unexpected performance characteristic or functionality provides benefits such as for example : the carving action of both skis constantly counterbalancing each other provides tremendous control and maneuverability in virtually every snow condition ; and under conditions of heavy loading of the downhill ski , the digging and tipping tendency of the sled is reduced dramatically . to provide further control and maneuverability a keel component may be added to the ski bottoms . a . the front ski retrofit is attached to the existing front a - arm ( wishbone ) assembly of the wheeled version with either a double or the single arm / linkage geometry by utilizing the existing fastening system . when fixed to the suspension linkage the ski has the ability to pivot from an axis perpendicular to the axle allowing the tip and heal to pivot in opposition to one another , upwards and downwards and is limited in its pivot by a stop mechanisms mounted to either the ski or the mounting system . the width and length of the selected skis and the forward or rearward positioning of the pivot point is established based upon the terrain and the specific performance requirements desired . the steering geometry has been designed to create a carving action when the skis are turned by the steering linkage . i . e ., upon causing a turn using the steering mechanism both ski tips rise slightly , the tails sink slightly and the inner edge of the ski opposite of the direction of the turn and the outer edge of the ski in the direction of the turn tilt slightly downwards into the snow or ice surfaces . these edges can also be described as the ski edges on the inner radius of the turn . b . the independently or simultaneously actuated right and left , rear , front or rear and front , or independent rear and front combined brakes or single brake actuation unit whether one or divided mechanism is integrated in to the front ski and trailing or sliding pan or ski assemblies that are part of the vehicle / mountain sled retrofit package . the actuation of the mountain sled brake is either mechanical , hydraulic , servo - mechanical , pneumatic or a combination of these technologies . when this solution is used as a retrofit it is intended , whenever and wherever possible , that the existing actuation system or systems be utilized . c . the rear brake system or systems is / are integrated into an under body pan covering a portion or all of the sled under body from approximately the middle of the sled length and some distance forward of the rear axle location mounting surfaces and is attached or nearly meets the sled underside and extends sufficiently across the width of the sled in the front in a fixed or in a limited manner with a hinge or slide like interface allowing the pan from the hinge point rearwards to move up and down or to slide or flatten out across the under face of the sled a distance equal to the translated stroke distance of an internally mounted shock system . the pan will be a complete cover with a downward sloping straight or radiused lead edge , running from the mounted or hinged or meeting leading edge and transitioning to a gliding surface that runs almost parallel to the underside of the body or sled frame . the rear pan or ski assemblies will be covering a single or double shock absorption mechanism able to operate independent of or together with each other and the braking mechanism that will be substantially a swing arm or linearly actuated arm or blade that will when actuated protrude out from the pan or ski below their running surfaces and into the snow or ice surface at a positive , negative or right angle to the pan or running surface and will be depth adjustable equal to the geometry and stroke of the actuation . this pan or ski ( if chosen ) as seen from behind is profiled to provide maximum lateral grip and stability when either turning or gliding . the geometries are optimized to address snow condition and terrain . d . commercial : the winter retrofit package allows an owner of a summer mountain sled the simplified and flexible solution of utilizing at a minimum a sled body with an integral frame or a sled body with a separate frame . additionally , depending upon the components of the winter retrofit package , many more of the basic of summer mountain sled components can be used in retrofitting the summer sled for winter recreation such as the axle , suspension , steering and braking systems . e . technical : the retrofitted summer sled steering , braking , and rear tracking and control systems provide in the sled retrofitted for winter use all of the already known benefits of summer / wheeled sled including superior control and stability for a snow sledding experience . the condition of downhill ice packed or ice covered roadways , trails , paths , etc . presents a braking , steering and control challenge for both a conventional summer mountain sled and a winter mountain sled of any form or configuration . the operational challenge is to provide a sled with a steering and braking solution that handles these conditions . the following embodiment of the invention and declared benefits address this challenge . a mountain sled equipped with four wheel or three wheel independent or simultaneous braking systems will have its standard tires replaced with slick or profiled tires that have been retrofitted or produced to order with studs , nails , screws , etc . fixed to , inserted into or imbedded in the rolling surface of the tire and protruding from the rolling face of the tire sufficiently to provide contact and grip in the existing ice or ice packed condition on the running surface . the selection of each tire profile and cleat material , cleat geometry and cleat placement and number of cleats is dependent solely on the application surface and can be changed and optimized accordingly to best suit the exact requirements of each downhill surface . this solution has the distinct benefit of providing exceptional control on most every downhill ice covered or ice packed roadway , trail , path , etc . running surface . i . due to the fact that only the tires used for summer sport are replaced with tires having studs or nails ( or the like ) mounted to the tread portion of the tire to provide improved friction interface between the sled and the running surface . all other subsystems , steering , suspension and braking remain the same for the studded tire version as for the summer tire version . the resulting sled has substantially all of the performance advantages of the summer wheeled vehicle . the challenge of providing superior handling and control of a gravity driven mountain sled is to offer the best technology to achieve differing optimized operating results to meet the demands of the conditions and requirements of various terrains . the integration of certain solutions in a mountain sled with tires or with winter attachments such as in various presented solutions is primarily possible due to the combination of certain existing technologies , materials and compact componentry and by integrating them into various suspension geometries . the advent of small components coming from the mountain bike industry , has permitted mountain sledding to move from being basically unsophisticated toys to sophisticated sports equipment . integrated into the mountain sled is a suspension system that displays when viewed from the side ( from sled rear to front or front to rear ) a suspension geometry that is trapezoidal in form ( parallelogram ) with all four joints forming pivots and the two sled side , upper and lower fastening points / pivots are fixed in some manner firmly to the sled frame or uni - body or axle system or combination thereof and the spindle or the ski assembly or ski pan assembly is fixed somewhere on the fixed member connecting the outboard pivot points of the trapezoid . as part of this design and resisting loading of the trapezoidal design is an arm that extends at an angle away from one of the inboard trapezoid pivot locations and is an integral mechanical arm to which a shock absorber is attached to the end of arm and to a fixed point on the body , frame or axle system and both ends of the shock absorber can pivot . this geometry allows the upright mounting face for the spindle or ski or pan to move the spindle or ski or snow pan assembly upward and downward when the sled is pointed straight forward and when the sled itself has certain load exerted and released such that the tire , ski or pan maintains complete contact of its lower running surface with the operating surface , the running surface remains parallel with itself as it is loaded and unloaded . the longitudinal motion of the entire assembly is limited by the stroke of the shock absorber and the operating envelope of the related mechanics . this design permits minimal axial motion of the contact running surface as it is loaded and unloaded called scrubbing . this scrubbing action is considerably less than that witnessed by the solution already presented in the claim from tsi with a single arm solution . ii . maintaining constant and maximum contact of the entire running face of the tire , ski , and pan solutions with the running surface . iii . reduces scrubbing and non - uniform wear of the running surfaces of the tires , skis and pans . iv . simplifies steering geometry compound angles allowing maximization of ski contact and carving benefits . this system is highly recommended for applications utilizing skis and sliding pan systems . the body design and construction for the instant vehicle represents the latest form of taking the idea of monocoque or body integral frames and eliminating the need for conventional frames and separate bodies for use in mountain sled , sleds and sled product applications . this idea utilizes the fiberglass upper and lower body components known as or halves and sandwiches them together and imbeds inserts to add strength , to bond the halves , to stiffen the body and to take maximum advantage of the collective strength of each system . this solution accommodates and allows the fiberglass to be a connecting structure through the use of adhesives and epoxies that are part of the normal fiber - glassing process of dissimilar materials . this permits the combination of a variety of materials that would not otherwise be combined in a conventional fame / body construction . the imbedded materials then are optimized for their ability to retain fasteners , to choose material that accommodates extreme variations in temperature , adequately spread load across the fiberglass surface and eliminating extra material where it is unnecessary . i . provides singular body and frame system , simplifying assembly , inventory and repair . ii . makes maximum use of the strength and stiffness of each system . iii . allow adaptability and design modifications when new materials come available without requiring the whole design be changed . there are additional subsystems which may be incorporated into the gravity driven vehicle of each of the embodiments described such as for example : complete braking system i . e ., one system for the front and one for the rear which may use two ( 2 ) independent master cylinders and brake circuits . detail relative to the suspension system , the ski assembly and the braking system suspension geometry action and performance contribution to tracking and steering control : the existing , previously disclosed single a - arm suspension geometry provides the ability to present the outer edge of four skis , when mounted to a two opposing arm axle assemblies , to the snow at an angle to the running surface which delivers significant unique , maneuvering and steering control performance in most all snow conditions . this performance results from the fact that a carving geometry of the skis to the snow occurs . this engagement with the running surface is equally as consistent improves as the sled is underway and is caused to turn through the steering linkage . in a turn or as one is traversing a downhill slope the outboard or downhill ski receives increased load and the ski engages more with the snow / ice running surface until such time that the load on this ski begins to overcome the resisting force of the shock attached to the shock anchor point on the a - arm and the axle . as the resisting force ( ajustable ) is gradually overcome the a - arm begins to pivot at the a - arm pivot and ski assembly begins to move toward a flatter orientation with the snow . this action helps to avoid over powering the engagement of the downhill ski downhill edge and helping to avoid overturning . simultaneously , the uphill ski is less loaded but still has its outer edge engaged in the snow and creates a scrapping action on the adjacent downhill snow / ice as well as packing what ever loose snow is present under the underside of the ski . this uphill ski performance improves as the downhill ski continues to flatten in respect to the running surface and loading . additionally , the underside of any and all skis can be equipped with various geometry keels to assist in linear or turn tracking of all skis as they , under suspension applied compressive loads , present more ski surface and the keels to the running surface . there are always limits to this performance resulting from excessive speed and surface conditions , etc . the ski foot and post pivot allows any ski when traveling over uneven surfaces to follow the terrain contour more closely . the swing motion allowed by this feature is limited by the presence of bumpers mounted on the ski foot which contact ski post extensions when pivot travel limits are reached . this function delivers another benefit because of the ability to allow the ski to follow the terrain more closely that being it causes the brake mounted on the attached ski assembly to achieve more consistent contact with running surface . the brake assembly developed by the applicants provides superior braking action in various snow and ice conditions . the brake assembly has a hydraulic piston actuated lever equipped with a brake blade . this brake is actuated through the introduction of hydraulic pressure into the input port , the pressure causes the piston shaft to extend from the cylinder in the direction of the rear of the ski , the shaft is attached to the brake lever which begins to pivot at the brake lever pivot and rotates the lever with the attached blade toward the running surface until such point that the full stroke piston and the lever has been reached . the developed solution looked to achieve maximum force , with limited space by using a short stroke cylinder and applying multiple ratio motion at the brake tip . currently , the solution developed provides practically two inches of travel at the brake tip . the solution utilizes external extension springs to assist the brake return when no longer under hydraulic pressure . the solution is further supported by the presence of an expansion tank mounted to and on the non - pressure side of the brake actuation cylinder . the expansion cylinder is partially filled with the same fluid used to actuate the piston and then securely plugged . this expansion tank provides three benefits , closed system that does not allow air to enter the non - pressurized side of the system and contaminate the pressurized side of the system if air were to get by the piston seals , this non - pressurized side of the system could be used to introduce opposing pressure by filling it with more fluid and when compared with an open ended system where an air vent is present to relieve pressure this solution eliminates the likelihood of drawing contaminants such as water into the cylinder or by the piston seals into the pressurized fluid side of the system . the brake assembly developed by the applicants provides superior braking action in various snow and ice conditions . the brake assembly depicted in print number ( s ) ______ shows a hydraulic piston actuated lever equipped with a brake blade . this brake is actuated through the introduction of hydraulic pressure into the input port , the pressure causes the piston shaft to retract extend from the fully extended position away from the rear end of the ski , the shaft is attached to the brake lever which begins to pivot at the brake lever pivot and rotates the lever with the attached blade upwards away from and out of the running surface until such point that the full stroke piston and the lever has been fully retracted . the developed solution looked to achieve maximum force , with limited space by using a short stroke cylinder and applying multiple ratio motion at the brake tip . currently , the solution developed provides practically two inches of travel at the brake tip . the solution utilizes external extension springs to assist the brake return when no longer under hydraulic pressure . the solution is further supported by the presence of an expansion tank mounted to and on the non - pressure side of the brake actuation cylinder . the expansion cylinder is partially filled with the same fluid used to actuate the piston and then securely plugged . this expansion tank provides three benefits , closed system that does not allow air to enter the non - pressurized side of the system and contaminate the pressurized side of the system if air were to get by the piston seals , this non - pressurized side of the system could be used to introduce opposing pressure by filling it with more fluid and when compared with an open ended system where an air vent is present to relieve pressure this solution eliminates the likelihood of drawing contaminants such as water into the cylinder or by the piston seals into the pressurized fluid side of the system . the gap between the rear end of the ski and the brake blade is critical . the development of this ski brake determined that when braking , the disturbed running surface , snow , ice , etc . needs to find a place to release the braking loads and if this release location is readily available between the blade and the ski it will escape at that point , evidenced through the plume , rooster tail that gets larger the larger the gap and the higher the speed . conversely , when the gap is reduced to a minimum the loads , forces , energy is then captured under the ski and greatly increases brake drag and brake performance . while these additional subsystems are not being described in detail herein , it is certainly within the skill of the ordinary artisan in the field of mechanics and mechanical design to understand and implement many types of mechanisms or systems addressing the incorporation of any or all of the above subsystems into any one of the vehicles as described as the instant invention . it is thought that the present gravity driven steerable vehicle , for use in riding or racing primarily down hill over varied terrain , and many of its attendant advantages is understood from the foregoing description and it will be apparent that various changes may be made in the form , construction and arrangement of the parts thereof without departing from the spirit and scope of the invention or sacrificing all of its material advantages , the form hereinbefore described being merely a preferred or exemplary embodiment thereof . 14 a rider riding surface on said chassis top side 12 d configured to cause a rider to said ride riding surface 14 to be oriented in a prone , face down , face forward position ; 16 means for attaching a rear axle assembly 16 a substantially at said chassis rear portion 12 b ; 18 means for mounting a front axle assembly 18 a substantially at said chassis front portion 12 a ; 20 means for steering said gravity driven steerable wheeled vehicle 10 by said rider when said rider is positioned on said rider riding surface 14 ; 22 rear wheel hub and spindle assemblies integral with said rear axle assembly 16 a ; 24 front wheel hub and spindle assemblies integral with said front axle assembly 18 a . 26 braking system or means for causing deceleration and haulting of motion of said vehicle 10 when said vehicle has motion . 28 means for harnessing the rider onto and into said rider riding surface 14 when said rider is positioned on said vehicle 10 30 means for absorbing shock exerted on each said front wheels and tires 23 attached to each said two front wheel hub and spindle assemblies 24 thereby damping shock caused by said vehicle 10 passing over rough terrain , between said front wheels and tires 23 and said front axle assembly 18 a ; 32 means for absorbing shock exerted on each said rear wheels and tires 23 attached to each said two rear wheel hub and spindle assemblies 22 thereby damping shock caused by said vehicle 10 passing over rough terrain , between said rear wheels and tires 23 and said rear axle assembly 16 a ; 40 a a gravity driven steeable vehicle with two skis in front and two wheels in the rear

a gravity driven steerable vehicle having wheels , or skis or a combination of wheels and skis for recreational use , most particularly on surfaces such as pavement , artificial hard - pack turf , mountain slopes , dirt roads , grass and hard - packed or non - packed snow . the vehicle has at least three but preferably four wheels , or skis or a combination of wheels and skis which may or may not be on independent axles one from the other and which may or may not be each independently shock suspended . there is also a steering mechanism for steering the vehicle and a driver compartment portion for containing a driver of the vehicle in a prone face - down and face - forward position . the vehicle is steerable by the driver from the prone face - down and face - forward position . the mechanism for suspension of the wheels and / or skis is configured to provide precise control in turns especially the carving of turns , by the skis , while descending on snow covered terrain . the attitude of the skis relative to the snow surface changes upon initiation of a turn and while in the turn to increase the edgeing of the skis thereby enhancing the turning characteristics of the vehicle . the vehicle may further have a braking system for slowing or stopping the vehicle and a harness apparatus for harnessing the driver onto and into the vehicle .

referring now to the following detailed information , and to incorporated materials ; a detailed description of the invention , including specific embodiments , is presented . unless otherwise indicated , numbers expressing quantities of ingredients , constituents , reaction conditions and so forth used in the specification and claims are to be understood as being modified by the term “ about .” accordingly , unless indicated to the contrary , the numerical parameters set forth in the specification and attached claims are approximations that may vary depending upon the desired properties sought to be obtained by the subject matter presented herein . at the very least , and not as an attempt to limit the application of the doctrine of equivalents to the scope of the claims , each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques . notwithstanding that the numerical ranges and parameters setting forth the broad scope of the subject matter presented herein are approximations , the numerical values set forth in the specific examples are reported as precisely as possible . any numerical value , however , inherently contains certain errors necessarily resulting from the standard deviation found in their respective testing measurements . the present invention employs inverse wave techniques to reconstruct images of a medium surrounding a physical probe in a plane perpendicular to an axis of rotation in a radial reflection configuration , i . e ., in a multimonostatic or a multistatic arrangement disclosed infra , wherein one or more transmitting and receiving elements , more often at least about 15 of such elements , e . g ., transducer ( s ), are at a fixed radius and designed to collect scattered fields , e . g ., reflected and diffracted fields . such a radial reflection diffraction tomography ( rrdt ) technique is based upon a linearized scattering model to form images given the disclosed physical transmitter and receiver configurations and the mathematical method , i . e ., a hilbert - based wave algorithm , utilized to invert the scattering collected fields . as example embodiments , the multimonostatic and multistatic probes can be mounted at the end of a flexible substrate , such as a catheter or snaking tube that can be inserted into a part with an existing access hole or a medium ( e . g ., an artery ) with the purpose of forming images of the plane perpendicular to the axis of rotation . by applying the hilbert space inverse wave ( hsiw ) algorithm of the present invention to the collected data of such multimonostatic and multistatic probes , radial reflected diffraction tomographic images are readily obtained . fig1 ( a ) shows a basic multimonostatic conceptual arrangement of the present invention , wherein a single energy source element 1 , such as a transducer , can operate as both source and receiver ( as denoted by t / r , to indicate transmitter and receiver ) at multiple spatial locations . at each angular location along the illustrated dashed circumference , as denoted by the directional arrow , energy source element 1 can launch a primary field wave ( not shown ) and receive a reflected scattered field wave ( not shown ). such an arrangement often requires a spectrally wide band frequency diverse source capable of producing frequencies from about 1 khz to about 3 thz ( electromagnetic frequencies ), often from about 100 hz to about 10 ghz ( acoustic frequencies ), more often between about 20 mhz and about 60 mhz ( acoustic frequencies ), to provide spatial diversity so as to form images of a surrounding medium . fig1 ( b ) shows an example conceptual multistatic mode embodiment , wherein a plurality of fixed energy source elements 2 , e . g ., transducers , are arranged as an annular array , generally designated by the reference numeral 20 . in succession , along for example , the illustrated directional arrow , each energy source element ( for example , the element denoted by the letter t to indicate a transmitter ) is capable of launching a primary field wave ( not shown ) and a backscattered field wave ( not shown ) is measured on all the remaining elements ( as denoted by the letter r , indicating the remaining fixed elements are operating as receivers ). fig1 ( c ) illustrates a beneficial multistatic conceptual arrangement that includes a plurality of energy source elements 4 configured in a rotating sub - aperture 6 , as denoted by the bi - directional arrow , formed by a single transmitter , as denoted by the letter t to indicate a transmitter , and surrounded by multiple receivers , as denoted by the letter r . at each angular location , as denoted by the single directional arrow along the illustrated dashed circumference , transmitter t can launch a primary field ( not shown ) and a backscattered field ( not shown ) is measured on all receivers r . when operating in a reflection mode as disclosed herein , the mathematics applied to the collected data operate beneficially to image objects because the range resolution of the reconstructed image is proportional to the number of frequencies used in the reconstruction . under the hilbert space inverse wave algorithm , increasing the number of frequencies and transducers , increases the complexity of the reconstruction , the size of the intermediary data files , reconstruction time , and computer memory requirement . thus , the trade - off between computer resources and resolution is a consideration . nonetheless , the techniques employed in the present invention are beneficial even at acoustic frequencies from as low as about 100 hz to as high as about 10 ghz . such lower frequencies allow the disclosed embodiments to additionally be employed in borehole type of applications , such as , but not limited to , characterizing underground contamination plumes or waste in contamination barrels . for either the multimonostatic or multistatic example embodiments , the planar reconstruction of the imaged object ( s ) requires that the one or more collected measurements map a pair of spatial variables ( i . e ., angular location and incident source frequency ) of a physical object into the angular location and frequency parameters of the measured field . an exemplary application of the present invention is in the characterization of vulnerable atherosclerotic plaque . arthrosclerosis is a condition where the arteries are obstructed by the buildup of deposits , “ intravascular plaque ” ( ivp ), on the inside of arterial walls and such a buildup of deposits can lead to what is known to those of ordinary skill in the art as cerebrovascular disease , which is the third leading cause of death and the leading cause of major disability among adults . plaque grows as a fibrous tissue encapsulating a lipid pool and as the plaque grow it may incorporate calcium . of particular concern is vulnerable or unstable plaque because of the possibility of such plaque becoming inflamed and unexpectedly rupturing . stable or non - vulnerable plaque , typically includes a thick layer of fibrous tissue of about 800 microns but is not life threatening and can be treated slowly . a thin fibrous cap of typically up to about 300 microns covering a pool of a soft lipid core typically characterizes vulnerable plaque . when such a cap is disrupted , the thin cap is compromised and the lipid deposited into the artery can produce adverse effects , such as thrombus formation , strokes and death . fig2 shows a conventional catheter , generally designated as reference numeral 200 , for intravascular tissue characterization , such as atherosclerotic vulnerable plaque . such a catheter 200 , typically has an elongated flexible substrate 202 with an axially extending lumen 204 through which a guide wire 206 , and / or various other devices or other instruments can be delivered to a region of interest . an ultrasonic transducer assembly 208 is provided at the distal end 210 of the catheter , with a connector 214 located at the proximal end of the catheter for transducer manipulation and processing received transducer signals . transducer assembly 208 can comprise a plurality of transducer elements 216 arranged in a cylindrical array centered about a longitudinal axis 218 of the catheter for transmitting and receiving ultrasonic energy . adhesive ( not shown ) and or an end - cap ( not shown ) can be applied to transducer assembly 208 , and lumen 204 to protect such elements from the surrounding environment . transducer assembly &# 39 ; s 208 individual elements ( not shown ) and conductive acoustical backing ( not shown ) are often mounted on the inner wall of elongated flexible body 202 operating as the flexible substrate . fig3 a illustrates a typical ivus method using such a catheter 200 , as shown in fig2 a . in such a conventional application , catheter 200 , having a transducer assembly 208 that can launch an energy wave as a primary field ( as denoted by the letter f ) is inserted typically non - centered into a nominally circular diseased artery 302 . around a wall 304 of artery 302 is a fibrous collagen plaque 306 . a lipid pool 308 can reside inside such a fibrous structure , wherein when a fibrous cap 310 of plaque 306 separating lipid pool 302 from the blood ( not shown ) within artery 302 is more than about 800 μm thick , plaque 306 is characterized as stable . however , in cases where cap 310 is less than about 300 μm thick , such a plaque is characterized as vulnerable , and is more likely to rupture and / or thrombosis . the present invention utilizes the disclosed rrdt approach for improved intravascular applications such as characterizing plaque as discussed above , and incorporates various aspects of the method of utilizing a probe , such as , but not limited to , the catheter as shown in fig3 a . however , such catheters 200 and similar probes known to those of ordinary skill in the art typically show angular overlap for beam processing , which results in loss of valuable image information of one or more objects of interest within a surrounding medium . the present invention overcomes such processing by incorporating novel improvements of the transmitters and receivers , by utilizing frequencies between about 20 mhz ( acoustic ) and about 60 mhz ( acoustic ), and by utilizing rrdt techniques of the present invention as discussed herein . such novel embodiments accounts for phase , amplitude , and beam diffraction , to recover not only such loss of valuable image information information but to further enhance the imaging capabilities of the invention by providing images with improved lateral resolution of the acoustic absorption and sound speed . fig3 b shows the geometry incorporated by the rrdt method of the present invention . fig3 b shows a cross - sectional view of a catheter 200 , having an outer diameter between about 0 . 25 mm and about 5 mm , being inserted into an artery 302 , having a surrounding plaque 306 that includes a cap 310 and a lipid pool 308 . inserted into artery 302 is a non - centered catheter 200 , which includes a transducer assembly ( not shown ) that can be disposed about the distal end of catheter 200 , as disclosed in the present invention , with a radial location specified by r o ≡ r o ( cos θ o , sin θ o ), where r o is the catheter 200 probe radius , a constant . at each angular location , θ o , transducer assembly 208 , as shown in fig3 a , launches a primary field f radially outward ( as denoted by the letter r ) into a medium , such as the blood ( not shown ) and surrounding tissue in this example , and the transducer arrangement , as disclosed in the present invention , can measure a reflected scattered field ( not shown ) having , for example , at least up to about 90 degrees of angular content from one or more objects , such as the linings of cap 310 that overlies lipid pool 308 . as another example embodiment , the rrdt method and apparatus of the present invention can be combined with elastography to gain further insight into a surrounding medium &# 39 ; s elastic properties and provide further information in the determination of characterizing plaque as vulnerable or stable . generally , the contrast in elastic properties between a lipid pool and a fibrous cap is evident . by utilizing elastography , the elastic properties of a vessel wall can be obtained by observing a deformation of the vessel due to an external pressure , such as the pressure produced by a heart . such a change in the arterial pressure due to the pumping action of the heart produces a measurable deformation of the tissue surrounding the vessel . such a deformation can be measured by tracking a motion of patterns in successive intravascular scans as disclosed by the present invention . by knowing the arterial pressure and the measured deformation , the present invention can recover elastic properties of the surrounding tissue . from such elastic properties , one can further characterize the surrounding tissue to predict plaque composition . fig4 illustrates a further beneficial embodiment , wherein the present invention can be utilized for non - destructive characterization ( i . e ., rrdt imaging ) in applications other than for intravascular rrdt imaging . as shown by the example cross - sectional underground view of a borehole 404 in fig4 , a flexible substrate 400 or snake - like tube having a transducer assembly 402 similarly configured like the intravascular rrdt application discussed above , can be lowered into bore hole 404 so as to image a site using rrdt techniques . such an arrangement can launch a primary field ( denoted by the letter f ) and receive diffracted energy waves having frequencies often between about 100 hz and about 300 hz , to determine the state of buried wastes , such as waste within a radioactive waste drum barrel 410 or a biohazardous container , and / or to track a plume 412 of underground contaminants . in a similar manner , disclosed probes herein , can be inserted into waste drum barrels 410 , or weapons ( not shown ) or any part having an existing access hole , such as , but not limited to , an automobile engine , and determine the state of the part or material . hilbert spaces are spaces constructed using vectors . specifically they define vector spaces where sets of vectors in the space “ add up ” to another vector , an analog to euclidean space where measurements can be added to result in another valid measurement . hilbert spaces are particularly useful when studying the fourier expansion of a particular function . in the fourier transform , a complex function describing a waveform is re - expressed ( transformed ) into the sum of many simpler wave functions . a hilbert space describes the “ universe of possible solutions ” given one particular such function . the hilbert space inverse wave ( hsiw ) algorithm of the present invention enables an inverse for any multistatic or multimonostatic geometry with any combination of sources , receivers , and frequencies . in a radial reflection device of the present invention , such as an intravascular ultrasound probe having an outer diameter between about 0 . 25 mm and about 5 mm , or a probe configured to non - destructively characterize buried wastes ( e . g ., tracking plumes of underground contaminants of materials ), evaluating the state of materials residing in waste drum barrels or weapons , or to non - destructively evaluate parts with existing access holes ( e . g ., automobile parts ), acquired data are collected at discrete angular locations . such angular locations are denoted by : r n t ≡ r 0 ( cos θ n , sin θ n ) ( 1 ) for transmitter locations , where θ n = nδθ src for n = 0 , 1 . . . , n src − 1 , where n src 2π / δθ , and δθ src is the source angular increment . r m r ≡ r o ( cos θ m , sin θ m ) ( 2 ) where θ m = mδθ rcv for m = 0 , 1 . . . , n src − 1 , where n rcv 2π / δθ rcv , and δθ rcv is the receiver angular increment . for each source , configured receiver ( s ) can record a backscattered field as a time series that can be digitized for processing . discrete fourier transforming the time series data result in the spectrum of one or more measured wave forms at discrete frequencies . the forward scattering equation under the born approximation with both spatial and frequency diversity is given by : ψ b scat ( r m r , r n t , ω l )= p ( ω l ) k o 2 ( ω l )∫ dr ′ g ( r m r , r ′ , ω l ) o ( r ′ ) g ( r ′ , r n t , ω l ), ( 3 ) where ω l , l = 0 , 1 . . . , n f − 1 are the discrete frequencies and n f is the number of frequencies in the pulse band width . the hsiw as disclosed herein interprets equation ( 3 ) as a mapping from a continuous object space to a discrete measurement space . the object space is the physical ( x , y ) space of the object function . the measurement space includes discrete angles and temporal frequencies at which the scattered data are collected . the scattering operator projects the object onto the measurement space . the forward propagation or projection kernel is defined as : π *( r )≡ p ( ω l ) k o 2 ( ω l ) g ( r m r , r , ω l ) g ( r , r n t , ω l ), ( 4 ) where π ( r ) is a j ≡( n src × n rcv × n f ) element column vector , and p ( ω l ) is the incident pulse spectrum . mathematically , the projection is represented as an inner product between the object function and the kernel via : where d is a j element column vector , and where each element represents a particular source , receiver , and frequency combination . symbolically , the forward scattering operator , k , is defined as : the hsiw method of the present invention is employed to derive an inverse of the operator as shown in equation ( 6 ). the singular value decomposition ( svd ) of k is given as : where the columns of u form an orthonormal set of column vectors , u j , which span a measured data space , and the components of v form an orthonormal set of vectors , v j ( r ), which span an object space . s is a diagonal matrix of singular values , σ j . it is emphasized that the u j are complex column vectors where as the v j ( r ) are complex functions of r . the set of normal equations for such a singular system are : kk † u j = σ j kv j ( r )= σ j 2 u j , ( 10 ) k † kv j ( r )= σ j k † u j ( r )= σ j 2 v j ( r ), ( 11 ) the inversion method of the present invention estimates the object function of equation ( 5 ) given measured data in d . such an inversion incorporates expanding the object function in terms of v j ( r ): o ^ ⁡ ( r ) = ∑ j = 0 j - 1 ⁢ α j ⁢ v j ⁡ ( r ) , ( 12 ) where the α j are constant coefficients to be determined . substituting the object expansion into equation ( 5 ) results in : applying the definition of the k operator in equation ( 6 ) to equation ( 8 ) yields an expression for the integral of equation ( 13 ), kv j =∫ dr π *( r ) v j ( r )= σ j u j , ( 14 ) using the orthogonality of the u j vectors , the unknown α j is solved as follows : u i † ⁢ d = ∑ j = 0 j - 1 ⁢ α j ⁢ σ j ⁢ u i † ⁢ u j = ∑ j = 0 j - 1 ⁢ α j ⁢ σ j ⁢ δ ij = α i ⁢ σ i , ( 16 ) the adjoint of the forward scattering operator , k † and the singular values and singular vectors , σ j , u j , and v j ( r ) are now required . first , the following inner product equation defines the adjoint , using the definition of the forward scattering operator from equation ( 16 ) results in : u † ∫ dr π *( r ) v ( r )=∫ dr ( u † π *( r )) v ( r ), ( 19 ) by comparing the right hand sides of equations ( 18 ) and ( 19 ), the following definition of the adjoint of the forward scattering operator is obtained : the σ j and u j are determined by solving the eigenvalue equation of equation ( 10 ) formed by the outer product of the forward scattering operator with its adjoint . explicitly , the outer product is represented by : (∫ dr π *( r ) π t ( r )) u j = σ j 2 u j , ( 21 ) which is a j × j eigenvalue equation of the form ax = λx . the π ( r ) vectors are known analytically and can be evaluated numerically . it follows that the elements of the outer product matrix can be computed numerically and the resulting system solved numerically for the σ j 2 and u j . given these and using equation ( 19 ) to solve for v j ( r ) results in : substituting equations ( 17 ) and ( 22 ) into equation ( 12 ) yields the final expression for the reconstruction : as described above , the π ( r ) vectors of equation ( 4 ), and outer products and eigenvalues of equation ( 21 ) are computed numerically . the measurement system of the analytically described invention only measures part of the scattered field due to the aperture and the loss of the evanescent field information and accordingly , some of the eigenvalues , σ j 2 , are close to zero . those eigenvalues and their corresponding eigenvectors determine the rank of the outer product matrix , and they must not be used in the reconstruction of equation ( 23 ). thus , in the method of the present invention , a best rank n approximation is used to select the number of singular values / vectors . a ratio is computed as follows : r ⁡ ( n ) = ∑ j = 0 n - 1 ⁢ σ j 2 ∑ j = 0 j - 1 ⁢ σ j 2 , ( 24 ) where the singular values are assumedly arranged from smallest to largest : σ 0 2 ≦ σ 1 2 ≦ σ j − 1 2 . plotting r ( n ), the point at which the function starts to rise rapidly is graphically identified . the index of the singular value at which this occurs is labeled as j 0 . with this value determined , a final reconstruction is as follows : the hsiw as disclosed herein is flexible in that it allows any transducer configurations of the present invention and any number of frequencies to be used in forming such a final reconstruction . changes and modifications in the specifically described embodiments can be carried out without departing from the scope of the invention , which is intended to be limited only by the scope of the claims .

a wave - based tomographic imaging method and apparatus based upon one or more rotating radially outward oriented transmitting and receiving elements have been developed for non - destructive evaluation . at successive angular locations at a fixed radius , a predetermined transmitting element can launch a primary field and one or more predetermined receiving elements can collect the backscattered field in a “ pitch / catch ” operation . a hilbert space inverse wave algorithm can construct images of the received scattered energy waves using operating modes chosen for a particular application . applications include , improved intravascular imaging , bore hole tomography , and non - destructive evaluation of parts having existing access holes .

referring now in general to the drawings and in particular to fig1 - 3 , a chicken coop 10 is shown for transporting chickens from a poultry house to a processing plant . the chicken coop is formed of an assembly of cages 11 , here fifteen in number , arranged in rows and columns with three cages in a row and five cages in a column . the cages are integrally joined to form a rectangular enclosure having a roof 12 , five floors 13 , a front wall 14 , rear wall 15 and four side walls 16 . the side walls 16 and rear wall 15 are formed of an open framework to confine the chickens while providing ventilation . the two interior side walls 16 form a common wall for adjacent cages . a pair of spaced tubular , rectangular beams 17 are joined to the underside of bottom floor 13 to receive a fork lift to move the coop . each cage 11 of the coop has a frame opening 18 which collectively form the front wall 14 . each frame opening comprises a top frame member 19 , a bottom frame member 20 and two side frame members 21 . the frame members can be fabricated from lengths of square tubing common to multiple frame openings . referring now to fig3 a door 22 is pivotally mounted on the bottom frame member 20 to move from an open position shown in the top cage of fig3 to a closed position shown in the lower cage in fig3 . the pivotal mounting of door 22 includes a limiting pivot position where the door remains at rest in an open position with its inside surface substantially flush with the cage floor as shown in the top cage in fig3 . in its closed position shown in the bottom cage in fig3 the door is rotated until it engages a stop 23 where it remains until manually moved to an open position . a handle 24 is mounted on the outside surface of the door to facilitate manual opening and closing . the prior art shows numerous mechanisms for opening and closing a cage door . a simple hand latch is disclosed in u . s . pat . no . 4 , 285 , 299 mentioned above while an over center spring mechanism 25 is employed here to hold the door closed when it is manually lifted from its at rest open position . the mechanism for opening and closing the cage door is conventional and is not part of the disclosed invention . a vision obstructing flexible curtain 26 is mounted across the opening 18 forward of the door to obstruct the opening when the door is in its open position . applicant has discovered that when caged chickens cannot see an unobstructed escape path they will not attempt an escape . the curtain 26 in fig3 is in the form of a black sheet of plastic having a hem 27 . as seen in fig4 the curtain is hung from the inside of the top member 19 by means of a clamping strip 28 and a number of screws 29 . fig4 and 5 are part schematic views explaining the mode of operation of the vision obstructing curtain . fig4 is a view of the inside of the curtain as seen by chickens confined by the remaining five sides of the cage . the inventor has discovered that chickens will not attempt flight when an open escape path is not visible to them . in this manner , the invention solves the problem of chicken escape when door 22 is in the open position during the cage loading operation . as an optional feature , a wood dowel or steel pin 34 can be inserted in hem 27 for ballast . fig5 diagrammatically explains the operation of the curtain . fig5 also discloses an alternative mounting for the curtain . instead of a clamping strip and screws as shown in fig4 fig5 discloses a series of open hooks 30 spaced along top member 19 which supports the curtain on a matching series of grommets 31 . as seen in fig5 when door 22 is in the open position , chickens are pushed through the curtain , causing it to rotate in a counterclockwise direction as shown by the arrows 32 around pivots 30 , 31 . after the chickens are loaded , the curtain rotates back to its vertical rest position , darkening the opening . when the cage is full , door 22 is moved to a closed position . to unload all of the cages in a coop , a fork lift engages the rectangular beams 17 , and rotates the coop about a quarter turn in a counterclockwise direction . the weight of the birds sliding down the floors forces the doors to open and the curtains to swing to an open position as shown by the arrows 33 . after the chickens are unloaded , the coop is rotated back to a rest position and the doors are closed . fig6 shows a modified curtain construction which is suspended from top frame member 19 in a manner similar to fig4 . however , instead of a single layer curtain , two layers 34 and 35 are employed . the front layer 34 is split at cuts shown with a solid line while the rear layer 35 is split at cuts shown with a dashed line . this construction provides for greater flexibility while still obstructing the line of sight . fig7 shows a modified curtain suspended from top member 19 in the manner shown at 28 and 29 in fig4 or by means of hooks and grommets as shown in fig5 . the curtain 35 is formed of a closely woven fabric which allows for a certain degree of ventilation while obstructing the line of sight . it is not intended to limit the present invention to the details of illustration or terms of description of the preferred embodiments shown above . it will be appreciated by those skilled in the art that various modifications and alterations therein may be made within the scope of the present invention .

method and apparatus for loading a poultry coop . each compartment in the coop has a rectangular frame opening which is blocked or unblocked by a pivoted door . a flexible vision blocking curtain is hung across the opening to prevent the escape of any poultry during the loading procedure .

in the description of the present invention below the terms biological oil composition , copepod oil , copepod oil composition , oil composition are used interchangeable . epa and dha are predominant fatty acids present in marine fish , whale , seal and crustaceans . also , the oil present in the marine copepod calanus finmarchicus is a rich source of epa and dha , but this oil differs from other marine oils in a number of other chemical characteristics . compared to other marine oils , the copepod oil of the present invention is very rich in the c18 : 4n - 3 pufa ( stearidonic acid , sda ). unlike other common marine food oils , the pufas present in the copepod oil exist predominantly as monoesters with long chain monounsaturated alcohols i . e . wax esters . compared to other common dietary marine oils , the copepod oil of the present invention contains a relatively high proportion of free fatty acids , low amounts of triglycerides , and high levels of astaxanthin and cholesterol . based on the common understanding that epa and dha are the key factors responsible for the beneficial effects of marine oils in prevention and treatment of coronary artery disease , the biomedical effects of these two fatty acids have been compared with those of the copepod oil composition , as described in the present invention . the effects of the copepod oil according to the present invention have been compared with that of a concentrated epa / dha - preparation on atherosclerotic plaque formation and on total cholesterol level in mice , adjusted so that copepod oil provided the same total amount of epa and dha as the total amount of epa and dha in the reference preparation . in these studies , experimental animals ( apolipoprotein e ( apoe ) deficient mice ) feeding on an atherogenic high fat ( 21 % w / w ) diet containing 0 . 2 % ( w / w ) cholesterol were used . although there are differences in chemical composition between the copepod oil composition of the present invention and other dietary marine oils , the remarkable difference in biological activities , as described in the present invention , could not at all be predicted by anyone working on the effects of marine pufas on coronary heart disease . most striking is the highly unexpected finding that the biological oil composition of the present invention , as opposed to concentrated epa / dha , has a statistically significant ability to inhibit formation of atherosclerotic plaques . it also differs from epa and dha in the way it affects the pattern of lipid deposition in the body of the experimental animals . the copepod oil described in the present invention is in itself a novel anti - atherosclerotic composition . the biological oil composition according to the present invention also shows a significant effect on blood cholesterol level . total blood cholesterol levels are significantly lower in animals fed with a diet comprising the biological oil composition according to the present invention as compared with the levels in animals fed a diet comprising concentrated epa / dha the biological oil composition according to the present invention is derived from a marine copepod , preferably a copepod of the genus calanus , such as calanus finmarchicus , using freshly harvested , frozen / thawed or dehydrated raw material . oil compositions according to the invention may be obtained by any method known to the person skilled in the art such as , but not limited to , conventional fish oil production technology , biotechnological methods , organic solvents or supercritical fluid extraction , or cold pressing . independent of the procedure of obtaining the oil and the yield of oil , the typical gross composition will be as shown in table 1 . to illustrate the uniqueness of the biological oil composition according to the present invention , the corresponding compositions of conventional fish oil ( cod liver oil ) and krill oil are shown for comparison . it is evident from this gross chemical analysis that these oils are highly different , in particular regarding their contents of triglycerides , phospholipids , monoesters ( wax esters ), and of astaxanthin . it should be noted that wax esters constitute the major lipid component in the copepod oil of the present invention , unlike both cod liver oil and krill oil . besides the notable difference in gross chemical composition ( table 1 ), the three marine oils used here for illustration purposes , are highly different also in their content of individual fatty acids ( table 2 ). in the oil composition of the present invention , sda , epa and dha exist to a large extent as esters with long chain alcohols . a typical composition of wax esters and long chain alcohols in the copepod oil of the present invention is shown in table 3 . in conclusion , the copepod oil of the present invention differs markedly from typical fish oil and krill oil in both gross chemical composition and fatty acid content . however , like other marine oils it comprises epa and dha . in spite of its high wax - ester content , the oil composition of the present invention is a low - viscous and completely free - flowing liquid at room - temperature . one of the reasons for this is that the alcohols of the wax esters are predominated by medium - length monounsaturated alcohols , typically 80 % or more ( mainly c20 : 1 and c22 : 1 ). depending on the analytical methods used , the typical content of wax - ester of the oil composition of the present invention is 70 - 90 %, whereas it contains 10 - 20 % of other components such as free fatty acids , triacylglycerols , sterols and pigments . in certain applications , it may be advantageous or even desirable to remove free fatty acids and other components by suitable methods known to those skilled in the art . thus , in one embodiment of the preset invention the oil composition may contain up to 100 % wax ester . it has been found that the copepod oil according to the present invention has markedly different biological effects than a concentrated preparation of epa and dha used in the same concentration as in the copepod oil . particularly the composition according to the present invention prevents the formation of atherosclerotic plaque and thus is useful in the prevention and treatment of cardiovascular disease . the composition according to the present invention is also found to have an effect on the total blood cholesterol level and is useful in the prevention and treatment of hypercholesterolaemia and elevated blood cholesterol levels . the biological oil composition according to the present invention comprises from 20 %, 25 %, 30 %, 35 %, 40 %, 45 %, 50 %, 55 %, 60 %, 65 %, 70 %, by weight up to 75 %, 80 %, 85 %, 86 %, 87 %, 88 %, 89 % 90 %, 91 %, 92 %, 93 %, 94 %, 95 %, 96 %, 97 %, 98 %, 99 %, 100 % by weight of wax esters . preferably the biological oil composition comprises from 80 %, 81 %, 82 %, 83 %, 84 %, 85 %, 86 %, 87 % 88 %, 89 % by weight up to 90 %, 91 %, 92 %, 93 %, 94 %, 95 %, 96 %, 97 %, 98 %, 99 %, 99 . 5 %, 100 % by weight of wax esters . further the biological oil composition of the present invention comprises from 5 %, 6 %, 7 %, 8 %, 9 %, 10 % by weight up to 11 %, 12 %, 13 %, 14 %, 15 %, 16 %, 17 %, 18 %, 19 %, 20 % by weight of sda . the content of epa in the biological oil composition may be 3 %, 4 %, 5 %, 6 %, 7 %, by weight up to 8 %, 9 %, 10 %, 11 %, 12 %, 13 %, 14 %, 15 % by weight . the composition may comprise 2 %, 3 %, 4 %, 5 % by weight up to 6 %, 7 %, 8 %, 9 %, 10 % by weight of dha . in one embodiment , the present invention provides a biological oil composition wherein the composition comprises 20 - 100 % by weight of wax esters , preferably 50 - 100 % by weight of wax esters , more preferred 70 - 100 % by weight of wax esters for use as a medicament for the prevention and treatment of cardiovascular disease . the oil composition may be isolated from a marine copepod , preferably one of the genus calanus , and more preferably said copepod is of the species calanus finmarchicus . in other embodiments of the invention the present invention provides a biological oil composition for the use as a medicament in the prevention and treatment of atherosclerosis , hypercholesterolaemia and elevated blood cholesterol levels . in another embodiment the present invention provides an oil composition that further comprises 5 - 20 % by weight of sda . in yet another embodiment the present invention provides an oil composition comprising 3 - 15 % by weight of epa and 2 - 10 % by weight of dha . in a further embodiment of the present invention an oil composition comprising 20 - 100 % by weight of wax esters , preferably 70 - 100 % by weight of wax esters , 5 - 20 % by weight of sda , 3 - 15 % by weight of epa and 2 - 10 % by weight of dha is provided . in another embodiment of the present invention an oil composition comprising fatty alcohols and sda , dha and epa as monoester with fatty alcohols is provided . in a further embodiment the present invention provides an oil composition comprising 1000 - 4000 ppm of astaxanthin , mainly in esterified form . a dietary supplement formulation comprising an oil composition as described above is also provided by the present invention . a functional food formulation comprising an oil composition as described above is also encompassed by the present invention . in yet another embodiment of the present invention a pharmaceutical formulation comprising an oil composition as described above is provided . the formulation according to the invention comprising an oil composition as described above may be provided in capsules , tablets , emulsions or tonics and may comprise one or more pharmaceutically acceptable additive selected from the group consisting of adjuvans , antioxidants , emulsifiers , surfactants and carriers . the present invention further provides the use of an oil composition as described above for the manufacturing of a product for the prevention or treatment of a cardiovascular disease , particularly atherosclerosis , hypercholesterolaemia and elevated blood cholesterol levels . the present invention also provides a method for the prophylaxis or treatment of cardiovascular disease , particularly atherosclerosis , hypercholesterolaemia and elevated blood cholesterol levels wherein the individual in need of such prophylactic or curative treatment is orally administered with a pharmaceutical composition comprising a biological oil composition wherein the composition comprises 20 - 100 % by weight of wax esters , preferably 50 - 100 % by weight of wax esters , more preferred 70 - 100 % by weight of wax esters , and wherein a daily dosage level in the range of 4 - 100 mg / kg body weight . in another embodiment the present invention provides a method wherein the administered pharmaceutical composition further comprises 5 - 20 % by weight of sda . in yet another embodiment the present invention provides a method wherein the pharmaceutical composition comprising 3 - 15 % by weight of epa and 2 - 10 % by weight of dha . in a further embodiment of the present invention a method wherein the administered pharmaceutical composition comprises 20 - 100 % by weight of wax esters , preferably 70 - 100 % by weight of wax esters , 5 - 20 % by weight of sda , 3 - 15 % by weight of epa and 2 - 10 % by weight of dha is provided . in another embodiment of the present invention a method wherein the administered pharmaceutical composition comprising fatty alcohols and sda , dha and epa as monoester with fatty alcohols is provided . in a further embodiment the present invention provides a method wherein the administered pharmaceutical composition comprises 1000 - 4000 ppm of astaxanthin , mainly in esterified form . the following non - limiting experimental part and examples illustrate and document the present invention . when studying the preventive efficacy of any drug candidate or dietary ingredient on coronary heart disease , the most reliable end - point analyses are the actual disease manifestations , such as , for instance , formation of atherosclerotic plaques . effects on blood parameters considered to be indicative of the risk of disease development are of course important for evaluation of mode of action of new anti - atherogenic drug candidates , but it is preferable to relate such blood analyses to efficacy data on the disease manifestation itself . this has been the philosophy in the studies constituting the foundation of the present invention . the biological effects of the copepod oil of this invention were recorded in mice deficient in apolipoprotein e ( apoe ). mice of this strain are routinely used to determine effects of dietary components on development of vascular inflammation and atherosclerotic plaques , since they develop atherosclerotic lesions according to a pattern very similar to that of humans , and they are useful model animals for studies of biochemical and cellular processes involved in initiation , progression and regression of atherotrombotic disease . the studies were carried out at the faculty of medicine at the university of tromsø ( norway ). three groups of ten female mice were installed at an age of 7 weeks and fed 3 different diet treatments ( see below ) for 13 weeks . the mice were fed ad libitum with an experimental high fat ( 21 % w / w ) and cholesterol ( 0 . 2 % w / w ) diet , rich in bioavailable carbohydrates ( sugar / dextrin ) and with a high proportion of saturated fat ( sniff spezialdiaten gmbh , sniff ef clinton / cybulsky ( ii ) mod .). the composition of this diet promotes development of obesity and of atherosclerotic lesions . the diet was added either 1 % ( w / w ) of the copepod oil of the present invention ( diet 1 ) or 0 . 1223 % ( w / w ) of an epa / dha - concentrate ( diet 2 ), producing two experimental feeds with equal contents of epa and dha . the cholesterol content of these two diets and of the control diet ( diet 3 ) without added oil was adjusted to 0 . 20 % by adding cholesterol , taking into account the cholesterol present in the feed ingredients and in the copepod - oil itself . the composition of the experimental diets is shown in table 4 . the copepod oil preparation was an experimental product provided by calanus as , tromsø , norway ( www . calanus . no ). the epa / dha concentrate used as reference test substance was the lipid lowering drug omacor ( pronova biopharma asa , p . o . box 420 , no - 1327 lysaker , norway ). according to the manufacturer ( www . pronova . com ) this product contains 90 % omega - 3 - acid ethyl esters of epa ( 460 mg / g ) and dha ( 380 mg / g ) and is manufactured using fish oil as a starting material . the experimental mice were monitored daily , and weighed at regular intervals . samples of blood serum were taken at different points for later analysis of various blood parameters including lipids and fatty acids . the mice were sacrificed at the end of the experiment , and all relevant organs were dissected out following standard procedures . following dissection of the sacrificed mice , the aortas were isolated , cleaned and cut open longitudinally , pinned to a white cardboard and fixed in 10 % formalin for at least 24 hours . the aortas were stained with oil red o ( sigma ) before analysis . after rinsing , the aortas were mounted on microscopic slides , and images ( 2 , 700 dpi ) were acquired using a sprintscan 35 scanner ( polaroid , cambridge , mass ., usa ) equipped with geoscan enabler ( meyer instruments , houston , tex ., usa ). the images were analyzed for positive areas , adopting the state - of - the art calibration and image analyses methodology . the total lesion area was quantified in each group by computer - assisted quantitative morphometry as described by n . v . guevara et al . ( the absence of p53 accelerates atherosclerosis by increasing cell proliferation in vivo . nature medicine 1999 ; 5 : 335 - 339 ). it has been found that the copepod oil of the present invention has markedly different biological effects than a concentrated preparation of epa and dha used in the same concentration as in the copepod oil . this was a highly unexpected finding , considering the overwhelming consensus among the skilled in the art , that the positive health effects of marine oils are associated with their content of epa and dha , exclusively . the results are shown in table 5 and in fig1 - 3 . the effect of the copepod oil of the present invention and of epa / dha - concentrate on atherosclerotic plaque formation in the aortas of female mice is shown in table 5 . the copepod oil preparation had a striking and statistically highly significant effect on reduction of plaque formation both in the aortic arch ( p = 0 . 002 ) and the total aorta ( p = 0 . 001 ) compared to control . also the epa / dha - concentrate reduced plaque formation compared to control , but the effect did not meet the requirements of statistical significance . 1 the figures represent the average lesion area in percent of total area of each target region at time of sacrifice . see fig1 for the subdivision of target regions ( a - d ) of the aorta . growth of the mice is shown in fig2 . although the mice grew fastest on feed enriched with copepod oil , and thrived well on that diet , this apparent difference does not meet the requirements for statistical significance . there was no difference between the groups in feed intake and no negative effects could be observed on animals fed the experimental diets . weight of different organs is shown in fig3 . although there was a higher level of fat deposited in the white adipose tissue ( wat ) in mice fed the copepod oil , the difference was not statistically significant . however , it is a noteworthy observation indeed that the copepod oil of the present invention reduces plaque formation while more lipids are deposited in lipid storage tissues . the copepod oil has a notably more pronounced anti - atherosclerotic effect than purified epa and dha at same concentration as in this oil . the mechanisms involved in this effect of the copepod oil may accordingly be additive to the epa - and dha - effects or be entirely different . the results shown in table 6 illustrate that calanus oil differs from epa and dha also regarding the effect on blood cholesterol level in the experimental animals . whereas the cholesterol level in blood of animals fed the epa / dha - diet was the same as in control animals after 13 weeks of feeding , the cholesterol level in blood of the calanus oil group was notably lower . both treatment groups seem to have a slight , and similar , triglyceride lowering effect compared to control .

this invention relates to a biological oil composition , preferably obtained from a copepod , most preferably the copepod calanus finmarchicus and the use thereof to prevent or treat formation of atherosclerotic plaques and hence development of coronary heart disease . the composition comprises the same marine n - 3 polyunsaturated fatty acids generally regarded as being responsible for the anti - atherosclerotic effect of marine oils , namely epa and dha . however , quite unexpectedly , it has been found that the oil composition of the present invention has a remarkably higher ability to prevent formation of atherosclerotic plaques than what can be attributed to epa and dha alone , and moreover , unlike epa and dha alone it has a notable blood cholesterol lowering effect .

the partners employed for the complex formation are preferably biocompatible , biodegradable polyacids and polybases which are naturally occurring or composed of natural subunits . in this case , &# 34 ; poly &# 34 ; means that the compound carries more than one charge of the same polarity , preferably a large number of such charges . the particular counterions can be composed either of low molecular weight ions or likewise of a polyionic species . either one or both ionic partners can be either inorganic or organic in nature . in the case of organic polyions , hydrophobic substituted derivatives prove suitable and preferable . preferred materials for the preparation of biocompatible polyelectrolyte complex / active substance combinations are , as polyacids : xylan polysulfate , partially hydrophobically esterified xylan polysulfate , polysulfates of other polysaccharides such as , for example , starch hydrolysates , inulin , hydroxyethylstarch , dextrans and the partially hydrophobically substituted derivatives thereof in each case , and poly ( amino acids ) such as polyaspartic acid or polyglutamic acid and the hydrophobically substituted derivatives thereof in each case . as polybases : poly - l - lysine of various defined molecular weight ranges , poly - α , β -( 2 - dimethylaminoethyl )- d , l - aspartamide ( pdaa ), copolymers of pdaa and hydrophobically esterified poly - α , β -( 2 - hydroxyethyl )- d , l - aspartamide ( phea ), chitosan , lysine octadecyl ester , aminated dextrans , aminated cyolodextrins , aminated cellulose ethers , aminated pectins and the partially hydrophobically substituted derivatives thereof in each case . in one preferred embodiment , the polyelectrolyte complex contains a polyacid which is selected from : xylan polysulfates , dextran sulfates , poly ( amino acids ) such as polyaspartic acid or polyglutamic acid , polysaccharide polysulfates such as sulfates of starch hydrolysates , inulin , hydroxyethylstarches , polysaccharide polysulfonates , polysaccharide polyphosphates , polyphosphates , and , more preferably , the polyelectrolyte complex contains a polyacid which is selected from : in each case partially hydrophobized ( for example etherified , esterified ) derivatives of xylan polysulfate , polysulfates of other polysaccharides such as , for example , starch hydrolysates , inulin , hydroxyethylstarches , dextrans ; of poly ( amino acids ) such as polyaspartic acid or polyglutamic acid , and of polysaccharide polysulfonates , polysaccharide polyphosphonates , polyphosphates . in another preferred embodiment , the polyelectrolyte complex contains a polybase which is selected from : poly - l - lysine , poly - α , β -( 2 - dimethylaminoethyl )- d , l - aspartamide , chitosan , lysine octadecyl ester , aminated dextrans , aminated cyclodextrine , aminated cellulose ethers , aminated pectins , and , more preferably , the polyelectrolyte complex contains a polybase which is selected from : in each case ( for example by partial or complete esterification and / or etherification ) hydrophobized derivates of : poly - l - lysine of various molecular weight ranges , poly - α , β -( 2 - dimethylaminoethyl )- d , l - aspartamide , chitosan , aminated dextrans , aminated cyclodextrins , aminated cellulose ethers , aminated pectins and copolymers of poly - α , β -( 2 - dimethylaminoethyl )- d , l - aspartamide and hydrophobically esterified poly - α , β -( 2 - hydroxyethyl )- d , l - aspartamide . microparticles composed of polyelectrolyte complexes can , depending on the requirements , be prepared in average particle sizes from a few nm up to a few hundred μm . it is also possible by definition for the microparticles to be in the form of emulsions . the breadth of the size distribution can be adjusted , for example by the stirring speed on mixing the polyelectrolytes , the drop rate , the nozzle diameter , the ph and by suitable choice of the polyelectrolyte partners . it is particularly advantageous to carry out the formation of the complexes with addition of auxiliaries such as amphiphilic molecules ( for example ® pluronic ) or colloidal substances ( for example adjuvants ) with high incorporation capacity . these parameters can be determined in simple routine tests and adjusted to the required particle size and particle size distribution . particles below 5 μm in diameter are suitable for intravenous injection . particles with a diameter & lt ; 15 μm , preferably & lt ; 10 μm can be employed as s . c . or i . m . injectable depot forms and as a vehicle to increase the enteral absorption . the incorporation of an active substance in the polyelectrolyte complex particles / colloids can be carried out in at least 4 ways : a ) incorporation by &# 34 ; entrapment &# 34 ; of the active substance , which is present in solution , on precipitation of the complex , b ) incorporation by absorption of the active substance from a solution with which the already prepared polyelectrolyte complexes come into contact ( especially in the case of porous materials or gels with &# 34 ; sponge &# 34 ; properties ), c ) precipitation of the polyelectrolyte complex , in which case the active substance is chemically bound to at least one complex partner and , d ) incorporation by employing the active substance as partner in the formation of the polyelectrolyte complex . this usually requires at least one charge or polarizable group on the active substance . the invention therefore also relates to a process for preparing pharmaceutical compositions containing polyelectrolyte complexes and active substances , where a solution of an acidic and a solution of a basic substance , where at least one of these substances must be polymeric , are mixed and where a ) either one of the partners is an active substance or contains the latter in chemically bound form , or b ) the active substance is contained in one of the solutions , and subsequently the resulting polyelectrolyte complex is precipitated in microparticulate form or , where appropriate , converted into a microparticulate form . polyelectrolyte complex / active substance formulations show , because the consistency properties can be widely varied on the one hand and can be very specifically adjusted on the other hand , property profiles as required for diverse pharmaceutical applications . thus , it has emerged that the cytostatic daunorubicin and the polyacid xylan polysulfate produce macroparticles which contain daunorubicin and release the latter in buffer solution or in biological systems uniformly over a lengthy period , during which they are broken down . if polybases are also added and / or the polyacid is changed , especially by replacing xylan polysulfate by xylan polysulfate which is partially substituted with palmitoyl ester groups , it is possible to reduce the particle size to & lt ;& lt ; 5 μm and the result is an i . v . injectable system with the release properties described above . the therapeutic index of the cytostatic can be drastically increased with a slow - release form of this type . the activity properties of other low molecular weight active substances such as antibiotics ( for example tetracycline ) or other cytostatics can also be distinctly improved in this way . if proteins are incorporated in polyelectrolyte complex microparticles , it is possible in this way both to protect them from hydrolytic attack and to achieve controlled release profiles . thus , for example , vaccine preparations can be produced using vital proteins or similar substances suitable for vaccination and can , depending on the particle size , be injected i . m . or even administered orally , in which case there is absorption in the gastrointestinal tract of particles & lt ; 5 μm , and subsequent antigen expression / immunization occurs . it is possible , with such antigen - containing polyelectrolyte complexes according to the invention , to achieve release profiles which allow a large dose of the vaccine to be delivered shortly after administration and after a period of , for example , 4 weeks ( booster ). the substances particularly suitable for forming polyelectrolyte complexes in this case are described in example 3 . it is also possible to convert peptide - based active substances by means of polyelectrolyte complex preparations into suitable long - term systems . these formulations are in some cases superior to the known polymeric depot systems for lhrh analogs , for example , both because the degradability is better and because the release profiles are defined . polyelectrolyte complexes are likewise suitable for preparing wound ointment preparations which contain , for example , antibiotics or proteins as regeneration promoters . the polyelectrolyte complex microparticles according to the invention are also outstandingly suitable as air - containing echogenic contrast agents for ultrasonic diagnosis . polyelectrolyte complex particles composed of hydrophobically esterified dextran sulfate and of a copolymer of pdaa and hydrophobically esterified phea ( for abbreviations , see page 4 ) have proven particularly suitable for ultrasonic diagnosis . the invention is explained in more detail hereinafter by means of examples . the particle size has been determined by microscopic methods or by filtration through filters of defined pore size and , in some cases , by coulter counter ( from coulter electronics ) or flow cytometer . a 0 . 1 % aqueous solution of each of xylan polysulfate sodium salt ( from bene - chemie ) and of poly - l - lysine of average molecular weight 3800 ( from sigma ) is made up . sufficient hcl is added to the poly - l - lysine solution for the ph to be 3 . the xylan polysulfate solution is likewise adjusted to ph 3 ( hcl ) and added dropwise via a metering pipette . the polyelectrolyte complex precipitates and is separated off by centrifugation and membrane filtration . after washing with h 2 o , the microparticulate product can be freeze - dried . the particle size can be controlled by the vessel size , the stirring speed , the diameter of the dropwise addition nozzle and the dropping rate and can be adjusted from the region around 20 nm to 100 μm . complex of palmitoylxylan polysulfate with 20 % palmitic acid residues and chitosan 0 . 1 % solutions are prepared as in example 1 . the procedure corresponds to that employed in example 1 , only that no ph control is carried out in this case , and polylysine is replaced by chitosan ( from protan ). the palmitoylxylan polysulfate can be prepared , for example , by the process described in german patent application p 3921761 . 2 . chitosan 143 is used . the resulting particles are large agglomerates ( 100 μm and larger ) and can be reduced to a size of 1 - 4 μm by grinding in a mortar . polyelectrolyte complex particles composed of palmitoylxylan polysulfate with 20 % palmitic acid and chitosan with incorporation of human serum albumin as model protein for vaccines . the procedure is carried out as described in example 2 , only that 0 . 2 % human serum albumin ( from sigma ), dissolved in water , is added to the palmitoylxylan polysulfate solution before the dropwise addition . particles in the range 2 - 5 μm can be obtained after grinding . see example 10 for the determination of the albumin release . particles in the & lt ; 5 μm range can be obtained with two different preparations : 50 mg of polyacid are dissolved in 5 ml of a 0 . 1 % strength solution of rabies vaccine from behringwerke ( the solution is aqueous and contains 40 % sucrose ), the ph is 6 . 3 . 50 mg of polybase are added to 5 ml of a 0 . 5 % strength solution of ® pluronic f68 in water . the polyacid / vaccine solution is added dropwise to the stirred polybase solution ( which has ph 5 . 8 ). after centrifugation ( 10 min , 2000 rpm ), the clear supernatant is separated off , and the residue is made into a paste with h 2 o and freeze - dried . yield 779 . 7 mg of particles . the amount of the employed vaccine incorporated can be found by resuspension and analysis of the supernatant ( in h 2 o ) to be 90 %. once again , two solutions are made up , each containing 50 mg of polyacid / base . the polyacid solution is identical to that in i . the polybase solution is identical to that in i except that it contains no ® pluronic . both solutions are adjusted to ph 7 and , as in i , centrifuged and the residue is made into a paste and freeze - dried . the incorporation efficiency corresponds to that in i . yield : 76 . 5 mg . vaccination of mice against human serum albumin with polyelectrolyte complex microparticles sample i : xylan sulfate esterified with about 15 % palmitic acid / lysine octadecyl ester + 7 % pluronic ® 68 , 5 - 30 μm sample ii : xylan sulfate esterified with about 15 % palmitic acid / lysine octadecyl ester , ≦ 10 μm sample iii : xylan sulfate esterified with about 15 % palmitic acid / poly - l - lysine 4 kda + 7 % pluronic ® f68 , 2 - 50 μm all the samples contained about 7 % by weight human serum albumin ( behringwerke ). these complexes were resuspended in concentrations of 66 . 67 μg / ml , 6 . 67 μg / ml and 0 . 67 μg / ml in pbs ( phosphate - buffered saline ). 0 . 3 ml of each vaccine was administered s . c . to , in each case , 10 nmri mice weighing about 20 g . 14 weeks after the vaccination , the experimental animals were revaccinated with the same dose . the antibodies directed against human serum albumin in the serum of the experimental animals were quantified in an elisa . used as comparison was aluminum hydroxide al ( oh ) 3 which is known as a good adjuvant and is contained in various vaccines . elisa titer after inoculation with 6 . 67 μg of formulation / ml ( average dose ), 2 , 4 , 8 , 14 ( revaccination ), 16 and 21 weeks after the first vaccination : ______________________________________sample day 0 day 2 day 4 day 8 day 14______________________________________i & lt ; 1 : 300 & lt ; 1 : 300 1 : 300 1 : 900 1 : 900ii & lt ; 1 : 300 & lt ; 1 : 300 1 : 300 & lt ; 1 : 300 & lt ; 1 : 300iii & lt ; 1 : 300 1 : 300 1 : 900 1 : 2700 1 : 8100iv & lt ; 1 : 300 & lt ; 1 : 300 & lt ; 1 : 300 1 : 2700 1 : 8100v & lt ; 1 : 300 1 : 900 1 : 2700 1 : 8100 1 : 24300al ( oh ). sub . 3 & lt ; 1 : 300 1 : 900 1 : 900 1 : 900 1 : 900______________________________________sample day 16 day 21______________________________________i 1 : 72900 1 : 72900ii 1 : 24300 1 : 24300iii 1 : 72900 1 : 24300iv 1 : 72900 1 : 72900v 1 : 72900 1 : 72900al ( oh ). sub . 3 1 : 8100 1 : 24300______________________________________ administration of the same vaccine to guinea pigs likewise resulted in distinct seroconversion . polyelectrolyte complex particles composed of polyaspartic acid and poly - α , β -( 2 - dimethylaminoethyl )- d , l - aspartamide ( pdaa ) with incorporation of tetracycline as example of a low molecular weight active substance . the procedure is as described in example 3 , except that a 0 . 2 % solution of tetracycline in water is employed in place of human serum albumin . see example 11 for the tetracyctine release . 10 mg of xylan polysulfate are dissolved in 0 . 5 ml of h 2 o . 100 μl of a 10 % daunorubicin solution ( daunorubicin from sigma ) are diluted to 0 . 4 ml with water . the daunorubicin solution is added dropwise to the xylan polysulfate solution . the resulting suspension contains particles whose diameter is in the 5 μm range . see example 12 for the daunorubicin release . polyelectrolyte complex particles composed of palmitoylxylan polysulfate with 20 % palmitic acid , daunorubicin and lysine octadecyl ester . 1 ml of a solution which contains 1 % each of daunorubicin and lysine octadecyl ester is adjusted to ph 4 . a 1 % solution of palmitoylxylan polysulfate , likewise 1 ml , likewise adjusted to ph 4 , is added dropwise . the resulting suspension can no longer be fractionated by filtration . the particles can be adjusted by altering the concentration , the stirring speed , the dropping rate and the nozzle diameter in the range from 100 nm to 1 μm ( see table 1 ). table 1______________________________________particle concen - stirring dropping nozzlesize tration speed rate diameter______________________________________ 1 μm 0 . 1 % 300 min . sup .- 1 100 min . sup .- 1 0 . 5 mm 10 μm 0 . 5 % 300 min . sup .- 1 100 min . sup .- 1 0 . 5 mm 20 μm 1 % 300 min . sup .- 1 100 min . sup .- 1 0 . 5 mm100 nm 0 . 1 % 1000 min . sup .- 1 100 min . sup .- 1 0 . 5 mm 20 nm 0 . 1 % 1000 min . sup .- 1 100 min . sup .- 1 0 . 2 mm 80 μm 1 % 100 min . sup .- 1 100 min . sup .- 1 0 . 5 mm100 μm 1 % 100 min . sup .- 1 200 min . sup .- 1 0 . 5 mm______________________________________ in each case a 1 % strength aqueous solution at ph 7 is made up from dextran sulfate ( m = 6000 ) in which about 20 % of the dextran oh groups have been esterified with caproic acid and the remaining oh groups have been sulfated (&# 34 ; hydrophobically esterified dextran sulfate &# 34 ;, &# 34 ; polyacid &# 34 ;) and from a copolymer of poly - α , β -( 2 - dimethylaminoethyl )- d , n - aspartamide ( 60 %) and poly - α , β -( 2 - palmitoyloxyethyl )- d , l - aspartamide ( 40 %) (&# 34 ; polybase &# 34 ;). the polyacid solution is added dropwise to the polybase solution and stirred at room temperature for 10 minutes , the complex is removed by centrifugation , the solution is decanted off , and the solid is made into a paste with and freeze - dried . freeze - dried and resuspended microparticles with a size of the order of 1 - 3 μm are investigated in a phantom which represents a model of the heart and extremely small capillary vessels ( lung model ) for the ultrasonic contrast brought about by incorporated air . the particles pass through the capillaries unhindered . a microparticle suspension in phosphate buffer is shaken continuously . after 1 , 4 , 7 , 13 , 21 add 28 days , the supernatant is removed and then the albumin content is determined by electrophoresis known from the literature . the result is a profile with 2 release maxima as is required for various vaccines : ______________________________________release on day 1 4 7 13 21 28albumin released 50 20 & lt ; 5 & lt ; 5 10 & lt ; 5______________________________________ particles are no longer present after somewhat more than one month . the breakdown test is carried out as test 10 . the active substance is determined by a uv spectroscopic method known from the literature . ______________________________________release on day 1 4 7 13tetracycline released 30 10 10 & lt ; 5______________________________________ the particle suspension is placed in a soxhlet extractor and extracted with h 2 o for several days . daunorubicin in the extract is determined by a fluorometric method known from the literature ( at 472 / 555 nm ). it emerges that the release , based on the total amount of daunorubicin weighed in , is as follows : ______________________________________after 3 . 5 h 11 h 20 h 29 h the releasewas : 8 . 5 % 10 . 5 % 15 . 0 % 26 . 2 % of the amount______________________________________

the invention relates to a pharmacological composition comprising a polyelectrolyte complex , in particular a polyacid with an average particle size of less than 15 μm and an active agent , among which are active peptides , proteins , enzymes , enzyme inhibitors , antigens , cytostatics , antiinflamatory agents , antibiotics and vaccines . the said composition ensures that the active agent is converted in a non - deleterious manner into a form which can be administered . in addition , the biodistribution , bioavailability and absorption of the pharmaceutical are beneficially affected .

referring now to the drawings , wherein like or corresponding reference numerals are used for like or corresponding parts throughout are used , there is shown in fig1 a container generally designated 10 and comprising a first part 12 which is generally in the form of the end portion of a poultry egg , extending to a large diameter circumference of such poultry egg . the part 12 encompasses an unobstructed space 14 extending inwardly from an edge 16 thereof . the second part 18 comprises a generally cylindrical wall 20 and a bottom 22 joined to it , the wall 20 having at its upper end , as shown in fig1 a , a shoulder 24 and , interiorly thereof , an upstanding peripherally extending ridge 26 . on the shoulder 24 is a body of adhesive 30 , the adhesive 30 extending entirely about the part 18 , and is continuous and unbroken . the adhesive body 30 is provided with a protective covering 32 of paper , or the like , which may be readily removed from the adhesive body 30 , but which protects it from engagement with another object , such as the part 12 , until it is removed . the part 18 provides an open space 28 in it , which is unobstructed , and which may readily receive a part of a sanitary napkin or other absorbent body . there is shown in fig1 within the container 10 , occupying the spaces 14 and 34 , an absorbent body 34 , i . e ., a bandage which is unused , i . e . aseptic . the absorbent body 34 may have a disposable cover ( not shown ) and is specifically a new , ready - for - use sanitary napkin . alternatively , the bandage 34 may be a tampon , or other product of material , shape and size to absorb body fluids . when assembled , the body 34 may be placed in the part 18 , and with the covering 32 in place , the part 12 is associated with the part 18 , guidance for such association being provided by the upstanding ridge 26 . thus , there will be provided a container 10 with an unused aseptic , and ready - for - use absorbent body 34 . the part 12 will not be bonded to the part 18 , since the adhesive 30 will not be in engagement with the part 12 . the container 10 with the unused and aseptic absorbent body 34 therein may be placed at convenient locations , such as in rest rooms , or medical facilities , and may be carried by a person . the container 10 with the body 34 therein is therefore readily available for use , since there will be no impediment to the disassociation of part 12 from part 18 , thereby providing ready access to the sanitary body 34 . after the container 10 has been separated and the new sanitary absorbent body 34 has been removed , the parts 12 and 18 are retained for re - use , to receive a used , septic and possibly infectious absorbent body , which may or may not be the absorbent body which was removed from the container 10 . when a used absorbent body is to be disposed of , it is placed within one or another of the parts 12 and 18 , the protective cover 32 is removed , and the parts 12 and 18 are associated together so that the adhesive 30 is in contact with both of the parts 12 and 18 . the adhesive 30 provides a substantially permanent bond between these parts and is of sufficient strength to prevent the manual separation of the parts 12 and 14 . the adhesive 30 also provides a hermetic seal between the container parts 12 and 42 . among the adhesives which are suitable is adhesive 4693 of 3m company , st . paul , minnesota . container 10 , and each of the containers herein disclosed , is made of material which is readily combustible , so that the container and the used and possibly infectious absorbent body within it may be disposed of by burning , in accordance with established procedures and regulations . the material of which the container is made includes combustible plastic , as well as other materials such as those which are paper - based . in fig2 there is shown an egg - shaped container 40 comprising an upper part 12 , and a lower part 42 having the shape of a part of a poultry egg . the part 42 will be seen to have a shoulder 24 and a ridge 26 , with an adhesive body 30 on the shoulder 24 . the lower portion of the part 12 engages the adhesive 30 , and the adhesive 30 thereby serves to bond the parts 12 and 42 . the space within the container 40 is unobstructed , so that the space readily contains a used absorbent body 44 , such as a used sanitary napkin , tampon or bandage which may contain body fluids . since such body fluids may be infectious , and therefore the body 44 may be infectious , the container 40 , including the adhesive 30 , seals the used absorbent body 44 therewithin and is not hazardous . in fig3 there is shown another embodiment of a container in accordance with the present invention . the container 50 comprises a first part 52 having a top 54 of square configuration , and depending walls 56 , the walls terminating in a peripherally extending edge 58 located at the bottoms thereof , and surrounding an opening into the unobstructed space 60 within the part 52 . a similarly shaped second or bottom part 62 has a bottom 64 which is congruent with the top 54 , and has walls 66 extending upwardly therefrom and which are in alignment with the walls 56 . on the upper edge 68 of the walls 66 is a body of adhesive 30 , shown partly covered with a protective strip 32 . the total height of the container 50 is substantially equal to the height of a used septic absorbent body , such as a sanitary napkin ( not shown ). as will be understood , the protective strip 32 will have been removed , to expose the adhesive 30 , so that the parts 52 and 62 , with their substantially unobstructed spaces , may be joined at their edges to provide a butt joint . there is provided a disposable container 50 with the septic body therein , and which is both hermetically sealed and incapable of being separated by manual force . there is shown in fig4 a further embodiment of the present invention , there being provided a container 70 having a first part 72 having a top 74 in the form of a flat disc , which may be provided with a depending annular flange 76 . there is also provided a second part 78 shaped generally like the part 42 of fig2 and having an upper edge 80 on which there is an adhesive body 30 which bonds to the underside of the top 74 . within the body 78 there is a used , septic absorbent body 44 , which may be a sanitary napkin . fig5 is a perspective view of a container 80 which is of generally elongate parallelepiped shape and size so as to closely encompass a sanitary napkin 84 . container 80 comprises a tray - like bottom part 82 having a length and width substantially equal to the length and width of the sanitary napkin 84 and having a height provided by the walls 86 which is somewhat less than the thickness of the sanitary napkin 84 . the walls 86 include a shoulder 88 and an upstanding ridge 90 ; a body of adhesive 30 is on the shoulder 88 . the top part 92 is of substantially the same length and width as the bottom part 82 and has depending walls 94 which have internal dimensions slightly greater than the ridge 90 , so as to be guided thereby . the bottom edges of the walls 94 engage the adhesive 30 , so that the container with the used septic sanitary napkin 84 is hermetically sealed , and the container 80 may not be opened by manual force . in fig6 there is a generally elongate parallelepiped container 100 , having a first , bottom part 102 of the same shape and size as the bottom part 82 , but having a height of the walls 106 thereof substantially equal to the thickness of a used septic sanitary napkin 84 . the top edge of the walls 86 is provided with a body of adhesive 30 , and the second or top part 108 of the container 100 has a rectangular top 110 , the bottom surface of which engages the adhesive 30 , and the depending walls 112 of which telescope over a portion of the walls 106 of the first or bottom part 102 . fig7 discloses a container 120 in accordance with the present invention comprising a first part 122 and a second part 124 , each of which has a width substantially equal to the width of a sanitary napkin 84 and a depth substantially equal to the thickness of the sanitary napkin 84 . the total height of the container 120 , comprised of the parts 122 and 124 , is substantially equal to the length of the sanitary napkin 84 ; each of the parts 122 and 124 has a height which is less than the length of sanitary napkin 84 . the part 124 will be seen to have a shoulder 126 with adhesive 30 thereon , and an upstanding ridge 128 . ridge 128 has an exterior size and shape slightly smaller than the interior size and shape of the part 122 , and thereby serves to guide the part 122 into engagement with the adhesive 30 on the shoulder 126 . there has been provided a container which may be readily used for the disposal of septic , potentially infectious bodies , such as absorbent bodies that may have body fluids in them . such absorbent bodies or bandages include sanitary napkins , tampons , and bandages . the container herein provided has a substantially unobstructed space for receiving the septic body and is made of separable parts which are bonded together by an adhesive which provides both a hermetic seal and a bonding of such strength as to prevent manual disassembly . the insertion of a septic body , such as a used sanitary napkin , may be readily accomplished , requiring no complicated manipulation . when put in the container or container part , and after removal of the protective cover from the adhesive , a hermetically sealed container , incapable of being manually opened , results . the sealed container may be disposed of in an ecologically acceptable manner , such as by incineration , due to the fact that the container is made of combustible material . the herein disclosed container may be used to ship and / or store an aseptic , unused sanitary napkin or other absorbent body . such an aseptic body , which can be properly packaged to maintain its aseptic condition , may be placed in the container with the parts of the container joined , but one part being separated from contact with the adhesive by a protective layer on the adhesive , so that the parts of the container are readily separable . the herein disclosed container is readily usable , both to extract a body from the container and to place a body within a container , and to provide a hermetic sealing of the container with the aseptic within it . the claims and specification describe the invention presented , and the terms that are employed in the claims draw their meaning from the use of such terms in the specification . some terms employed in the prior art may be broader in meaning than specifically employed herein . whenever there is a question between the broader definition of such term as used in the prior art and the more specific use of the term herein , the more specific meaning is meant .

a container of combustible material is provided for disposal , in an ecologically satisfactory manner , of septic bodies , such as a used sanitary napkin , tampon or bandage . the container comprises two parts , with at least one part providing an open , obstructed space for the reception of the septic body . one of the parts of the container has an adhesive body which completely encircles it . the adhesive body is initially protected by a removable cover . when the parts are assembled , so that both parts are in contact with the adhesive , the adhesive provides a continuous bonding of the parts of the container to hermetically seal the container . the adhesive is sufficiently strong to prevent manual separation of the parts . the container may be used to ship and store an aseptic body , prior to use , and then be used for the reception , sealing and disposal of the same or a similar body which has become septic .

the first compound of this invention is a growth hormone secretagogue ( ghs ). any ghs may be used in the combinations , pharmaceutical compositions , methods and kits of this invention . a representative first class of growth hormone secretagogues within those compounds of formula i as described hereinabove is set forth in pct application publication no . wo97 / 24369 , which is incorporated herein by reference , as compounds having the structural formula : wherein the various substituents are as defined in wo97 / 24369 . said compounds are prepared as disclosed therein . are both within the scope of the disclosure of international pat . application publication no . wo97 / 24369 . those compounds of formula i which are not within the disclosure of international pat . application publication no . wo97 / 24369 may be prepared as disclosed in international pat . application publication no . wo98 / 58947 , which is incorporated herein by reference . is within the scope of the disclosure of international pat . application publication no . wo98 / 58947 . other ghs compounds which may be used in the compositions , methods and kits of this invention include the following : wherein the various substituents are defined , and the compounds are prepared , as disclosed in u . s . pat . no . 5 , 206 , 235 , which is incorporated herein by reference ; wherein the various substituents are defined , and the compounds are prepared , as disclosed in u . s . pat . no . 5 , 283 , 241 , which is incorporated herein by reference ; wherein the various substituents are defined , and the compounds are prepared , as disclosed in international pat . application publication no . wo97 / 41879 , which is incorporated herein by reference ; and wherein the various substituents are defined , and the compounds are prepared , as disclosed in u . s . pat . no . 5 , 492 , 916 , which is incorporated herein by reference . the most preferred compounds within ( 1 ) above have the following structures : the most preferred compound within ( 3 ) above has the following structure : still other compounds which may be used within the compositions , methods and kits of this invention include : ( 5 ) ghrp - 6 , which is the prototype gh - releasing peptide h - his - d - trp - ala - trp - d - phe - lys - nh 2 , ( also called his 1 , lys 6 )- ghrp ), is sold commercially by bachem , catalog number h - 9990 and peninsula labs , catalog number 8071 and is disclosed in u . s . pat . no . 4 , 411 , 890 , which is incorporated herein by reference , and in bowers et al ., endocrinology , 114 : 1537 , 1984 ; ( 6 ) ghrp - 1 , also known as kp101 , which is the second generation gh - releasing peptide ala - his - d - βnai - ala - trp - d - phe - lys - nh 2 and is disclosed in akman , endocrinology , 132 : 1286 , 1993 ; ( 7 ) ghrp - 2 , also known as kp - 102 ( kaken ) and gpa - 748 ( wyeth - ayerst ), which is the gh - releasing peptide d - ala - d - βnai - ala - trp - d - phe - lys - nh 2 and is disclosed in bowers et al ., endocrinology , 114 : 1537 , 1984 and in bowers in : molecular and clinical advances in pituitary disorders , pp . 153 - 157 , 1993 , edited by s . melmed , endocrine research and education , inc ., los angeles , calif ., usa ; and ( 8 ) hexarelin , which is his - d - 2 - methyl - trp - ala - trp - d - phe - lys - nh 2 , is sold commercially by peninsula labs , catalog number 8083 , was synthesized by europeptides , argenteuil , france and is disclosed in guillaume et al ., endocrinology , 135 , 1073 , 1994 . any antidepressant may be used in the combinations , pharmaceutical compositions , methods and kits of this invention . the term antidepressant means an agent used to treat affective or mood disorders and related conditions . affective mood disorders are characterized by changes in mood as the primary clinical manifestation . either extreme of mood may be associated with psychosis , manifested as disordered or delusional thinking and perceptions which are often incongruent with the predominant mood . affective disorders include major depression and mania , including bipolar manic - depressive illness . preferred classes of antidepressants include norepinephrine reuptake inhibitors ( neris ), including secondary and tertiary amine tricyclics ; selective sertraline reuptake inhibitors ; combined neri / ssris ; monoamine oxidase ( mao ) inhibitors ; and atypical antidepressants . any norepinephrine reuptake inhibitor ( neri ) may be used in the combinations , pharmaceutical compositions , methods and kits of this invention . the term norepinephrine reuptake inhibitor means agents which potentiate the actions of biogenic amines by blocking their major means of physiological inactivation , which involves transport or reuptake into nerve terminals , and specifically , agents which block the reuptake of norepinephrine into said nerve terminals . preferred tertiary amine tricyclic norepinephrine reuptake inhibitors which may be used in accordance with this invention include , but are not limited to , amitriptyline , which may be prepared as described in u . s . pat . no . 3 , 205 , 264 ; chlomipramine , which may be prepared as described in u . s . pat . no . 3 , 467 , 650 ; doxepin , which may be prepared as described in u . s . pat . no . 3 , 420 , 851 ; imipramine , which may be prepared as described in u . s . pat . no . 2 , 554 , 736 ; and trimipramine , which may be prepared as described in jacob and messer , compt . rend . 252 , 2117 ( 1961 ). preferred secondary amine tricyclic norepinephrine reuptake inhibitors which may be used in accordance with this invention include , but are not limited to , amoxapine , which may be prepared as described in u . s . pat . no . 3 , 663 , 696 ; desipramine , which may be prepared as described in u . s . pat . no . 3 , 454 , 554 ; maprotiline , which may be prepared as described in u . s . pat . no . 3 , 999 , 201 ; nortriptyline , which may be prepared as described in u . s . pat . no . 3 , 442 , 949 ; and protriptyline , which may be prepared as described in u . s . pat . no . 3 , 244 , 748 . any selective serotonin reuptake inhibitor ( ssri ) may be used in the combinations , pharmaceutical compositions , methods and kits of this invention . the term selective serotonin reuptake inhibitor refers to a compound which inhibits the reuptake of serotonin by afferent neurons . such inhibition is readily determined by those skilled in the art according to standard assays such as those disclosed in u . s . pat . no . 4 , 536 , 518 and other u . s . patents recited in the next paragraph . preferred selective serotonin reuptake inhibitors ( ssri ) which may be used in accordance with this invention include , but are not limited to : citalopram , which may be prepared as described in u . s . pat . no . 4 , 136 , 193 ; femoxetine , which may be prepared as described in u . s . pat . no . 3 , 912 , 743 ; fluoxetine , which may be prepared as described in u . s . pat . no . 4 , 314 , 081 ; fluvoxamine , which may be prepared as described in u . s . pat . no . 4 , 085 , 225 ; indalpine , which may be prepared as described in u . s . pat . no . 4 , 064 , 255 ; indeloxazine , which may be prepared as described in u . s . pat . no . 4 , 109 , 088 ; milnacipran , which may be prepared as described in u . s . pat . no . 4 , 478 , 836 ; paroxetine , which may be prepared as described in u . s . pat . no . 3 , 912 , 743 or u . s . pat . no . 4 , 007 , 196 ; sertraline and the hydrochloride salt of sertraline , which may be prepared as described in u . s . pat . no . 4 , 536 , 518 ; sibutramine , which may be prepared as described in u . s . pat . no . 4 , 929 , 629 ; and zimeldine , which may be prepared as described in u . s . pat . no . 3 , 928 , 369 . fluoxetine is also known as prozac ®. sertraline hydrochloride is also known as zoloft ®. sibutramine is also known as meridia ®. any combined neri / ssri may be used in the combinations , pharmaceutical compositions , methods and kits of this invention . the term combined neri / ssri refers to a compound which blocks the reuptake of both serotonin and norepinephrine by afferent neurons . a preferred combined neri / ssri which may be used in accordance with this invention is venlafaxine , which may be prepared as described in u . s . pat . no . 4 , 535 , 186 . any monoamine oxidase ( mao ) inhibitor may be used in the combinations , pharmaceutical compositions , methods and kits of this invention . the term monoamine oxidase inhibitor refers to a compound which inhibits monoamine oxidase , for example by blocking the metabolic deamination of a variety of monoamines by mitochondrial monoamine oxidase . preferred monoamine oxidase inhibitors which may be used in accordance with this invention include , but are not limited to , phenelzine , which may be prepared as described in u . s . pat . no . 3 , 000 , 903 ; tranylcypromine , which may be prepared as described in u . s . pat . no . 2 , 997 , 422 ; and selegiline , which may be prepared as described in u . s . pat . no . 4 , 564 , 706 . any atypical antidepressant may be used in the combinations , pharmaceutical compositions , methods and kits of this invention . the term atypical antidepressant refers to any antidepressant not within any of the aforesaid classes of antidepressants . preferred atypical antidepressants which may be used in accordance with this invention include , but are not limited to , bupropion , which may be prepared as described in u . s . pat . no . 3 , 885 , 046 ; nefazodone , which may be prepared as described in u . s . pat . no . 4 , 338 , 317 ; and trazodone , which may be prepared as described in u . s . pat . no . 3 , 381 , 009 . the disclosures of each of the patents and published patent applications cited within this description are incorporated herein by reference . the expression “ pharmaceutically acceptable salts ” includes both pharmaceutically acceptable acid addition salts and pharmaceutically acceptable cationic salts , where appropriate . the expression “ pharmaceutically - acceptable cationic salts ” is intended to define but is not limited to such salts as the alkali metal salts , ( e . g ., sodium and potassium ), alkaline earth metal salts ( e . g ., calcium and magnesium ), aluminum salts , ammonium salts , and salts with organic amines such as benzathine ( n , n ′- dibenzylethylenediamine ), choline , diethanolamine , ethylenediamine , meglumine ( n - methylglucamine ), benethamine ( n - benzylphenethylamine ), diethylamine , piperazine , tromethamine ( 2 - amino - 2 - hydroxymethyl - 1 , 3 - propanediol ) and procaine . the expression “ pharmaceutically - acceptable acid addition salts ” is intended to define but is not limited to such salts as the hydrochloride , hydrobromide , sulfate , hydrogen sulfate , phosphate , hydrogen phosphate , dihydrogenphosphate , acetate , succinate , d - tartrate , i - tartrate , citrate , methanesulfonate ( mesylate ) and p - toluenesulfonate ( tosylate ) salts . pharmaceutically acceptable cationic salts of the compounds used in this invention may be readily prepared , where appropriate , by reacting the free acid form of said compound with an appropriate base , usually one equivalent , in a co - solvent . typical bases are sodium hydroxide , sodium methoxide , sodium ethoxide , sodium hydride , potassium methoxide , magnesium hydroxide , calcium hydroxide , benzathine , choline , diethanolamine , piperazine and tromethamine . the salt is isolated by concentration to dryness or by addition of a non - solvent . in many cases , salts are preferably prepared by mixing a solution of the acid with a solution of a different salt of the cation ( sodium or potassium ethylhexanoate , magnesium oleate ), and employing a solvent ( e . g ., ethyl acetate ) from which the desired cationic salt precipitates , or can be otherwise isolated by concentration and / or addition of a non - solvent . the acid addition salts of the compounds used in this invention may be readily prepared by reacting the free base form of said compound with the appropriate acid . when the salt is of a monobasic acid ( e . g ., the hydrochloride , the hydrobromide , the p - toluenesulfonate , the acetate ), the hydrogen form of a dibasic acid ( e . g ., the hydrogen sulfate , the succinate ) or the dihydrogen form of a tribasic acid ( e . g ., the dihydrogen phosphate , the citrate ), at least one molar equivalent and usually a molar excess of the acid is employed . however when such salts as the sulfate , the hemisuccinate , the hydrogen phosphate or the phosphate are desired , the appropriate and exact chemical equivalents of acid will generally be used . the free base and the acid are usually combined in a co - solvent from which the desired salt precipitates , or can be otherwise isolated by concentration and / or addition of a non - solvent . in addition , the growth hormone secretagogues and antidepressants which may be used in accordance with this invention , prodrugs thereof and pharmaceutically acceptable salts thereof or of said prodrugs , may occur as hydrates or solvates . said hydrates and solvates are also within the scope of the invention . the utility of the combinations , pharmaceutical compositions , kits and methods of the present invention as medical agents in the treatment of musculoskeletal frailty ( e . g ., conditions which present with low bone mass or low muscle mass including osteoporosis ) in mammals ( e . g . humans ) is demonstrated by the activity of the compounds of this invention in conventional assays as set forth in u . s . pat . no . 5 , 552 , 412 and international pat . application publication no . wo97 / 24369 . such assays also provide a means whereby the activities of the compositions of this invention can be compared between themselves and with the activities of other known compounds and / or compositions . the results of these comparisons are useful for determining dosage levels in mammals , including humans , for the treatment of such diseases . administration of the compounds used in this invention can be via any method which delivers the compounds or the combination of this invention systemically and / or locally . these methods include oral , parenteral , intraduodenal routes , etc . generally , the compounds used in this invention are administered orally , but parenteral administration ( e . g ., intravenous , intramuscular , transcutaneous , subcutaneous or intramedullary ) may be utilized , for example , where oral administration is inappropriate for the instant target or where the patient is unable to ingest the drug . the two different compounds used in this invention can be co - administered simultaneously or sequentially in any order , or a single pharmaceutical composition comprising a first compound as described above and a second compound as described above in a pharmaceutically acceptable carrier can be administered . in any event the amount and timing of compounds administered will , of course , be dependent on the subject being treated , on the severity of the affliction , on the manner of administration and on the judgment of the prescribing physician . thus , because of patient to patient variability , the dosages given below are a guideline and the physician may titrate doses of the drug to achieve the activity ( e . g ., muscle mass improvement , mental state improvement and / or metabolism improvement ) that the physician considers appropriate for the individual patient . in considering the degree of activity desired , the physician must balance a variety of factors such as muscle mass starting level , cardiac output , age of the patient , presence of preexisting disease , other ongoing or planned medical treatments or procedures , as well as the presence of other diseases . the following paragraphs provide preferred dosage ranges for the various components of this invention . this invention relates both to methods of treating the physical and mental condition of a patient and / or to improve the cardiac function , metabolism and muscle condition of a patient in which the ghs and antidepressant are administered together , as part of the same pharmaceutical composition , and to methods in which these two agents are administered separately , as part of an appropriate dosage regimen designed to obtain the benefits of the combination therapy . the appropriate dosage regimen , the amount of each dose administered and the intervals between doses of the active agents will depend upon the ghs and the antidepressant being used , the type of pharmaceutical formulations being used , the characteristics of the subject being treated and the severity of the complications . generally , in carrying out the methods of this invention , an effective dosage for the ghs compounds of this invention is in the range of 0 . 0002 to 2 mg / kg / day , preferably 0 . 01 to 1 mg / kg / day in single or divided doses . it is preferred that the dosage amount of said ghs is about 1 mg to about 50 mg per day for an average subject , depending upon the ghs and the route of administration . the ghs compound and the antidepressant will be administered in single or divided doses . the preferred dosage ranges for the antidepressants used in this invention will vary depending upon the particular antidepressant used . the preferred dosage amounts of the antidepressants are well known to those skilled in the art or can be found in the physicians desk references ( pdr ®), 54 th edition , 2000 , medical economics company , inc ., montvale , n . j ., 07645 or in goodman and gilman &# 39 ; s the pharmacological basis of therapeutics , hardman , limbird , molinoff , ruddon and gilman , eds ., 9 th edition , 1996 , mcgraw - hill , new york , pp . 433 - 435 . for example , ssris will generally be administered in amounts ranging from about 0 . 05 mg / kg / day to about 10 mg / kg / day in single or divided doses , preferably 5 mg to about 500 mg per day for an average subject , depending upon the ssri and the route of administration . however , some variation in dosage will necessarily occur depending on the condition of the subject being treated . the prescribing physician will , in any event , determine the appropriate dose for the individual subject . pharmaceutical compositions comprising a growth hormone secretagogue , a prodrug thereof or a pharmaceutically acceptable salt of said growth hormone secretagogue or said prodrug and an antidepressant , a prodrug thereof or a pharmaceutically acceptable salt of said antidepressant or said prodrug are hereinafter referred to , collectively , as “ the active compositions of this invention .” where the tartrate salt , hydrochloride salt or other pharmaceutically acceptable salt of any of the above compounds is used in this invention , the skilled person will be able to calculate effective dosage amounts by calculating the molecular weight of the salt form and performing simple stoichiometric ratios . the compounds , prodrugs and pharmaceutically acceptable salts used in the combinations of the present invention are generally administered in the form of a pharmaceutical composition comprising at least one of the compounds or pharmaceutically acceptable salts thereof of this invention together with a pharmaceutically acceptable vehicle or diluent . thus , the compounds , prodrugs and pharmaceutically acceptable salts thereof of this invention can be administered separately or together in any conventional oral , parenteral or transdermal dosage form . when administered separately , the administration of the other compound or a pharmaceutically acceptable salt thereof of the invention follows . for oral administration a compound or pharmaceutical composition can take the form of solutions , suspensions , tablets , pills , capsules , powders , and the like . tablets containing various excipients such as sodium citrate , calcium carbonate and calcium phosphate are employed along with various disintegrants such as starch and preferably potato or tapioca starch and certain complex silicates , together with binding agents such as polyvinylpyrrolidone , sucrose , gelatin and acacia . additionally , lubricating agents such as magnesium stearate , sodium lauryl sulfate and talc are often useful for tableting purposes . solid compositions of a similar type are also employed as fillers in soft and hard - filled gelatin capsules ; preferred materials in this connection also include lactose or milk sugar as well as high molecular weight polyethylene glycols . when aqueous suspensions and / or elixirs are desired for oral administration , the compounds or pharmaceutically aceptable salts thereof of this invention can be combined with various sweetening agents , flavoring agents , coloring agents , emulsifying agents and / or suspending agents , as well as such diluents as water , ethanol , propylene glycol , glycerin and various like combinations thereof . for purposes of parenteral administration , solutions in sesame or peanut oil or in aqueous propylene glycol can be employed , as well as sterile aqueous solutions of the corresponding water - soluble salts . such aqueous solutions may be suitably buffered , if necessary , and the liquid diluent first rendered isotonic with sufficient saline or glucose . these aqueous solutions are especially suitable for intravenous , intramuscular , subcutaneous and intraperitoneal injection purposes . in this connection , the sterile aqueous media employed are all readily obtainable by standard techniques well - known to those skilled in the art . for purposes of transdermal ( e . g ., topical ) administration , dilute sterile , aqueous or partially aqueous solutions ( usually in about 0 . 1 % to 5 % concentration ), otherwise similar to the above parenteral solutions , are prepared . methods of preparing various pharmaceutical compositions with a certain amount of each active ingredient are known , or will be apparent in light of this disclosure , to those skilled in this art . for examples , see remington &# 39 ; s pharmaceutical sciences , mack publishing company , easton , pa ., 19th edition ( 1995 ). pharmaceutical compositions according to the invention may contain 0 . 1 %- 95 % of a combination of the compounds , prodrugs or pharmaceutically acceptable salts thereof used in this invention , preferably 1 %- 70 %. in any event , the composition or formulation to be administered will contain a quantity of a combination of the compounds , prodrugs or pharmaceutically acceptable salts thereof used in the invention in an amount effective to treat the disease / condition of the subject being treated . since the present invention relates to treatment with a combination of the two active ingredients which may be administered separately , the invention also relates to combining separate pharmaceutical compositions in kit form . the kit includes two separate pharmaceutical compositions : a ghs , a prodrug thereof or a pharmaceutically acceptable salt thereof or of said prodrug and an antidepressant , a prodrug thereof or a pharmaceutically acceptable salt thereof or of said prodrug . the kit includes a container for containing the separate compositions such as a divided bottle or a divided foil packet , however , the separate compositions may also be contained within a single , undivided container . typically the kit includes directions for the administration of the separate components . the kit form is particularly advantageous when the separate components are preferably administered in different dosage forms ( e . g ., oral and parenteral ), are administered at different dosage intervals , or when titration of the individual components of the combination is desired by the prescribing physician . an example of such a kit is a so - called blister pack . blister packs are well known in the packaging industry and are being widely used for the packaging of pharmaceutical unit dosage forms ( tablets , capsules , and the like ). blister packs generally consist of a sheet of relatively stiff material covered with a foil of a preferably transparent plastic material . during the packaging process recesses are formed in the plastic foil . the recesses have the size and shape of the tablets or capsules to be packed . next , the tablets or capsules are placed in the recesses and the sheet of relatively stiff material is sealed against the plastic foil at the face of the foil which is opposite from the direction in which the recesses were formed . as a result , the tablets or capsules are sealed in the recesses between the plastic foil and the sheet . preferably the strength of the sheet is such that the tablets or capsules can be removed from the blister pack by manually applying pressure on the recesses whereby an opening is formed in the sheet at the place of the recess . the tablet or capsule can then be removed via said opening . it is desirable to provide a memory aid on a card insert , e . g ., in the form of numbers next to the tablets or capsules whereby the numbers correspond with the days of the regimen which the tablets or capsules so specified should be ingested . another example of such a memory aid is a calendar printed on the card e . g ., as follows “ first week , monday , tuesday , . . . etc . . . second week , monday , tuesday , . . . ” etc . other variations of memory aids will be readily apparent . a “ daily dose ” can be a single tablet or capsule or several pills or capsules to be taken on a given day . also a daily dose of antidepressant can consist of one tablet or capsule while a daily dose of a ghs can consist of several tablets or capsules and vice versa . the memory aid should reflect this . in another specific embodiment of the invention a dispenser designed to dispense the daily doses one at a time in the order of their intended use is provided . preferably , the dispenser is equipped with a memory - aid , so as to further facilitate compliance with the regimen . an example of such a memory - aid is a mechanical counter which indicates the number of daily doses that has been dispensed . another example of such a memory - aid is a battery - powered micro - chip memory coupled with a liquid crystal readout , or audible reminder signal which , for example , reads out the date that the last daily dose has been taken and / or reminds one when the next dose is to be taken . it should be understood that the invention is not limited to the particular embodiments described herein , but that various changes and modifications may be made without departing from the spirit and scope of this invention as defined by the following claims .

this invention is directed to combinations comprising a growth hormone secretagogue , a prodrug thereof or a pharmaceutically acceptable salt of said growth hormone secretagogue or said prodrug and an antidepressant , a prodrug thereof or a pharmaceutically acceptable salt of said antidepressant or said prodrug and to pharmaceutical compositions and kits comprising such combinations . antidepressants within the scope of this invention include norepinephrine reuptake inhibitors , selective sertraline reuptake inhibitors , agents which are combined norepinephrine / sertraline reuptake inhibitors , monoamine oxidase inhibitors and atypical antidepressants . this invention is also directed to methods of improving the physical and / or psychological condition of a patient undergoing a medical procedure , to methods of treating musculoskeletal frailty , to methods of treating congestive heart failure and to methods of attenuating protein catabolic response after a major operation comprising administering such a combination . in particular , this invention relates to such compositions and kits that improve the cardiac function , metabolism , muscle tone and / or mental state of patients undergoing a medical procedure . the compositions and kits of this invention are also useful in treating central nervous system disorders of patients undergoing a medical procedure .

the present invention will be described with respect to particular embodiments and with reference to certain drawings but the invention is not limited thereto but only by the claims . the drawings described are only schematic and are non - limiting . in the drawings , the size of some of the elements may be exaggerated and not drawn to scale for illustrative purposes . the dimensions and the relative dimensions do not correspond to actual reductions to practice of the invention . furthermore , the terms first , second , third and the like in the description and in the claims , are used for distinguishing between similar elements and not necessarily for describing a sequence , either temporally , spatially , in ranking or in any other manner . it is to be understood that the terms so used are interchangeable under appropriate circumstances and that the embodiments of the invention described herein are capable of operation in other sequences than described or illustrated herein . moreover , the terms top , bottom , over , under and the like in the description and the claims are used for descriptive purposes and not necessarily for describing relative positions . it is to be understood that the terms so used are interchangeable under appropriate circumstances and that the embodiments of the invention described herein are capable of operation in other orientations than described or illustrated herein . it is to be noticed that the term “ comprising ”, used in the claims , should not be interpreted as being restricted to the means listed thereafter ; it does not exclude other elements or steps . it is thus to be interpreted as specifying the presence of the stated features , integers , steps or components as referred to , but does not preclude the presence or addition of one or more other features , integers , steps or components , or groups thereof . thus , the scope of the expression “ a device comprising means a and b ” should not be limited to devices consisting only of components a and b . it means that with respect to the present invention , the only relevant components of the device are a and b . reference throughout this specification to “ one embodiment ” or “ an embodiment ” means that a particular feature , structure or characteristic described in connection with the embodiment is included in at least one embodiment of the present invention . thus , appearances of the phrases “ in one embodiment ” or “ in an embodiment ” in various places throughout this specification are not necessarily all referring to the same embodiment , but may refer to different embodiments . furthermore , the particular features , structures or characteristics may be combined in any suitable manner , as would be apparent to one of ordinary skill in the art from this disclosure , in one or more embodiments . similarly it should be appreciated that in the description of exemplary embodiments of the invention , various features of the invention are sometimes grouped together in a single embodiment , figure , or description thereof for the purpose of streamlining the disclosure and aiding in the understanding of one or more of the various inventive aspects . this method of disclosure , however , is not to be interpreted as reflecting an intention that the claimed invention requires more features than are expressly recited in each claim . rather , as the following claims reflect , inventive aspects lie in less than all features of a single foregoing disclosed embodiment . thus , the claims following the detailed description are hereby expressly incorporated into this detailed description , with each claim standing on its own as a separate embodiment of this invention . furthermore , while some embodiments described herein include some but not other features included in other embodiments , combinations of features of different embodiments are meant to be within the scope of the invention , and form different embodiments , as would be understood by those skilled in the art . for example , in the following claims , any of the claimed embodiments can be used in any combination . in the description provided herein , numerous specific details are set forth . however , it is understood that embodiments of the invention may be practised without these specific details . in other instances , well - known methods , structures and techniques have not been shown in detail in order not to obscure an understanding of this description . the invention will now be described by a detailed description of several embodiments of the invention . it is clear that other embodiments of the invention can from the true spirit or technical teaching of the invention , the invention being limited only by the terms of the appended claims . in fig1 , the assembled and erected apparatus 10 comprises a base 20 . this base 20 comprises two feet 30 , one at the lower end of each leg 40 . each foot comprises a rectilinear length of box - section section . each foot 30 comprises a rear 34 and a front 36 member . the front member 36 has a smaller cross - section than the rear member 34 such that it may be moved telescopically into and out of the larger rear member 34 . this allows the length of the feet 30 to be adjusted as required and allows the apparatus to be packed into a small volume as may be seen in fig3 . the position of the two members 34 , 36 of each foot 30 relative to one another may be adjustably fixed by means of a pin ( not shown ), attached to the rear member 34 by means of a chain 93 , passing through a hole in each member 34 , 36 , the hole selected from a plurality of holes for the appropriate length as required . other means of adjustably maintaining the relative positions of the two feet members 34 , 36 are contemplated such as the pull - pins discussed above . each leg 40 comprises two members 44 , 46 of generally tubular shape . the lower leg 44 has a larger cross - section than the upper leg 46 such that the upper leg 46 may be moved telescopically into and out of the larger lower leg 44 . this allows the length of the legs 40 to be individually adjusted to cater for uneven ground and for adjustment of the height of the upper gripping member 50 relative to the base 20 . it also allows the apparatus to be packed into a small volume as may be seen in fig3 . the upper 46 and lower 44 leg members are retained in position relative to one another by means of bolts 49 a provided at the upper end of the lower leg members 44 . corresponding holes 49 b are provided in the upper leg members 46 at various positions along their lengths to allow positive locking of the bolts 49 a therein . other means of adjustably maintaining the relative positions of the upper 46 and lower 44 leg members are contemplated such as the pull - pins discussed above . each leg 40 may be releasably attached to each foot 30 . alternatively , or additionally , each leg 40 may be pivotable connected to each foot 30 . slots 91 , 92 are provided on each lower leg member 44 . these will be described in more detail in conjunction with the discussion regard fig3 below . the upper gripping member 50 is provided at the upper end of the legs 40 . it comprises a first portion 52 which is substantially rectilinear and horizontally positioned . the first portion includes downwardly depending portions which fit inside the upper end of each upper leg member 46 . the position of these downwardly depending portions are indicated by reference numeral “ 54 ”. these portions 54 may be locked to the upper leg members 46 by use of bolts similar to the ones describe above and referenced “ 49 a ”. however , other means of releasably maintaining the upper gripping means 50 to the upper leg members 46 are contemplated such as the pull - pins discussed above . from the upper end of each downwardly depending portion 54 a portion 53 extends substantially horizontally . it is to these horizontal sections 53 that the first portion 52 is attached . the first portion 52 extends over the top of both legs 40 and projects beyond the area defined by the base 20 . two second portions 55 are connected to the middle of the length of the first portion and each extends towards a leg 40 such that they extend in different directions to one another . each second portion 55 extends to the same side of the first portion 52 . each second portion 55 lies in the same plane as the first portion 52 , but not parallel to it . each second portion 55 makes a “ v ” shape arrangement with the first portion 52 . a third portion 58 extends from the end of each horizontal portion 53 in the same direction thereas . each third portion 58 connects the end of each second portion 55 , opposite from the end which is connected to the first portion 52 , to the first portion 52 , to form a triangular shape therebetween . each third portion 58 extends beyond the end of each second portion 55 to provide another position for gripping by the user in use . an additional second portion 56 is also provided substantially above each leg 40 . these additional second portions 56 connect to each end of the first portion 52 at one end and to each of the third portions 58 at their other end in the vicinity where the second portions 55 connect to each third portions 58 . this arrangement provides a triangular shape therebetween . the additional second portions 56 also lie in the same plane as the first 52 and second 55 portions . a fourth portion 59 is also provided at each end of the first portion 52 . these fourth portions are not in the same plane as the first , second and third portions . rather , they depend downwardly . the arrangement of various portions allows a user to grip the upper gripping member 50 in numerous ways . a handle 80 is included at one point along the length of the first portion 52 as will be described in more detail below . the various portions may be integral with one another in that they may be manufactured from one piece . alternatively , one or more various portions may be attached or connected together , such as by welding . the apparatus 10 may comprise steel and / or aluminium , although other materials are contemplated . to provide greater stability to the apparatus 10 a brace 70 is provided between the legs 40 . this brace 70 comprises two struts 72 , 74 which are each connected at one end to each of the lower leg members 44 . the two struts 72 , 74 lie substantially horizontally , in this assembled state shown , and meet in the middle between the two legs 40 . the two struts are hinged or pivoted together . a locking means 76 in the form of a channel is located at this mid - point to prevent the two struts 72 , 74 from moving relative to one another . the locking means 76 may be moved to allow the struts 72 , 74 to pivot relative to one another during disassembly . fig2 shows the apparatus 10 with the upper leg members 46 retracted fully inside the lower leg members 44 . a handle 80 is shown attached to the upper gripping member 50 for use as a carrying handle when the apparatus is disassembled and packed as shown in fig3 . all other referenced elements are the same as described with reference to fig1 . fig3 demonstrates how the apparatus 10 may be packed into a relatively small volume for ease of storage and or portability . the upper gripping member 50 is attached to the lower leg members 44 , which have the upper leg members 46 substantially fully retracted inside . the lower leg members 44 are , in turn , attached to the rear feet members 34 , which have the forward members 36 fully retracted inside them . the legs 40 have been brought together and the feet 30 have been rotated relative to the legs ( by means of pivoting means 90 ) such that the longitudinal axes of the feet 30 , legs 40 and first portion 52 of the upper gripping member 50 are substantially parallel and adjacent with one another . the legs 40 may be releasably fixed in this position , relative to the feet 30 , by use of a locking means , such as one or more pins 99 passing through appropriate holes in the pivoting means 90 . the upper gripping member 50 is attached to the lower leg members 44 by means of the slots 91 , 92 provided on the surface of the lower leg members 44 . the two third portions 58 each fit inside the slots 91 , 92 and are retained therein by means of a releasable pin 94 .

a free - standing exercise apparatus is provided which comprises a base , at least one leg extending , in use , upwardly from the base , and a substantially horizontal bar attached to the at least one leg at an end substantially opposite to the base , wherein the bar has a substantially rectilinear first portion and at least one second portion arranged substantially in the same plane as , but substantially non - perpendicularly to , the first portion .

this invention relates to the therapeutic use of nap and adnf polypeptides in the treatment of diseases and disorders including anxiety and depression , and disorders related thereto . the invention is based on the finding set out in example 1 that treatment of mice with nap peptide significantly reduces anxiety - like behavior in a widely used and accepted industry standard model of anxiety , the elevated plus - maze ( see rodgers & amp ; dalvi , neurosci . biobehav . rev . 21 ( 6 ) 801 - 810 ( 1997 )). the invention further discloses that while providing anxiolytic effects , nap does not inhibit cognitive functions . in another embodiment , this invention further discloses nap mechanism of action and identifies tubulin as the molecular target for nap &# 39 ; s activity offering a novel target platform for anxiolytic drug discovery ( see example 2 ). the discovery of nap &# 39 ; s mechanism of action provides drug assays for compounds that also can be used to treat anxiety and depression . in such assays , compounds that modulate the interaction between nap and tubulin are identified . in one embodiment , the adnf polypeptides of the present invention comprise the following amino acid sequence : ( r 1 ) x - asn - ala - pro - val - ser - ile - pro - gln -( r 2 ) y ( seq id no : 13 ) and conservatively modified variations thereof . in this designation , r 1 denotes the orientation of the amino terminal ( nh 2 or n - terminal ) end and r 2 represents the orientation of the carboxyl terminal ( cooh or c - terminal ) end . in the above formula , r 1 is an amino acid sequence comprising from 1 to about 40 amino acids , wherein each amino acid is independently selected from the group consisting of naturally occurring amino acids and amino acid analogs . the term “ independently selected ” is used herein to indicate that the amino acids making up the amino acid sequence r 1 may be identical or different ( e . g ., all of the amino acids in the amino acid sequence may be threonine , etc .). moreover , as previously explained , the amino acids making up the amino acid sequence r 1 may be either naturally occurring amino acids , or known analogues of natural amino acids that functions in a manner similar to the naturally occurring amino acids ( i . e ., amino acid mimetics and analogs ). suitable amino acids that can be used to form the amino acid sequence r 1 include , but are not limited to , those listed in table i , infra . the indexes “ x ” and “ y ” are independently selected and can be equal to one or zero . as with r 1 , r 2 , in the above formula , is an amino acid sequence comprising from 1 to about 40 amino acids , wherein each amino acid is independently selected from the group consisting of naturally occurring amino acids and amino acid analogs . moreover , as with r 1 , the amino acids making up the amino acid sequence r 2 may be identical or different , and may be either naturally occurring amino acids , or known analogues of natural amino acids that functions in a manner similar to the naturally occurring amino acids ( i . e ., amino acid mimetics and analogs ). suitable amino acids that can be used to form r 2 include , but are not limited to , those listed in table i , infra . as used herein , “ nap ” or “ nap peptide ” refers to the formula above where x and y both equal 0 . “ nap related peptide ” refers to any of the other variants of nap which are described the formula . r 1 and r 2 are independently selected . if r 1 r 2 are the same , they are identical in terms of both chain length and amino acid composition . for example , both r 1 and r 2 may be val - leu - gly - gly - gly ( seq id no : 14 ). if r 1 and r 2 are different , they can differ from one another in terms of chain length and / or amino acid composition and / or order of amino acids in the amino acids sequences . for example , r 1 may be val - leu - gly - gly - gly ( seq id no : 15 ), whereas r 2 may be val - leu - gly - gly ( seq id no : 16 ). alternatively , r 1 may be val - leu - gly - gly - gly ( seq id no : 17 ), whereas r 2 may be val - leu - gly - gly - val ( seq id no : 18 ). alternatives , r 1 may be val - leu - gly - gly - gly ( seq id no : 19 ), whereas r 2 may be gly - val - leu - gly - gly ( seq id no : 20 ). within the scope of the above formula , certain nap and nap related polypeptides are preferred , namely those in which x and y are both zero ( i . e . nap ). equally preferred are nap and nap related polypeptides in which x is one ; r 1 gly - gly ; and y is zero ( seq id no : 21 ). also equally preferred are nap and nap related polypeptides in which is one ; r 1 is leu - gly - gly ; y is one ; and r 2 is - gln - ser ( seq id no : 22 ). also equally preferred are nap and nap related polypeptides in which x is one ; r 1 is leu - gly - leu - gly - gly - ( seq id no : 23 ); y is one ; and r 2 is - gln - ser ( seq id no : 24 ). also equally preferred are nap and nap related polypeptides in which x is one ; r 1 is ser - val - arg - leu - gly - leu - gly - gly -( seq id no : 25 ); y is one ; and r 2 is - gln - ser ( seq id no : 26 ). additional amino acids can be added to both the n - terminus and the c - terminus of the active peptide without loss of biological activity . in another aspect , the present invention provides pharmaceutical compositions comprising one of the previously described nap and nap related polypeptides in an amount sufficient to exhibit anxiolytic ( e . g . anxiety reducing ) or anti - depressant activity , in a pharmaceutically acceptable diluent , carrier or excipient . in one embodiment , the nap or nap related peptide has an amino acid sequence selected from the group consisting of seq id no : 2 , and 9 - 12 , and conservatively modified variations thereof . in another embodiment , the adnf polypeptide comprises the following amino acid sequence : ( r 1 ) x - ser - ala - leu - leu - arg - ser - ile - pro - ala -( r 2 ) y ( seq id no : 27 ) and conservatively modified variations thereof . in this designation , r 1 denotes the orientation of the amino terminal ( nh 2 or n - terminal ) end and r 2 represents the orientation of the carboxyl terminal ( cooh or c - terminal ) end . in the above formula , r 1 is an amino acid sequence comprising from 1 to about 40 amino acids , wherein each amino acid is independently selected from the group consisting of naturally occurring amino acids and amino acid analogs . the term “ independently selected ” is used herein to indicate that the amino acids making up the amino acid sequence r 1 may be identical or different ( e . g ., all of the amino acids in the amino acid sequence may be threonine , etc .). moreover , as previously explained , the amino acids making up the amino acid sequence r 1 may be either naturally occurring amino acids , or known analogues of natural amino acids that functions in a manner similar to the naturally occurring amino acids ( i . e ., amino acid mimetics and analogs ). suitable amino acids that can be used to form the amino acid sequence r 1 include , but are not limited to , those listed in table i , infra . the indexes “ x ” and “ y ” are independently selected and can be equal to one or zero . as with r ′, r 2 , in the above formula , is an amino acid sequence comprising from 1 to about 40 amino acids , wherein each amino acid is independently selected from the group consisting of naturally occurring amino acids and amino acid analogs . moreover , as with r 1 , the amino acids making up the amino acid sequence r 2 may be identical or different , and may be either naturally occurring amino acids , or known analogues of natural amino acids that functions in a manner similar to the naturally occurring amino acids ( i . e ., amino acid mimetics and analogs ). suitable amino acids that can be used to form r 2 include , but are not limited to , those listed in table i , infra . as used herein , “ sal ” or “ sal peptide ” refers to the formula above where x and y both equal 0 . “ sal related peptide ” refers to any of the other variants of sal which are described the formula . r 1 and r 2 are independently selected . if r 1 r 2 are the same , they are identical in terms of both chain length and amino acid composition . additional amino acids can be added to both the n - terminus and the c - terminus of the active peptide without loss of biological activity . in another aspect , the present invention provides pharmaceutical compositions comprising one of the previously described sal and sal - related polypeptides in an amount sufficient to exhibit anxiolytic ( e . g . anxiety reducing ) or anti - depressant activity , in a pharmaceutically acceptable diluent , carrier or excipient . in one embodiment , the sal or sal related peptide has an amino acid sequence selected from the group consisting of seq id no : 1 and 3 - 8 , and conservatively modified variations thereof . polypeptides and peptides comprising the core napvsipq or sallrsipa active site can be easily made , e . g ., by systematically adding one amino acid at a time and screening the resulting peptide for biological activity , as described herein . in addition , the contributions made by the side chains of various amino acid residues in such peptides can be probed via a systematic scan with a specified amino acid , e . g ., ala . one of skill will recognize many ways of generating alterations in a given nucleic acid sequence . such well - known methods include site - directed mutagenesis , pcr amplification using degenerate oligonucleotides , exposure of cells containing the nucleic acid to mutagenic agents or radiation , chemical synthesis of a desired oligonucleotide ( e . g ., in conjunction with ligation and / or cloning to generate large nucleic acids ) and other well - known techniques ( see giliman & amp ; smith , gene 8 : 81 - 97 ( 1979 ); roberts et al ., nature 328 : 731 - 734 ( 1987 )). most commonly , polypeptide sequences are altered by changing the corresponding nucleic acid sequence and expressing the polypeptide . however , polypeptide sequences are also optionally generated synthetically using commercially available peptide synthesizers to produce any desired polypeptide ( see merrifield , am . chem . soc . 85 : 2149 - 2154 ( 1963 ); stewart & amp ; young , solid phase peptide synthesis ( 2nd ed . 1984 )). one of skill can select a desired nucleic acid or polypeptide of the invention based upon the sequences provided and upon knowledge in the art regarding proteins generally . knowledge regarding the nature of proteins and nucleic acids allows one of skill to select appropriate sequences with activity similar or equivalent to the nucleic acids and polypeptides disclosed herein . the definitions section , supra , describes exemplar conservative amino acid substitutions . modifications to the nap and adnf polypeptides are evaluated by routine screening techniques in suitable assays for the desired characteristic . for instance , changes in the immunological character of a polypeptide can be detected by an appropriate immunological assay . modifications of other properties such as nucleic acid hybridization to a target nucleic acid , redox or thermal stability of a protein , hydrophobicity , susceptibility to proteolysis , or the tendency to aggregate are all assayed according to standard techniques . more particularly , it will be readily apparent to those of ordinary skill in the art that the small peptides of the present invention can readily be screened for anxiolytic and anti - depressant activity by employing suitable assays and animal models known to those skilled in the art . among the animal models employed to evaluate the anxiolytic or anxiogenic effects of drugs , the elevated plus - maze is probably the most popular . ( see rodgers and dalvi , supra ). for factors controlling measures of anxiety and responses to novelty in the mouse , see file , behav . brain res . 125 : 151 - 157 ( 2001 ). for a review of the validity and variability of the elevated plus - maze as an animal model of anxiety , see hogg , pharmacol . biochem . behav . 54 : 21 - 30 ( 1996 ); and lister , psychopharmacology ( berlin ) 92 : 180 - 185 ( 1987 ). the elevated plus - maze model is described in some detail in example 1 . still , those skilled in the art are aware of a wide range of alternative models which are also available to measure the anxiolytic effect of therapeutic agents . such models may require measurement of physiological or endocrine functions ( e . g ., hyperthermic or corticosterone responses to stress ) while others analyze behavior . broadly speaking , suitable behavioral models for testing anxiolytic effects of a test compound involve exposure of animals to stimuli ( exteroceptive or interoceptive ) that appear capable of causing anxiety in humans . the animals are then treated with the test compound to determine if it generates an anxiolytic effect . the models may also be grouped into two general categories involving either conditioned ( e . g . geller - seifter conflict , potentiated startle ) or unconditioned ( social interaction and light / dark exploration tests ) responses . those in the art are aware that any of these standard behavioral models may be used to test nap or adnf polypeptides to identify or confirm anxiolytic activity of test peptides . using these assays and models , one of ordinary skill in the art can readily prepare a large number of nap and adnf polypeptides in accordance with the teachings of the present invention and , in turn , screen them using the foregoing animal models to find adnf polypeptides , in addition to those set forth herein , which possess the desired activity . for instance , using the nap peptide ( i . e ., asn - ala - pro - val - ser - ile - pro - gln ( seq id no : 2 )) or sal peptide ser - ala - leu - leu - arg - ser - ile - pro - ala ( seq id no : 1 ) as a starting point , one can systematically add , for example , gly -, gly - gly -, leu - gly - gly - to the n - terminus of the peptide and , in turn , screen each of these nap or adnf polypeptides in the foregoing assay to determine whether they possess anxiolytic or anti - depressant activity . in doing so , it will be found that additional amino acids can be added to both the n - terminus and the c - terminus of the active site , i . e ., asn - ala - pro - val - ser - ile - pro - gln ( seq id no : 2 ) or ser - ala - leu - leu - arg - ser - ile - pro - ala ( seq id no : 1 ), without loss of biological activity . the peptides of the invention may be prepared via a wide variety of well - known techniques . peptides of relatively short size are typically synthesized on a solid support or in solution in accordance with conventional techniques ( see , e . g ., merrifield , am . chem . soc . 85 : 2149 - 2154 ( 1963 )). various automatic synthesizers and sequencers are commercially available and can be used in accordance with known protocols ( see , e . g ., stewart & amp ; young , solid phase peptide synthesis ( 2nd ed . 1984 )). solid phase synthesis in which the c - terminal amino acid of the sequence is attached to an insoluble support followed by sequential addition of the remaining amino acids in the sequence is the preferred method for the chemical synthesis of the peptides of this invention . techniques for solid phase synthesis are described by barany & amp ; merrifield , solid - phase peptide synthesis ; pp . 3 - 284 in the peptides analysis , synthesis , biology . vol . 2 : special methods in peptide synthesis , part a . ; merrifield et al 1963 ; stewart et al . 1984 ). nap and related peptides are synthesized using standard fmoc protocols ( wellings & amp ; atherton , methods enzymol . 289 : 44 - 67 ( 1997 )). in addition to the foregoing techniques , the peptides for use in the invention may be prepared by recombinant dna methodology . generally , this involves creating a nucleic acid sequence that encodes the protein , placing the nucleic acid in an expression cassette under the control of a particular promoter , and expressing the protein in a host cell . recombinantly engineered cells known to those of skill in the art include , but are not limited to , bacteria , yeast , plant , filamentous fungi , insect ( especially employing baculoviral vectors ) and mammalian cells . the recombinant nucleic acids are operably linked to appropriate control sequences for expression in the selected host . for e . coli , example control sequences include the t7 , trp , or lambda promoters , a ribosome binding site and , preferably , a transcription termination signal . for eukaryotic cells , the control sequences typically include a promoter and , preferably , an enhancer derived from immunoglobulin genes , sv40 , cytomegalovirus , etc ., and a polyadenylation sequence , and may include splice donor and acceptor sequences . the plasmids of the invention can be transferred into the chosen host cell by well - known methods . such methods include , for example , the calcium chloride transformation method for e . coli and the calcium phosphate treatment or electroporation methods for mammalian cells . cells transformed by the plasmids can be selected by resistance to antibiotics conferred by genes contained on the plasmids , such as the amp , gpt , neo , and hyg genes . once expressed , the recombinant peptides can be purified according to standard procedures of the art , including ammonium sulfate precipitation , affinity columns , column chromatography , gel electrophoresis and the like ( see , e . g ., scopes , polypeptide purification ( 1982 ); deutscher , methods in enzymology vol . 182 : guide to polypeptide purification ( 1990 )). once purified , partially or to homogeneity as desired , the nap and adnf polypeptides may then be used , e . g ., to prevent neuronal cell death or as immunogens for antibody production . optional additional steps include isolating the expressed protein to a higher degree , and , if required , cleaving or otherwise modifying the peptide , including optionally renaturing the protein . after chemical synthesis , biological expression or purification , the peptide ( s ) may possess a conformation substantially different than the native conformations of the constituent peptides . in this case , it is helpful to denature and reduce the peptide and then to cause the peptide to re - fold into the preferred conformation . methods of reducing and denaturing peptides and inducing re - folding are well known to those of skill in the art ( see debinski et al ., j . biol . chem . 268 : 14065 - 14070 ( 1993 ); kreitman & amp ; pastan , bioconjug . chem . 4 : 581 - 585 ( 1993 ); and buchner et al ., anal . biochem . 205 : 263 - 270 ( 1992 )). debinski et al ., for example , describe the denaturation and reduction of inclusion body peptides in guanidine - dte . the peptide is then refolded in a redox buffer containing oxidized glutathione and l - arginine . one of skill will recognize that modifications can be made to the peptides without diminishing their biological activity . some modifications may be made to facilitate the cloning , expression , or incorporation of the targeting molecule into a fusion peptide . such modifications are well known to those of skill in the art and include , for example , a methionine added at the amino terminus to provide an initiation site , or additional amino acids ( e . g ., poly his ) placed on either terminus to create conveniently located restriction sites or termination codons or purification sequences . use of nap and adnf polypeptides for treating anxiety and / or depression , including other mood disorders and anxiety disorders this invention discloses for the first time the surprising finding that nap and adnf polypeptides that were shown before to be neuroprotective and providing cognitive enhancement can be used in the treatment and / or prevention of a broad range of human clinical disorders such as anxiety and depression and a broad range of related disorders . as current medications used for treatment of anxiety disorders may adversely affect alertness , this surprising discovery offers an obvious advantage . furthermore , anxiety is common in the elderly and can present as a primary anxiety disorder or as a symptom of another disorder . generalized anxiety disorder ( gad ), in particular , is a common syndrome in late life . anxiety symptoms are also common features of late - life depression and dementia . treatment of anxiety in elderly persons has typically involved the use of benzodiazepines , which are often effective but problematic because they are associated with increased risk of cognitive impairment , falls , and fractures ( lenze et al ., cns spectr . 12 suppl 3 : 6 - 13 ( 2003 )). benzodiazepines interact with the gamma - aminobutyric acid ( gaba ) receptor . previously , gephyrin , a tubulin - binding protein , was found as the core of inhibitory postsynaptic scaffolds stabilizing glycine receptors ( glyrs ) and / or gaba ( a ) receptors ( hanus et al ., j neurosci . 24 ( 5 ): 1119 - 28 ( 2004 )). here , a mechanism for nap is disclosed and the molecular target — tubulin , the subunit protein of microtubules is identified as the nap binding protein . the direct interaction of nap with tubulin may circumvent the adverse side effects associated with benzodiazepines treatments and further offers a target platform for novel drug discovery . anxiety is a cardinal symptom of many psychiatric disorders as well as a disease in itself . symptoms of anxiety commonly are associated with depression and especially with dysthymic disorder ( chronic depression of moderate severity ), panic disorder , agoraphobia and other specific phobias , obsessive - compulsive disorder , eating disorders and many personality disorders . anxiety in human includes those further divisions set out in the diagnostic and statistical manual of mental disorders ( american psychiatric association , dsm - iv , 4th ed . 1994 ). anxiety disorders are serious medical illnesses that affect approximately 19 million american adults . ( narrow et al ., nimh epidemiology note : prevalence of anxiety disorders . one - year prevalence best estimates calculated from eca and ncs data . population estimates based on u . s . census estimated residential population age 18 to 54 on jul . 1 , 1998 . unpublished ). these disorders fill people &# 39 ; s lives with overwhelming anxiety and fear . anxiety disorders are acute attacks or are chronic , relentless , and can grow progressively worse if not treated . examples include : panic disorder , obsessive - compulsive disorder , attention deficit disorder and attention deficit hyperactivity disorder , post - traumatic stress disorder , social phobia ( or social anxiety disorder ), specific phobias , and generalized anxiety disorder . major depression is characterized by clinically significant depressions of mood and impairment of functioning as its primary clinical manifestations . its clinical manifestations and current treatment overlap the anxiety disorders including panic - agorophobia syndrome , sever phobias , generalized anxiety disorder , social anxiety disorder , post - traumatic stress disorders and obsessive - compulsive disorder . extremes of mood may be associated with psychosis , manifested as disordered or delusional thinking and perceptions , often congruent with the predominant mood . in any given 1 - year period , 9 . 5 percent of the population , or about 18 . 8 million american adults , suffer from a depressive illness ( robins & amp ; regier ( eds ). psychiatric disorders in america , the epidemiologic catchment area study , 1990 ; new york : the free press ). depression often accompanies anxiety disorders ( regier et al ., british journal of psychiatry supplement 34 : 24 - 8 ( 1998 )) and , when it does , it needs to be treated as well . symptoms of depression include feelings of sadness , hopelessness , changes in appetite or sleep , low energy , and difficulty concentrating . most people with depression can be effectively treated with antidepressant medications , certain types of psychotherapy , or a combination of both . major depression is manifested by a combination of symptoms ( see symptom list ) that interfere with the ability to work , study , sleep , eat , and enjoy once pleasurable activities . such a disabling episode of depression may occur only once but more commonly occurs several times in a lifetime . a less severe type of depression , dysthymia , involves long - term , chronic symptoms that do not disable , but keep one from functioning well or from feeling good . many people with dysthymia also experience major depressive episodes at some time in their lives . another type of depression is bipolar disorder , also called manic - depressive illness . not nearly as prevalent as other forms of depressive disorders , bipolar disorder is characterized by cycling mood changes : severe highs ( mania ) and lows ( depression ). sometimes the mood switches are dramatic and rapid , but most often they are gradual . when in the depressed cycle , an individual can have any or all of the symptoms of a depressive disorder . when in the manic cycle , the individual may be overactive , overtalkative , and have a great deal of energy . mania often affects thinking , judgment , and social behavior in ways that cause serious problems and embarrassment . for example , the individual in a manic phase may feel elated , full of grand schemes that might range from unwise business decisions to romantic sprees . mania , left untreated , may worsen to a psychotic state . gamma - aminobutyric acid ( gaba ) is the major inhibitory neurotransmitter in the mammalian central nervous system ( cns ). gaba participates in the regulation of neuronal excitability through interaction with specific membrane proteins ( the gabaa receptors ). the binding of gaba to these postsynaptic receptors , results in an opening of a chloride channel integrated in the receptor which allows the entry of cl — and consequently leads to hyperpolarization of the recipient cell . the action of gaba is allosterically modulated by a wide variety of chemical entities which interact with distinct binding sites at the gabaa receptor complex . one of the most thoroughly investigated modulatory site is the benzodiazepine binding site . the benzodiazepines constitute a well - known class of therapeutics displaying hypnotic , anxiolytic and anticonvulsant effects . their usefulness , however , is limited by a broad range of side effects comprising sedation , ataxia , amnesia , alcohol and barbiturate potentiation , tolerance development and abuse potential . consequently , there has been an intensive search for modulatory agents with an improved profile , and a diversity of chemical entities distinct from the benzodiazepines , but with gaba modulatory effects have been identified . the existence of endogenous ligands for the gabaa receptor complex beside gaba has often been described , but their role in the regulation of gaba action is still a matter of controversy . the progress of molecular biology during the last decade has contributed enormously to the understanding of benzodiazepine receptor pharmacology . a total of 14 gabaa receptor subunits have been cloned from mammalian brain and have been expressed / co - expressed in stable cell lines . these transfected cells constitute an important tool in the characterization of subtype selective ligands . in spite of the rapidly expanding knowledge of the molecular and pharmacological mechanisms involved in gaba / benzodiazepine related cns disorders , the identification of clinically selective acting drugs is still to come ( teuber et al ., curr pharm des 5 ( 5 ): 317 - 43 ( 1999 )). control of neurotransmitter receptor expression and delivery to the postsynaptic membrane is of great importance for neural signal transduction at synapses . the gaba type a ( gaba ( a )) receptor - associated protein gabarap was reported to have an important role for movement and sorting of gaba ( a ) receptor molecules to the postsynaptic membrane . gabarap not only binds to gaba ( a ) receptor gamma2 - subunit but also to tubulin , gephyrin , and ulk1 , suggesting regulation through the interaction with the microtubular network ( stangler et al ., j biol . chem . 19 : 277 ( 2002 ), 16 : 13363 - 6 . epub 2002 mar . 1 ) anxiety is often defined as an organism &# 39 ; s response to potential threat , as opposed to direct or immediate threat . anxiety and depression also encompass disorders of mood such as affective disorders . the severity of these conditions covers an extraordinarily broad range from normal grief reactions and dysthymia to severe , incapacitating illnesses that may result in death . thus , according to the instant invention , nap and adnf polypeptides may be used to treat anxiety and / or depression and diseases or disorders related thereto , as defined herein . the identification of tubulin as the nap - binding site allows the use of tubulin and tubulin — derived peptides as targets for further drug discovery , e . g ., for the treatment of diseases related to adnf polypeptides such as anxiety , depression , disease related to neuronal cell death and oxidative stress , neurodegenerative diseases such as alzheimer &# 39 ; s disease , aids - related dementia , huntington &# 39 ; s disease , and parkinson &# 39 ; s disease , hiv - related dementia complex , stroke , head trauma , cerebral palsy , conditions associated with fetal alcohol syndrome . such therapeutics can also be used in methods of enhancing learning and memory both pre - and post - natally . experiments can be carried out with the intact tubulin structure and nap as a displacing agent , or by further identification of the precise tubulin - nap interacting site ( e . g ., as described katchalski - katzir et al ., biophys chem . 100 ( 1 - 3 ): 293 - 305 ( 2003 ); chang et al ., j comput chem . 24 ( 16 ): 1987 - 98 ( 2003 )). preliminary screens can be conducted by screening for agents capable of binding to a polypeptide of the invention , as at least some of the agents so identified are likely modulators of polypeptide activity . the binding assays usually involve contacting a polypeptide of the invention with one or more test agents and allowing sufficient time for the protein and test agents to form a binding complex . any binding complexes formed can be detected using any of a number of established analytical techniques . protein binding assays include , but are not limited to , methods that measure co - precipitation , co - migration on non - denaturing sds - polyacrylamide gels , and co - migration on western blots ( see , e . g ., bennet and yamamura , ( 1985 ) neurotransmitter , hormone or drug receptor binding methods , in neurotransmitter receptor binding ( yamamura et al ., eds . ), pp . 61 - 89 . the protein utilized in such assays can be naturally expressed , cloned or synthesized . agents that are initially identified by any of the foregoing screening methods can be further tested to validate the apparent activity . preferably such studies are conducted with suitable animal models . the basic format of such methods involves administering a lead compound identified during an initial screen to an animal that serves as a model for humans and then determining if expression or activity of a polynucleotide or polypeptide of the invention is in fact upregulated . the animal models utilized in validation studies generally are mammals of any kind specific examples of suitable animals include , but are not limited to , primates , mice , and rats . in one embodiment , the elevated plus maze and the morris water maze tests are used , as described in example 1 . the agents tested as modulators of the polypeptides of the invention can be any small chemical compound , or a biological entity , such as a protein , sugar , nucleic acid , rnai , or lipid . typically , test compounds will be small chemical molecules and peptides . essentially any chemical compound can be used as a potential modulator or ligand in the assays of the invention , although most often compounds that can be dissolved in aqueous or organic ( especially dmso - based ) solutions are used . the assays are designed to screen large chemical libraries by automating the assay steps and providing compounds from any convenient source to assays , which are typically run in parallel ( e . g ., in microtiter formats on microtiter plates in robotic assays ). it will be appreciated that there are many suppliers of chemical compounds , including sigma ( st . louis , mo . ), aldrich ( st . louis , mo . ), sigma - aldrich ( st . louis , mo . ), fluka chemika - biochemica analytika ( buchs , switzerland ) and the like . modulators also include agents designed to reduce the level of mrna of the invention ( e . g . antisense molecules , ribozymes , dnazymes and the like ) or the level of translation from an mrna . in one preferred embodiment , high throughput screening methods involve providing a combinatorial chemical or peptide library containing a large number of potential therapeutic compounds ( potential modulator or ligand compounds ). such “ combinatorial chemical libraries ” or “ ligand libraries ” are then screened in one or more assays , as described herein , to identify those library members ( particular chemical species or subclasses ) that display a desired characteristic activity . the compounds thus identified can serve as conventional “ lead compounds ” or can themselves be used as potential or actual therapeutics . libraries available for screening for small active molecules include the available chemical directory ( acd , 278 , 000 compounds ), acd screening library (& gt ; 1 , 000 , 000 compounds ), crc combined chemical dictionary (˜ 350 , 000 compounds ) anisex ( 115 , 000 compounds ) maybridge ( 62 , 000 compounds ) derwent and nci libraries . the pharmaceutical compositions of the present invention are suitable for use in a variety of drug delivery systems . peptides that have the ability to cross the blood brain barrier can be administered , e . g ., systemically , nasally , etc ., using methods known to those of skill in the art . larger peptides that do not have the ability to cross the blood brain barrier can be administered to the mammalian brain via intracerebroventricular ( icv ) injection or via a cannula using techniques well known to those of skill in the art ( see , e . g ., motta & amp ; martini , proc . soc . exp . biol . med . 168 : 62 - 64 ( 1981 ); peterson et al ., biochem . pharamacol . 31 : 2807 - 2810 ( 1982 ); rzepczynski et al ., metab . brain dis . 3 : 211 - 216 ( 1988 ); leibowitz et al ., brain res . bull . 21 : 905 - 912 ( 1988 ); sramka et al ., stereotact . funct . neurosurg . 58 : 79 - 83 ( 1992 ); peng et al ., brain res . 632 : 57 - 67 ( 1993 ); chem et al ., exp . neurol . 125 : 72 - 81 ( 1994 ); nikkhah et al ., neuroscience 63 : 57 - 72 ( 1994 ); anderson et al ., j . comp . neurol . 357 : 296 - 317 ( 1995 ); and brecknell & amp ; fawcett , exp . neurol . 138 : 338 - 344 ( 1996 )). suitable formulations for use in the present invention are found in remington &# 39 ; s pharmaceutical sciences ( 17th ed . 1985 )), which is incorporated herein by reference . in addition , for a brief review of methods for drug delivery , see langer , science 249 : 1527 - 1533 ( 1990 ), which is incorporated herein by reference . suitable dose ranges are described in the examples provided herein , as well as in wo 9611948 , herein incorporated by reference in its entirety . as such , the present invention provides for therapeutic compositions or medicaments comprising one or more of the nap or adnf polypeptides described hereinabove in combination with a pharmaceutically acceptable excipient , wherein the amount of the nap or adnf polypeptide is sufficient to provide a therapeutic effect . in a therapeutic application , the nap and adnf polypeptides of the present invention are embodied in pharmaceutical compositions intended for administration by any effective means , including parenteral , topical , oral , pulmonary ( e . g . by inhalation ) or local administration . preferably , the pharmaceutical compositions are administered parenterally , e . g ., intravenously , subcutaneously , intradermally , or intramuscularly , or intranasally . thus , the invention provides compositions for parenteral administration that comprise a solution of nap or adnf polypeptide , as described above , dissolved or suspended in an acceptable carrier , preferably an aqueous carrier . a variety of aqueous carriers may be used including , for example , water , buffered water , 0 . 4 % saline , 0 . 3 % glycine , hyaluronic acid and the like . these compositions may be sterilized by conventional , well known sterilization techniques or , they may be sterile filtered . the resulting aqueous solutions may be packaged for use as is or lyophilized , the lyophilized preparation being combined with a sterile solution prior to administration . the compositions may contain pharmaceutically acceptable auxiliary substances as required to approximate physiological conditions including ph adjusting and buffering agents , tonicity adjusting agents , wetting agents and the like , such as , for example , sodium acetate , sodium lactate , sodium chloride potassium chloride , calcium chloride , sorbitan monolaurate , triethanolamine oleate , etc . for solid compositions , conventional nontoxic solid carriers may be used that include , for example , pharmaceutical grades of mannitol , lactose , starch , magnesium stearate , sodium saccharin , talcum , cellulose , glucose , sucrose , magnesium carbonate , and the like . for oral administration , a pharmaceutically acceptable nontoxic composition is formed by incorporating any of the normally employed excipients , such as those carriers previously listed , and generally 10 - 95 % of active ingredient and more preferably at a concentration of 25 %- 75 %. for aerosol administration , the nap or adnf polypeptides are preferably supplied in finely divided form along with a surfactant and propellant . the surfactant must , of course , be nontoxic , and preferably soluble in the propellant . representative of such agents are the esters or partial esters of fatty acids containing from 6 to 22 carbon atoms , such as caproic , octanoic , lauric , palmitic , stearic , linoleic , linolenic , olesteric and oleic acids with an aliphatic polyhydric alcohol or its cyclic anhydride . mixed esters , such as mixed or natural glycerides may be employed . a carrier can also be included , as desired , as with , e . g ., lecithin for intranasal delivery . an example includes a solution in which each milliliter included 7 . 5 mg nacl , 1 . 7 mg citric acid monohydrate , 3 mg disodium phosphate dihydrate and 0 . 2 mg benzalkonium chloride solution ( 50 %) ( gozes et al ., j mol neurosci . 19 ( 1 - 2 ): 167 - 70 ( 2002 )). in therapeutic applications , the nap or adnf polypeptides of the invention are administered to a patient in an amount sufficient to reduce or eliminate symptoms of anxiety and / or depression . an amount adequate to accomplish this is defined as “ therapeutically effective dose .” amounts effective for this use will depend on , for example , the particular nap or adnf polypeptide employed , the type of disease or disorder to be prevented , the manner of administration , the weight and general state of health of the patient , and the judgment of the prescribing physician . for example , an amount of polypeptide falling within the range of a 100 ng to 10 mg dose given intranasally once a day ( e . g ., in the evening ) would be a therapeutically effective amount . alternatively , dosages may be outside of this range , or on a different schedule . for example , dosages may range from 0 . 0001 mg / kg to 10 , 000 mg / kg , and will preferably be about 0 . 001 mg / kg , 0 . 1 mg / kg , 1 mg / kg , 5 mg / kg , 50 mg / kg or 500 mg / kg per dose . doses may be administered hourly , every 4 , 6 or 12 hours , with meals , daily , every 2 , 3 , 4 , 5 , 6 , or 7 days , weekly , every 2 , 3 , 4 weeks , monthly or every 2 , 3 or 4 months , or any combination thereof . the duration of dosing may be single ( acute ) dosing , or over the course of days , weeks , months , or years , depending on the condition to be treated . those skilled in the art can determine the suitable dosage , and may rely on preliminary data reported in gozes et al ., 2000 , gozes et al ., 2002 ), bassan et al . 1999 ; zemlyak et al ., regul . pept . 96 : 39 - 43 ( 2000 ); brenneman et al ., biochem . soc . trans . 28 : 452 - 455 ( 2000 ); erratum biochem soc . trans . 28 : 983 ; wilkemeyer et al . proc . natl . acad . sci . usa 100 : 8543 - 8548 ( 2003 )). intranasal administration of nap decreases anxiety - like behavior in aging mice in the elevated plus maze the present study was designed to evaluate the long - term behavioral outcome of chronic intranasal exposure to nap . nd - swiss male mice ( 8 months old ; harlan sprague dawley , inc ., indianapolis , ind .) were kept under a 12 : 12 hour light / dark regimen , with food and water available at all times . the mice were kept in the animal care facility of the tel aviv university in compliance with institutional and state guidelines . nap was custom synthesized by peninsula ( bachem , torrance , calif ., usa ) or peptide technologies ( bethesda , md ., usa ). the peptide was dissolved in a solution dd , in which each milliliter included 7 . 5 mg nacl , 1 . 7 mg citric acid monohydrate , 3 mg disodium phosphate dihydrate and 0 . 2 mg benzalkonium chloride solution ( 50 %). the peptide was administered intranasally every day , 5 days a week , 0 . 5 μg in 10 μl for each mouse , half the portion in each nostril . the control group received 10 μl of the inert carrier per day . the mice were treated at least 1 h prior to the daily experiment ( water maze ). the elevated plus maze was built in a ‘ plus ’ form with two open arms ( 68 × 7 . 5 × 1 cm ) and two closed arms ( 68 × 7 . 5 × 17 . 5 cm ) opposing each other . the center of the four arms included a middle square ( 7 . 5 × 7 . 5 cm ). the maze was elevated , at a height of 51 cm above ground level . each mouse was placed separately in the center of the maze , facing an open arm . each trial lasted 5 min . parameters measured included : ( 1 ) number of closed arms entries , an accepted index of motor function ; ( 2 ) total number of open arms entries ; ( 3 ) length of time spent in the open arms ; ( 4 ) length of time spent in the closed arms . an entry was counted only after the mouse entered the arm with all four paws . the percentage of open arm entries out of total arms entries and the percentage of time spent in the open arms , accepted measures of anxiety levels , were further calculated . mice were also subjected to two daily tests in a morris water maze ( diameter 90 cm ; depth , 20 cm ), as described in wo 01 / 092333 , incorporated herein by reference . latency to reach the hidden platform over a 90 second test period was recorded . the experiment was performed for 4 - 5 consecutive days . to measure motor functions , mice were placed on a platform for 30 seconds and then in the water facing the wall . the platform was then removed from the maze and the time spent by the mice in the pool &# 39 ; s quarter where the platform used to be was recorded ( for 90 seconds ). measurements were performed with the hvs video tracking system ( hvs image ltd ., hampton , uk ). the water maze was chosen as a test as current medication against anxiety often present a side effect of reduced cognitive functions . statistical tests used one - way analysis of variance with pairwise multiple comparison procedure ( student - newman - kuels method ). when only two groups were compared , the student t - test was used . when tested in the elevated plus maze , at 13 months age , after 5 months of chronic treatment with nap , the percentage of time spent in the open arms was significantly higher in the nap - treated mice ( fig1 a ). however , the mean percentage of open arm entries out of total arms entries , the number of closed arms entries and the total number of arms entries was similar in the control group and the nap - treated group ( fig1 b - 1 d ). when the same group of mice was re - tested 3 months later at the age of 16 months and after 8 months of chronic intranasal treatments , again measurements indicated a decreased level of anxiety . the decreased anxiety level in the nap - treated older mice was even more prominent than in the younger animals . similar to the results in 13 - month old mice , the percentage of time spent in the open arms by the 16 - month old animals was significantly higher in the nap - treated group as compared to the control group ( fig2 a ). however , in contrast to the younger mice that were treated with nap for 5 months , in the older mice , treated for 8 months , the percentage of open arm entries out of total arms entries was significantly higher in the nap treated mice ( fig2 b ). motor function indices including the number of closed arms entries and the total amount of arms entries were not significantly different between the two groups ( fig2 c and 2 d ). as anxiolytics tend to reduce learning and memory functions , long - term effects of nap exposure were assessed in a spatial memory test using the morris water maze paradigm . at the age of 15 months , and after 7 months of chronic intranasal nap treatment an apparent improvement ( measured over four testing days ) was observed in the nap - treated mice but not in the control mice , in the first daily trial , but not in the second daily trial ( fig3 , a , b respectively ). no significant differences were found when comparing the first to last daily trial in either group . yet , a comparison of a block of the first daily trial in the first and the second testing days vs . a block of the first daily trials in the third and fourth testing days showed that only the nap - treated mice were significantly faster in finding the platform in the last two days ( second block ) demonstrating learning ( p & lt ; 0 . 04 ). these experiments show a moderate improvement of spatial learning resulting from long - term exposure to intranasal nap . no differences in motor behavior were apparent in eight month or 16 - month - old mice measured as the time to reach the visible platform ( 24 + 7 . 6 ; nap and 24 + 6 . 8 ; control , eight - month - old mice ). furthermore , only a small effect was seen at 15 months in the probe test , with the nap - treated animals spending 25 . 8 + 3 . 4 sec / 90 sec in the area of the pool where the platform used to be vs . 21 . 96 + 2 . 9 in the sham - treated mice . in the elevated plus model , anxiety - like behavior is measured by the percentage of time spent in the open arms and the percentage of open arms entries . curiosity will lead mice to spend more time in the open arms which anxiety will probably make them stay in the closed , protected arms of the model . the number of closed arms entries is an accepted parameter of motor function . intranasal nap significantly increased the percentage of time spent in the open arms and longer exposure to nap also increased open arm entries , thus demonstrating reduced anxiety - like behavior in nap treated mice . furthermore , in spatial learning and memory tests , an effect was observed after long - term nap administration in aged mice , on the first daily test , indicative of reference memory . the present study was conducted to identify primary targets for nap for neuroprotection , and to identify nap binding proteins . cell cultures . rat pheochromocytoma cells ( pc12 ) were grown in dulbecco &# 39 ; s modified eagle &# 39 ; s medium ( dmem ) supplemented with 8 % fetal calf serum ( fcs ), 8 % horse donor serum , 2 mm glutamine , and 1 % penicillin streptomycin solution for 48 h . nih3t3 were grown in dmem supplemented with 10 % fetal calf serum ( fcs ), 2 mm l - glutamine , 0 . 1 mg / ml streptomycin , 100 units / ml penicillin . for the experiments , cells were harvested , resuspended and seeded in 96 well dishes at a concentration of 2 × 10 ( 4 ) cells / well . the cells were allowed to attach to the dish for 3 h and were then exposed to 300 um h 2 o 2 for 24 h . when neuroprotective activity was tested , the peptides were added while seeding . additional studies with nerve growth factor ( ngf , 0 . 1 ug / ml )- treated pc12 cells plated on collagen ( 100 ug / ml ) were conducted . in these experiments , nerve growth factor ( ngf ) was added at seeding . rat cerebral cortical cells from newborn pups were prepared as before ( bassan et al ., 1999 ). all procedures performed in these studies were conducted in accordance with the tel aviv university regulations and were approved by the animal care and use committee of tel aviv university . the use of animals was not excessive and no animal suffering occurred . in short , cerebral cortical tissue was incubated for 20 minutes at 37 ° c . in hanks &# 39 ; balanced salt solution + 15 mm hepes , ph 7 . 3 containing trypsin b ( biological industries , beit haemek , israel ). dissociated cerebral cortical cells were added to the culture dish with 5 % horse serum in dmem . cells were plated in a ratio of 1 cortex per two 75 cm 2 cell culture flasks ( polystyrene , corning , n . y .). the medium was changed 1 day after plating . for astrocyte cultures , cells were split after 10 incubation days and plated in 24 well plates ( each flask into 60 wells containing microscope cover glasses ( 12 mm diameter ) and 250 μl medium ). cells were then incubated two additional weeks . for mixed neuroglial cultures , dissociated cerebral cortical cells were plated on a bed of astrocytes 2 weeks after the split and incubated in neuron - specific medium as before ( bassan et al ., 1999 ; brenneman , & amp ; gozes , j . clin . invest . 97 : 2299 - 2307 ( 1996 ); based on forsythe & amp ; westbrook , j . physiol . 396 : 515 - 533 ( 1988 )). metabolic activity measurements . metabolic activity of viable cells in culture was measured by a calorimetric method using a tetrazolium compound [ 3 -( 4 , 5 - dimethylthiazol - 2 - yl - 5 -( 3 - carboxymethoxyphenyl )- 2 -( 4 - sulfophenyl )- 2h tetrazolium , mts ] and an electron - coupling reagent phenazine methasulfate ( pms ). mts is bio - reduced by the living cells to the formazan form that is detected at 490 nm ( promega , madison , wis .). affi - gel 10 nap affinity chromatography . a protein lysate was prepared from one - day - old rat brains in a buffer containing the following ingredients : 150 mm nacl , 1 mm edta , 50 mm tris - hcl , ph 4 . 5 , 0 . 1 % triton x - 100 , 1 % np40 and a protease inhibitor cocktail ( roche diagnostics , mannheim , germany ). dna was fragmented by sonication . cell debris was discarded following 30 minutes centrifugation at 30 , 000 × g . an affinity column containing nap was prepared using elongated nap ( kkkggnapvsipqc ( seq id no : 28 ) and affi - gel 10 in 0 . 2m nahco 3 / 0 . 5 m nacl , ph 7 . 5 . further column preparation was according to the manufacturer &# 39 ; s instructions ( amersham pharmacia biotech , ab , uppsala ). the brain extract prepared as above was loaded ( 2 mg / ml ) on the column at 20 ° c . and incubated for an hour ; the column was then washed with pbs until all unbound protein eluted as confirmed by protein assay ( bradford , biorad , mannheim ). nap - binding proteins were eluted in 0 . 1 m glycine ( ph 3 . 0 ); the eluted protein fractions were then adjusted to ph 7 . 5 with tris - hcl buffer . electrophoresis on a 12 % polyacrylamide sds - containing gel was performed as before ( zamostiano et al ., 2001 ). sulfolink coupling gel nap affinity chromatography . the second isolation efforts utilized a different affinity column , sulfolink coupling gel ( pierce , rockford , ill .). binding of ckkggnapvsipq ( seq id no : 29 ) was performed according to the manufacturer &# 39 ; s instruction . brain extract was prepared as above and binding was performed at 4 ° c . for 20 h , washing was as above and bound proteins were eluted by incubation in the presence of excess soluble nap ( napvsipq ) 2 mg / ml pbs ( 2 ml / 2 ml column ) at 4 ° c . for 20 hours . sequence analysis . to further identify nap binding protein ( s ) the polyacrylamide gel portion containing the affinity purified protein bands was subjected to in - gel proteolysis with trypsin and mass spectrometry analysis ( technion , israel institute of technology , smoler protein center , department of biology ). direct nap binding to proteins assessed by dot blot analysis . each protein ( tubulin or muscle actin ( sigma , rehovot , israel ), or non - muscle actin from human platelets ( cytoskeleton , denver , colo .) was applied on nitrocellulose membrane ( schleicher & amp ; schuell , dassel , germany ) at a concentration of 1 - 4 microgram / 1 microliter / spot and dried ( 45 min 20 ° c .). the membrane was incubated in a blocking solution ( 10 mm tris , 6 mm nacl , 0 . 05 % tween - 20 and 10 % lowfat milk ) for 16 h at 4 ° c . detection was with biotin - labeled nap ( gottlieb et al ., eur . j . biochem . 125 : 631 - 638 ( 1982 )) with excess amount of nap ( e . g ., 5 microgram ) added to tubulin ( e . g ., 1 microgram ) or actin being attached to the membrane support ). avidin - horse radish peroxidase conjugate and ecl +( western blotting detection system , amersham pharmacia biotech , buckinghamshire , uk ) was used for further identification of interacting molecules . confocal microscopy . synthetic nap or fluorescein - labeled nap ( fitc - nap ) was added to tissue culture cells ( ascending concentrations ) and incubated for 15 mins - 24 hours . after incubation , cells were extensively washed and fixed in 4 % paraformaldehyde . following fixation , triton x - 100 ( 0 . 2 % was added to allow antibody cellular penetration for mouse monoclonal tubulin antibodies ( tub 2 . 5 ; gozes & amp ; barnstable , proc . natl . acad . sci . usa 79 : 2579 - 2583 ( 1982 )) and rhodamin - labeled secondary goat antimouse igg ( jackson immunoresearch , west grove , pa .). for specific neuronal staining in primary neuronal cultures , mouse monoclonal tubulin antibodies tub2 . 1 ( gozes & amp ; barnstable , 1982 ) were used . further neuronal identification was obtained by staining with antibodies against neuron specific enolase as before ( brenneman & amp ; gozes , 1996 ). fluorescent cells were analyzed with a zeiss confocal laser scanning microscope . zeiss lsm 410 inverted ( oberkochen , germany ) is equipped with a 25 - milliwatt krypton - argon laser ( 488 and 568 nm maximum lines ). a 40 ×/ 1 . 2 w apochromat water - immersion lens ( axiovert 135m , zeiss ) was utilized for all imaging . microtubule assembly . a microtubule assembly kit cytodynamix screen 01 ( cds01 ) was obtained from cytoskeleton ( denver , colo .). bovine map - rich tubulin ( hts01 ) was resuspended in g - pem buffer ( 80 mm pipes ph 6 . 9 , 1 mm mgcl , 1 mm egta and 1 mm gtp ) and subjected to polymerization at 37 ° c . the reaction was performed in 96 - well plate . assembly was monitored with a spectrophotometer spectramax 190 ( molecular devices , sunnyvale , calif .) employing continuous recording at 350 nm . in this example , affinity chromatography of brain extracts identified tubulin , the brain major protein and subunit protein of the microtubules as a nap - binding ligand . microtubules have been shown before to be associated with the mechanism of anxiety - associated neurotransmission (( stangler et al ., 2002 ). in addition , nap binding to non - muscle actin was also detected , suggesting interaction with polymerizing proteins . tubulin and non - muscle actin nap binding was also confirmed by dot blot analysis . in a cell free system , nap stimulated tubulin assembly into microtubules . when added to cerebral cortical astrocytes , mixed neuroglial cultures or pheochromocytoma cells ( a neuronal - like model ), nap caused rapid microtubule re - organization into distinct microtubular structures . furthermore , treatment of astrocytes with zncl 2 that induces the formation of tubulin zinc sheets ( melki & amp ; carlier , biochemistry 32 ( 13 ): 3405 - 13 ( 1993 )) induced cell death as suggested before ( juarranz et al ., photochem photobiol . 73 ( 3 ): 283 - 9 ( 2001 ); haase et al ., biol . chem . 382 ( 8 ): 1227 - 34 ( 2001 ); lobner et al ., cell mol biol ( noisy - le - grand ) 46 ( 4 ): 797 - 806 ( 2000 )). co - treatment with nap inhibited the zn - associated death . these functional results support the role of nap as a microtubule stabilizing agent by direct association with tubulin . as depression may be associated with cell death ( eilat et al ., j immunol . 163 ( 1 ): 533 - 4 ( 1999 )) the neuroprotective properties of nap , through interaction with key cytoskeletal elements is suggested to protect against anxiety . nap structure is a random coil and it may require a conformational epitope on tubulin for it &# 39 ; s catalytic - like activity enucleating tubulin polymerization . regardless , the tubulin interaction site for nap offers a target platform for drug discovery against anxiety - like conditions . nap specificity : in order to test for nap specificity and establish the identity of cell systems relevant for nap activity tests , a number of cell lines were screened . the rat pheochromocytoma ( pc12 ) cell line ( a neuronal - like cell system ) responded to nap neuroprotection against the effects of oxidative stress ( see also steingart et al . j . mol . neurosci . 15 : 137 - 145 ( 2000 )). cells that did not respond to nap included african green monkey kidney cell ( cos - 7 ), adenocarcinoma cells from human breast ( mcf - 7 ) and human colon ( ht - 29 ), human fibroblasts ( bj ) as well as mouse fibroblasts ( nih3t3 ). no cell proliferation effect was seen on any of the above tested cell lines ( gozes et al ., j mol neurosci . 20 ( 3 ): 315 - 22 ( 2003 )). these results imply specificity for nap &# 39 ; s activity and suggest a nap binding protein of neuronal lineage origin . isolation of nap binding proteins by affinity chromatography : based on the previous results , brain homogenates were chosen as a putative enriched source for nap interacting molecules . extracts were subjected to affinity chromatography comprising nap bound to either affi - gel 10 or sulfolink coupling gel , two different solid supports . elution of the nap interacting molecules was obtained by either reducing the ph or by competing the binding to the insoluble nap with excess free soluble nap . electrophoresis on a 12 % polyacrylamide sds - containing gel revealed a purified protein band at about 50 , 000 dalton and an additional protein at about 42 , 000 dalton . tubulin and actin are nap binding proteins : when the gel portions containing the purified protein bands were submitted to in gel proteolysis with trypsin followed by mass spectrometry analysis , the ˜ 50 , 000 dalton nap - binding protein was identified as rat alpha tubulin ( molecular mass 50 , 242 ); gi223556 ; the second band identified was beta actin , mass 41 , 737 , gi450885 . the identification of tubulin included the characterization of 6 different tryptic peptides . a dot blot assay on a cellulose nitrate filter was performed with spotted muscle and non - muscle actin and tubulin ( 1 microgram protein / microliter / spot ). results indicated binding to brain tubulin and to non - muscle actin , while no interaction with muscle actin was detected . nap interaction with tubulin / microtubules : confocal microscopy . to further establish an association between tubulin and nap in the living cell , confocal microscopy analysis of fluorescent nap and immunodetection of tubulin was performed . as a first experiment , pc12 cells and nih3t3 cells 2 h after exposure to nap were analyzed . tubulin is a heterodimer composed of two related but non - identical , ˜ 55 - kda subunits , α - and β - tubulin that exhibit microheterogeneity ( gozes & amp ; littauer , nature 276 ( 5686 ): 411 - 3 ( 1978 ); gozes & amp ; sweadner , nature 294 ( 5840 ): 477 - 80 ( 1981 )). to visualize the microtubule structure , monoclonal beta tubulin antibodies ( tub2 . 5 ; gozes & amp ; barnstable , proc . natl . acad . sci . usa 79 : 2579 - 2583 ( 1982 )) were used . results have shown that in pc12 cells , the microtubules seemed to assume a more definitive structure after nap application . in contrast , in cells not responsive to nap , such as nih3t3 cells , no apparent change in the microtubule organization was observed . to study microtubule rearrangement in differentiated neuronal - like pc12 , cells were exposed to nerve growth factor ( ngf ). results indicated robust microtubule rearrangement ( 100 % of the cells ) in these differentiated pc12 cells as well . two additional cell populations were tested : astrocytes as well as mixed astrocytes and neurons from newborn rat cerebral cortex . either fluoresceine - labeled nap ( fitc - nap ) or native nap was added to two - week - old astrocyte cultures and to one - week - old neuronal cultures originally plated on a bed of astrocytes . astrocytes were used as a model , since previous results have indicated that while nanomolar concentrations of nap protected neuronal - enriched cultures against beta amyloid toxicity ( zemlyak et al ., 2000 ); a more potent protection at femtomolar concentrations of nap was observed when neurons were plated on a bed of astrocytes ( bassan et al ., 1999 ). in astrocytes , like in the pc12 cells , an effect of microtubule re - organization was observed . a time course experiment suggested that the microtubule re - organization effect was occurring 2 h after nap application , with the microtubules undergoing an additional condensation 4 h after nap application and returning to the original morphology 24 h after nap application . mitotic spindles were not apparent . similar microtubule re - organizations were observed with nap at concentrations ranging from 10 − 15 m - 10 − 10 m with fluoresceine - labeled and with native nap . evaluation of the number of cells undergoing microtubule re - organization following nap treatment showed maximal organization at 2 - 4 h with a decline at 24 h . a control peptide , c2 ( vlgggsall ) ( seq id no : 30 ) that does not protect neurons in vitro did not induce a microtubule - associated morphological change . detection of fluoresceine labeled nap inside cells : nap can internalize cells and exhibit structural similarity to proteins / peptides used to permeate membranes : after a 2 h incubation period at 37 ° c ., fluoresceine - labeled nap was detected inside the cell . a critical question is whether nap induces microtubule re - organization through interaction with a surface receptor , or is a pore - forming peptide that interacts with the lipid bilayer and is then internalized into cells . to evaluate potential surface labeling , initial incubation was carried out at 4 ° c . and in a parallel experiment at ph 3 . 0 . when nap ( 10 − 15 m ) was incubated with astrocytes at ph 3 . 0 for 15 minutes , microtubule reorganization was apparent and fluoresceine labeled nap was visualized inside the cells . at 4 ° c ., while microtubule reorganization did not take place , as microtubules undergo disassembly at 4 ° c ., a dose - dependent intracellular accumulation of nap was apparent . nap structural analysis suggest similarities to peptides / proteins that transverse the cellular membrane , such as the vp22 translocation domain from hsv and signal peptides such as the kaposi fibroblast growth factor ( k - fgf ) region . bacterial toxins such as the c . perfringens iota toxin , diphtheria toxin , pseudomonas exotoxin a , pertussis toxin , and b . anthracis toxin can deliver translocate peptide through the cell membrane . — do we need references here ? changes in neuronal morphology toward a differentiated neuronal structures ( neurotrophism ): previous results indicated that nap protects neurons ( e . g ., bassan et al ., 1999 ). in the assay system of mixed cerebral cortical cells from newborn rat brains , the effect of nap on the microtubule system was tested . results , using confocal microscopy as above , identified fluorescent nap in the neurons . these studies were extended to determine the degree of microtubule re - organization in the neurons using the tubulin monoclonal antibody tbu2 . 1 that shows preferential binding to neuronal tubulin ( gozes & amp ; barnstable , 1982 ) as verified by staining with antibodies directed against neuron - specific enolase . here , results showed extensive microtubule re - organization in the nap - treated neurons . further quantitations indicated that of 145 neurons counted in the control ( untreated neurons ) only 4 neurons exhibited a similar microtubule arrangement to that seen 2 h after 10 − 15 m nap treatment . after nap treatment , out of 213 cells counted , 208 exhibited the nap - related re - rearrangement , suggesting an effect on ˜ 97 % of the treated neurons . statistical analysis of the changes in neuronal morphology ( number of processes per cell ) indicated that in untreated neurons the number was 2 . 56 +/− 0 . 14 / cell ( mean +/− sem , in 62 neurons ). in nap - treated neurons the number of processes was 6 . 47 +/− 0 . 3 ( mean =+/− sem , in 64 neurons , as also found in nap 2 h - neurites ). the difference was significant ( p & lt ; 0 . 001 , student &# 39 ; s t - test ). nap promotes tubulin assembly : using a high through - put analysis kit containing bovine tubulin ( cytoskeleton , inc . ), tubulin assembly was determined in the presence of increasing nap concentrations . measurements included absorbance determinations at 350 nm . while 10 − 18 m nap did not influence microtubule assembly in the test tube , 10 − 15 m nap stimulated microtubule assembly in a similar way to paclitaxel . paclitaxel and taxol - like compounds have been suggested as possible neuroprotective agents , however , brain penetration issues and toxic side effects may exist ( rice et al ., j mol neurosci . 20 ( 3 ): 339 - 43 ( 2003 )). in contrast , nap toxicology studies to - date indicate no adverse side effects ( gozes et al ., 2000 ; gozes et al ., 2003 ). further studies also indicate nap brain penetration ( gozes et al ., 2000 ) following intranasal administration using either radiolabeled nap ( gozes et al ., 2000 ) or mass spectrometry validated assays . nap at 10 − 10 m promoted tubulin assembly t the same degree as at a concentration of 10 − 15 m . at higher concentrations of 10 − 8 m nap , no significant stimulation was observed over the 40 minutes assembly period at 37 ° c ., paralleling the dose dependent survival - promoting response curve . paclitaxel was used as a positive control and c2 a peptide that was utilized as a negative control in the cellular assay did not affect microtubule assembly as well . tubulin as a discovery platform for neuroprotective and anxiolytic drug discovery : results demonstrated that nap cellular protection is specific and is paralleled by microtubule re - organization in glial cells and in differentiated neurons . a potential mechanism of action involves internalization into cells without a classical peptide receptor , followed by direct binding to tubulin and acceleration of microtubule formation . because nap activity is selective for cells of neuronal origin ( pc12 ) not fibroblasts ( nih3t3 ) as well as to astrocytes , it suggests tubulin / microtubule microheterogeneity in these cells that is specific for nap &# 39 ; s activity ( gozes et al ., 1978 and 1981 ). microheterogeneity may result from expression of different tubulin isotypes in different cells , or it may result from post - translational modifications , or both . the nap doses required for tubulin polymerization concurred with the doses required for cellular protection against oxidative stress . nap and related peptide protection against anxiety , depression , and other anxiety disorders and mood disorders may be direct through interaction with the microtubular network or indirect through glial and neuroprotection . the examples set out above are intended to be exemplary of the effects of the invention , and are not intended to limit the embodiments or scope of the invention contemplated by the claims set out below . other variants of the invention will be readily apparent to one of ordinary skill in the art and are encompassed by the appended claims . all publications , databases , genbank sequences , go terms , patents , and patent applications cited herein are hereby incorporated by reference . this application is related to pct wo 1 / 92333 ; u . s . ser . no . 07 / 871 , 973 filed apr . 22 , 1992 , now u . s . pat . no . 5 , 767 , 240 ; u . s . ser . no . 08 / 342 , 297 , filed oct . 17 , 1994 ( published as wo96 / 11948 ), now u . s . pat . no . 6 , 174 , 862 ; u . s . ser . no . 60 / 037 , 404 , filed feb . 7 , 1997 ( published as wo98 / 35042 ); u . s . ser . no . 09 / 187 , 330 , filed nov . 11 , 1998 ( published as wo00 / 27875 ); u . s . ser . no . 09 / 267 , 511 , filed mar . 12 , 1999 ( published as wo00 / 53217 ); u . s . pat . no . 6 , 613 , 740 , u . s . ser . no . 60 / 149 , 956 , filed aug . 18 , 1999 ( published as wo01 / 12654 ); u . s . ser . no . 60 / 208 , 944 , filed may 31 , 2000 ; and u . s . ser . no . 60 / 267 , 805 , filed feb . 8 , 2001 ; herein each incorporated by reference in their entirety .

this invention relates to the use of adnf polypeptides in the treatment of anxiety and / or depression . the present invention also relates to drug discovery assays using the adnf polypeptide mechanism of action and target interaction , as well as the manufacture of medicaments , methods of application and formulation therefor . embodiments of the invention provide methods for preventing and / or treating anxiety and depression disorders in a subject by administering a nap , an 8 - amino - acid peptide derived from activity dependent neurotrophic factor , in an amount sufficient to improve postnatal performance . the adnf polypeptides include adnf i and adnf iii polypeptides , analogs , subsequences , and d - amino acid versions , and combinations thereof which contain their respective active core sites and provide neuroprotective and anti - anxiety functions .

referring first to fig1 - 2 and 6 - 7 , there is shown a vaporizer 10 which includes a cover 12 having a air grill 13 , a ptc heater 14 , an impregnated mat 16 , and a housing bottom 18 . as will be apparent from fig3 , ptc heater 14 includes a first housing part 20 , a second housing part 22 , a first electrical contact 24 , a ptc pill form heating element 26 , a second electrical contact 28 , and most importantly spring 30 . the first housing part 20 supports the first electrical contact 24 , which abuts a second side 25 of the ptc heating element 26 . the second electrical contact 28 abuts a side 27 of the ptc heating element 26 opposite the side abutting the first electrical contact 24 . as shown in fig3 and 4 , the first housing part 20 and second housing part 22 form a clamshell type housing to define a cavity 33 there between . first housing part 20 has support pegs 32 integrally formed therewith and extending into the cavity 33 . these pass the first electrical contact 24 by virtue of cut outs 37 . the ends of the spring 30 can be pinned or otherwise fastened to the support pegs 32 spanning the distance between them . the second housing part 22 also has pegs 34 protruding inwards towards the first housing part 20 . these pegs 34 help fix the first electrical contact 24 in place when the housing is closed . the first electrical contact 24 preferably comprises a flat heat diffuser plate section 36 linked by a right angle bend to an elongated leg 38 . the leg 38 forms one terminal of a linkage to the power supply , and thus after assembly extends outside the housing . there are also apertures 40 for receiving additional pegs 32 from the first housing part 20 . the ptc heating element 26 includes a first side 27 and a second side 25 . while heating element 26 is shown in a “ pill ” form , other conventional ptc element shapes could also be used . further , heating element 26 can have metallization on either or both sides ( not shown ). the second electrical contact 28 preferably comprises a u - shaped plate 50 including an elongated leg 52 extending away from the plate 50 at a right angle . elongated leg 52 forms the second terminal of a linkage to the power supply and ultimately remains extending outside the housing . there is also a curved dome having a contact portion 56 . the dome can have a convex side 62 . a spring 30 is in the form of a stainless steel strip having apertures 68 , 70 in opposing ends 72 , 74 . the apertures 68 , 70 receive the tapered ends 39 of pegs 32 in wedging fashion , to thereby suspend the spring 30 over and against second electrical contact 28 . the middle suspended portion 76 of the spring 30 is convex in shape ( i . e ., bulges outwardly , away from the second electrical contact 28 ). while stainless steel is an optimal metal for the spring in this environment , it is not optimal for the second electrical contact 28 . for that we prefer a metal such as aluminum . referring most specifically to fig5 , alternate spring embodiments 30 a and 30 b of the spring 30 are shown . for spring 30 a two of the spring 30 elements are attached to each other face - to - face to create a convex bulge 86 and a concave bulge 88 . in spring 30 b the middle portion of a single spring 30 is split lengthwise , leaving three thinner strips 80 , 82 and 84 . strips 80 and 82 are convex ( curving away from the second electrical contact 28 ), while the middle strip 84 is concave in shape ( curving toward the second electrical contact ). the convex portion 76 of the spring 30 presses against the interior side of the second housing part 22 when the housing is assembled , somewhat compressing the convex portion of the spring . the convex portion 76 is sufficiently compressed that , when the housing expands in response to the heating of the heating element 26 , the convex portion rebounds to cause the spring 30 to remain in contact with the second housing part 22 and to continue to apply pressure against the second electrical contact 28 . the convex portions 80 and 82 of alternative embodiment spring 30 b and 86 of alternative embodiment spring 30 b function in that same way . thus , regardless of the spring embodiment 30 , 30 a , 30 b used , the spring helps maintain a positive pressure contact between the second electrical contact 28 and the ptc heating element 26 , and thus indirectly between the first electrical contact 24 and the ptc heating element , even during thermal expansion of the housing . in fact , because the spring 30 receives heat directly from the heating element 26 by conduction through the second electrical contact 28 , the spring tends to expand to an extent proportionally greater than the expansion of the housing , which tends to urge the convex portion of the spring even more securely against the housing . the combination of convex and concave portions of alternative spring embodiments 30 a and 30 b allows those curved parts to be compressed so as to achieve the same overall displacement as is achieved by compression of the convex portion of spring 30 but with less distortion of each individual curved part . note also that because the parts are held close together , heat can readily transfer from the pill form heating element 26 to the heat diffusing plate portion of the first electrical contact 24 . thus , the process of transferring heat to an outer surface 92 of the ptc heater remains efficient even during thermal expansion . note that the thermal expansion problem occurs even if preferred plastics are used for the outer housing . as seen in fig6 and 7 , the heater 14 is , after final assembly enclosed by protective cover 12 and housing bottom 18 of the vaporizer 10 . the mat 16 fits between that cover and outer surface 92 . while the present invention has been described with reference to a particular embodiment , various other embodiments are possible as well . for example , it is not essential that the heater be in pill form , or even be a ptc heater . thus , the claims should be looked to in order to judge the full scope of the invention . the present invention provides a heating device with an improved spring / electrical contact assembly to adjust for heat expansion .

an electrical heating device is disclosed that is suitable to vaporize air treatment chemicals from an impregnated substrate . the device is provided with a pct heater held between electrical contacts and a spring that is compressed between the housing of the heating device and one of the electrical contacts to maintain pressure thereon in spite of thermal expansion of the housing , ensuring good electrical contact between the pct heater and the electrical contacts .

the entire device is referred to generally by the reference numeral 10 . a golf ball is referred to generally by the reference numeral 12 . a golf tee is referred to generally by the reference numeral 14 , having a head 16 , and a shank 18 . a golf club grip is referred to generally by the reference numeral 20 . the perferred embodiment of the present invention is illustrated in fig1 . the invention comprises a housing 22 , which includes an upper portion 24 , and a lower portion 26 . the upper portion 24 includes a top wall 28 , a rear wall 30 , left vertical side wall 32 , and a right vertical side wall 34 . side walls 32 and 34 incorporate a recessed portion 36 and 38 respectively to facilitate easy removal of the device 10 from the teed golf ball 12 . the lower end of the rear wall 30 contains an opening 40 that extends between the two side walls 32 and 34 . the opening 40 has a height that will permit passage of the golf tee shank 18 but will not allow passage of the golf tee head 16 and is used to facilitate the retrieval of the golf tee 14 lying horizontally on the ground . the lower portion 26 of the housing 22 includes a bottom wall 42 which contains a slot 44 that extends inward from the edge of the bottom wall 42 . the slot 44 terminates with a rounded end 46 . the entire wall of the slot 44 is angled such that the slot is larger on the top surface of the bottom wall 42 than the bottom surface of the bottom wall 42 . the edges of the housing 22 are typically chamfered or rounded to avoid snagging or personal injury . attached to the lower surface of the top wall 28 is a delayed urging means 48 which exhibits a delayed rebound after being compressed . examples of such delayed urging means 48 are the isodamp ® c - 3000 series of energy absorbing foams manufactured by e - a - r division , cabot corporation , indianapolis , ind . these foams rebound very slowly after being compressed . in the preferred embodiment , a cylindrical piece of e - a - r c - 3002 - 50 low - recovery foam is used . however , means other than low - recovery foam could be used to provide a delayed urging function . the delayed urging means 48 is typically fastened to the top wall 28 by means of an adhesive . the placement of the delayed urging means 48 on the underside of the top wall 28 is such that it will be directly over the golf ball 12 when placed in the housing 22 . attached to the bottom of the delayed urging means 48 is a rigid ball interface member 50 used to provide a uniform surface to contact the golf ball 12 . in the preferred embodiment , this member is a ring shaped object with an outer diameter equal to the delayed urging means 48 diameter and an inner diameter sufficiently large enough to provide engagement of the golf ball 12 . however interface members of other shapes would equally suffice . the interface member 50 is typically attached to the delayed urging means 48 by means of an adhesive . fig3 shows a better view of the interface member 50 . the housing 22 height , interface member 50 size , slot 44 dimensions , and delayed urging means 48 size all affect the performance of the device 10 . this combination of dimensions must be such that when the golf ball 12 is placed in the housing 22 below the interface member 50 and the golf tee 14 is slid into the slot underneath the ball 12 , the delayed urging means 48 is slightly compressed exerting enough of a downward force to securely hold the ball 12 and tee 14 into the device 10 . additionally , these dimensions must be such that the delayed urging means 48 sufficiently further compresses due to the upward force on the tee 14 when the device 10 is used to insert the tee 14 into the ground . in the preferred embodiment , the interior height of housing 22 is 2 . 24 inches , slot 44 is 0 . 36 inches wide with angled walls at 21 °, the interface member height is 0 . 12 inches with an inner diameter of 0 . 64 inches , and the delayed urging means 48 has a diameter of 0 . 75 inches and a height of 0 . 50 inches in its uncompressed state . these dimensions describe one possible embodiment of the invention . other combinations of dimension values could also be used to achieve successful operation of the device 10 . extending from the upper side of the top wall 28 is the portion used to attach the device 10 to a golf club grip 20 as shown in fig4 . from the top wall 28 , an annular wall 52 extends upward vertically and then flares outward becoming a taper 54 . the annular wall 52 provides clearance for the end of the golf club grip 20 which is often convex in shape . the taper 54 ensures that the device 10 is aligned with the axis of the golf club by centering the end of the golf club grip 20 . the diameters at the bottom and top of the taper 54 are sized to accommodate the full range of golf club grip 20 diameters available in the market place . above the taper 54 the wall angles inward forming a plurality of individual gripping fingers 56 capable of flexing outward . in the preferred embodiment four gripping fingers 56 are used ; however , any number greater or equal to two would work . fig1 shows how the gripping fingers 56 are separated from each other by voids 58 . the voids 58 incorporate rounded bottoms 60 to reduce stress concentrations in the flexing material . the gripping fingers 56 are of sufficient height to prevent the device 10 from becoming skewed with respect to the axis of the golf club . fig4 shows how the gripping fingers 56 incorporate outward flares 62 at the top to provide easy insertion of the golf club grip 20 . the very top of the gripping fingers 56 incorporate chamfered edges 64 to also aid in the insertion of the golf club grip 20 . fig1 shows a series of supporting ribs 66 used to provide strength to the annular wall 52 and to the taper 54 below the gripping fingers 56 . these ribs 66 ensure that the stress created in the material during insertion of a golf club grip 20 will not cause a fracture in the material . fig2 shows a clip 68 extending from the rear of the housing 22 just above the opening 40 . the clip 68 is shaped with a large enough radius 70 to permit the device 10 to be clipped to the side of a typical golf bag . the clip 68 incorporates an inward bend 72 towards the housing 22 permitting the device 10 to be securely clipped to the pocket of a golfer &# 39 ; s clothing . an outward bend 74 at the top of the clip 68 allows the device 10 to be easily clipped to a golf bag , pocket , or belt . in the preferred embodiment the entire device 10 , except delayed urging means 48 , is molded from an economical , flexible plastic material such as abs . however , the device 10 can consist of any other material that exhibits the elasticity and impact resistance characteristics suitable for the application . from the description above , a number of advantages of the present invention become evident : ( a ) the device automatically unclamps the ball and tee once the tee is pushed into the ground since the delayed urging means becomes further compressed and will not immediately rebound . ( b ) the golfer can use a golf club as the device handle since no handle mounted unclamping control is needed . ( c ) the device makes it possible to tee up a golf ball from a standing position without the cumbersome use of relatively very large prior mechanisms . ( d ) the device allows a golfer to tee up golf balls without bending over by only carrying a small , lightweight device during a golf outing . ( e ) the device can be used to retrieve golf tees from the ground even if they are in a horizontal orientation . in use , the golfer removes the desired golf club from the golf bag and then unclips the device 10 from the golf bag , a pocket , a belt , or wherever the device 10 is stored . the device 10 is then attached to the golf club by pushing the gripping fingers 56 fully onto the end of the golf club grip 20 until the end of grip 20 comes in contact with the taper 54 . a golf ball 12 is then placed in the housing 22 below the ball interface member 50 . a golf tee 14 is then slid into slot 44 causing the ball 12 to push against the interface member 50 somewhat compressing the delayed urging means 48 . the delayed urging means 48 exerts a downward force on the ball 12 clamping the ball 12 and tee 14 securely to the device 10 as shown in fig5 a the golf club is then held by the golfer at the club head end with the grip end towards the ground . the golf club is positioned in a vertical orientation with the shaft of the golf club perpendicular to the ground . the golfer holds the golf club at a height such that the tip of the golf tee 14 is a short distance above the ground as also shown in fig5 a . the golfer then moves the golf club straight down sinking the golf tee 14 into the ground . as the tee 14 enters the ground it exerts an upward force on the ball 12 causing the delayed urging means 48 to substantially compress . as this happens , the device 10 lowers with respect to the ball 12 and tee 14 such that the slot 44 is no longer in full contact with the underside of the tee head 16 as shown in fig5 b . once the golf tee 14 has been sunk to the desired depth into the ground , the golfer releases the ball 12 and tee 14 from the device 10 by slightly moving the golf club straight up until the interface member 50 no longer is in contact with the ball as shown in fig5 c . the delayed urging means 48 remains compressed for a period of several seconds allowing the device 10 to be laterally removed from the teed ball 12 by moving the golf club in a motion parallel to the ground . after teeing up the ball 12 , the golfer then pulls the device 10 off the end of the golf club and uses clip 68 to temporarily fasten the device 10 to a pocket or belt while the ball 12 is hit . the device 10 can then be reinstalled on the golf club grip 20 to be used to retrieve the golf tee 14 without bending over . for instances when the tee 14 remains in the ground while hitting the ball 12 , the golfer uses the golf club as a long handle and maneuvers slot 44 of the device 10 under the head 16 of the tee 14 . the tee 14 can then be pulled out of the ground and retrieved without bending . for instances when the tee 14 comes out of the ground while hitting the ball 12 and is lying horizontally on the ground , the golfer again uses the golf club as a long handle and retrieves the tee 14 using the device 10 . this is accomplished by maneuvering the bottom wall 42 of housing 22 underneath the shank 18 of the tee such that the tip of the tee 14 protrudes through opening 40 of the housing 22 . the opening 40 will not permit passage of the tee head 16 allowing the tee 14 to be scooped up without bending . accordingly , this invention allows a golfer to easily tee up a golf ball without bending over . in addition , the invention permits a golfer to easily retrieve a golf tee without bending over whether or not the tee came out of the ground while hitting the ball . furthermore , the teeing device has the additional advantages in that it permits a golf club to be utilized as the handle reducing the weight and size of the device ; it is very simple to use with no cumbersome controls to release the tee and ball ; it can easily and nonintrusively be clipped onto a golfer &# 39 ; s apparel while hitting the ball ; it can be made from far fewer parts than prior tee setting devices . although the description above contains many specifics , these should not be construed as limiting the scope of the invention but as merely providing illustrations of some of the presently preferred embodiments of this invention . for example , a means other than low - recovery foam could be used to provide a delayed urging means . furthermore , the dimensions given of the housing , interface member , low - recovery material , and slot could be different , the ball interface member could be eliminated ; the gripping fingers could be of a different shape , the clip could be shaped differently , the supporting ribs could be eliminated , etc . thus the scope of the invention should be determined by the appended claims and their legal equivalents , rather than by the examples given .

a small , lightweight golf ball teeing device is disclosed for allowing a golfer to tee up a golf ball without bending over using a golf club as a handle for the device . a housing positions the golf ball over the golf tee . a delayed urging means is used to clamp the ball and tee to the housing . while the tee is inserted into the ground , the delayed urging means compresses and rebounds slowly releasing the ball and tee from the device . gripping fingers are positioned on top of the housing to provide a secure , aligned attachment to a golf club grip . an opening in the housing permits horizontal golf tees to be scooped up without bending . a clip is incorporated with the housing to provide attachment to golf bags , belts , etc .

hospital beds typically include a deck supporting a mattress or other patient support element ( not shown in the figs .). the deck may be divided into articulated sections so as to create various seating and lying down configurations . articulated beds with a controllable articulation system for the patient support surface are known and are not a novel and inventive part of embodiments of the subject disclosure so will not be described in detail . an example of such an articulated patient support surface is shown in ep 2 181 685 and wo 2004 / 021952 to which reference should now be made and whose contents are hereby expressly incorporated herein by reference . referring to fig1 to 3 , a hospital bed support assembly according to one embodiment of the present disclosure includes a deck support frame 3 to which a headboard and a footboard may be mounted at , respectively , its head 4 and foot 5 ends . the head board is mountable on head board plates 33 and the foot board on foot board plates 34 . the deck support frame has two leg or support structures 6 pivotally mounted to its under surface . each of the leg structures or assemblies 6 includes a pair of legs 7 each coupled to the deck support frame 3 by a moveable upper pivot or guide element 8 at their deck or upper end 9 . the moveable upper guide elements can move parallel to the longitudinal axis of the deck frame . for example , the moveable upper guide element 8 of the left - hand leg in fig2 and 3 can move in the directions shown by arrows d1 and d2 . the lower portions of the legs 7 of each pair of legs are connected together by a lower bracing cross - element 10 at the bottom 12 of the legs . the lower cross - elements 10 are each in turn connected to a lower longitudinal or side element and able to rotate about their longitudinal axis . in the embodiment shown in fig1 to 3 , each end of the foot end leg assembly lower cross - element is pivotally connected to a lower portion of a respective length extension element and the upper portion of each length extension element is pivotally connected to the lower longitudinal side element . the foot and head ends of the lower side elements 35 each have a castor or castor device 14 so that the support assembly can move over a floor or surface on which it is placed . a pair of stabilizer elements 16 is connected to each pair of legs . a stabilizer element is connected to and links each leg to the underside of the deck support frame . the stabilizer elements 16 , which are each coupled to a leg 7 , are pivotally connected at their first upper ends 17 to the underside of the deck support frame 3 . the upper ends 17 of each stabilizer are connected to a fixed upper pivot 18 displaced from the leg upper moveable pivot 8 of the respective leg , and are pivotally connected at their second lower ends 19 to the respective pair of legs at a pair of respective lower stabilizer pivots 20 . a stabilizer cross - element 37 is pivotally connected between the pair of stabilizers 16 for each leg assembly . the respective stabilizer cross - element is connected to each respective stabilizer at a point 36 between its upper 17 and lower 19 ends . an actuator - stabilizer yoke 21 is connected to each stabilizer cross - element at a point substantially mid - way along the stabilizer cross - element so that it is in the middle of the bed . the actuator - stabilizer yoke 21 is pivotally coupled to an end of an actuator 22 ( which may be a hydraulic actuator , or a linear actuator such as model no la27 actuators supplied by linak u . s . inc . located at 2200 stanley gault parkway , louisville ky . 40223 ) which controllably extends and retracts an actuator rod 23 connected to the actuator - stabilizer yoke 21 . extension and retraction of the actuator rod 23 causes the respective stabilizer cross - element 37 and hence the pair of stabilizers 16 connected to that stabilizer cross - element 37 to move and thence the pair of legs 7 connected to that stabilizer 16 to rotate relative to the deck support frame 3 and thence raises or lowers the deck support frame 3 and the patient support surface arranged on that deck support frame . the actuators 22 may be controlled by either the patient or a care - giver . control mechanisms for such actuators are well known and may be either a foot operated pedal , control panel on the side of the bed , remote control or other control mechanism . suitable actuators are well known and are therefore not described in detail in this application . they may be hydraulic , electric or pneumatic . an example of hydraulic actuators controlling the height of a deck is described in ep 2 181 685 and wo 2004 / 021952 . referring to fig1 , the deck support frame 3 is formed by three sides of a rectangle and comprises parallel side elements 24 connected at their head ends by a head frame element 25 . in the described embodiment there is no foot frame element closing the rectangle other than the foot board ( not shown ) when that is attached to the foot board plates 34 ( not shown ) but one could be provided if appropriate . one of the known patient support deck arrangements such as that described in ep 2 181 685 and wo 2004 / 021952 may be secured to the patient support frame . as shown in , for example , fig4 , the side rail elements each comprise a hollow channel element open , along at least a portion of its length , on its lower side 27 . the channel element is a modified inverted u - shaped channel in which a portion of the bottom edges 28 are lipped such that the sides of the channel extend partially across the bottom of the inverted u - shaped channel . the upper end of each leg is connected to two rollers 29 . the rollers 29 are supported on axles 30 running through the leg 7 and can rotate relative to the leg 7 . the upper end 31 of each leg passes through the gap or space 32 in the bottom of the channel elements 24 defining the sides of the deck support frame . the rollers 29 each engage the inner surface of the channel element . referring to fig2 and 3 , when the actuators 22 extend their respective rods 23 together to move the deck support frame 3 from a lowered position ( see fig3 ) to a raised position ( see fig2 ), the stabilizer element moves in direction e and pivots about its upper pivot . at the same time , the leg element pivots in direction f with its respective guide element moving in direction d1 . as the guide element moves in direction d1 while the deck support surface is being raised , the respective set of rollers 29 roll relative to the respective channel element 24 . when the actuators 22 retract their respective rods 23 together to move the deck support surface from a raised position ( fig2 ) to a lowered position ( fig3 ), the stabilizer element moves in direction g and pivots about its upper pivot . at the same time , the leg element pivots in direction h with its respective guide element moving in direction d2 . as the guide element moves in direction d2 while the deck support surface is being raised , the rollers roll relative to the channel element . movement of the legs 7 and associated rollers 29 brought about by extension of the actuator rod to raise the deck support frame , pushes the rollers against the inner surface of the top of the respective channel element 24 so the roller rolls against that inner top surface of the channel . when the deck support frame is lowered by retraction of the actuator rod , the weight of the deck support frame and the patient support surface and patient supported thereon presses the inner top surface of the channel 24 against the respective rollers so that again the rollers roll along that top inner surface . the channel 24 is provided along a substantial part of its length with a lip portion 28 welded or otherwise attached to each of the bottom edges of the two sides of the channel element . this helps hold the rollers in place and , if the patient support deck is lifted manually or otherwise than using the actuators , pushes up against the bottom of the rollers such that they roll against the lipped bottom edges 28 . moving the deck support frame into the trendelenburg position or reverse trendelenburg position is not illustrated in the figs . however , it is achieved by having one of the leg assemblies in the raised position and the other in the lowered position and is otherwise the same as for lowering or raising the whole height of a substantially horizontal deck support frame . for the trendelenburg position the foot end is raised to be about 15 - 30 degrees above the head end , whereas in the reverse trendelenburg the head end is raised to be above the foot end . in a one embodiment of the patient support apparatus according to the present disclosure , at least one of the castors and / or castor devices at each of the foot and head ends of the apparatus are provided with a brake assembly with a brake lever as described in , for example , u . s . pat . no . 7 , 703 , 157 and arranged to be contacted and pressed down by the lower surface of the channel element to lock or brake the respective castor or castor device when the respective portion of the deck support frame is lowered . each of the castors includes a braking mechanism . fig5 to 7 show how a braking mechanism of the type used in castors of the type supplied by tente as parts reference 5944 usc125 r36 may be incorporated in an embodiment according to the present disclosure . in such castors , the castor wheels 38 are braked when a pliable braking element 39 is squeezed down by a braking surface 40 so that the sides of the braking element contact and push against the sides of the castor wheels . an alternative braking element is shown in u . s . pat . no . 7 , 703 , 157 in which braking is by means of a floor engaging element which is pushed into contact with the floor when the braking surface is ousted downwards . any castor with an actuator mechanism operable by being pressed down or contacted may be used . the braking surface 40 at the foot ends of the bed is pushed downward by the action of a braking lever 41 which may be actuated by , for example , the foot of a care giver on , as is shown in fig5 to 7 , by contact with the underside of the channel element 24 as the bed is lowered to the lowermost position . the use of a guide element 8 which moves inside a channel 24 allows one to position the longitudinal channel 24 closer to the edges of the bed than is possible with the previous arrangements with a guide element on the outside of a channel . this means that the channel or longitudinal rod 24 can be positioned so it moves in a place sufficiently close to the wheels to itself directly engage the brake lever 41 . the brake surfaces ( not shown ) of the head end castors are connected to a respective foot end braking levers 41 by a rod element running inside each of the lower rail elements 35 . movement of the braking lever 41 causes the rod to rotate and hence push the braking surfaces associated with the head end castors to move and hence brake or release the head end castors . although certain illustrative embodiments have been described in detail above , variations and modifications exist within the scope and spirit of this disclosure as described and as defined in the following claims .

a patient support apparatus includes a frame having a first portion that is movable between a raised position and a lowered position to change an elevation at which a person is supported above a floor . castors are coupled to the frame and are configured to rest upon the floor . an actuator is movable between a brake position in which at least one castor of the castors is braked and a release position in which the at least one castor is released . as the first portion of the frame is moved to the lowered position , the first portion automatically engages the actuator and moves the actuator to the brake position thereby to automatically brake the at least one castor .

the apparatus illustrated very diagrammatically in fig1 . comprises a probe 10 , a measuring device 30 and a flexible connection 20 in fiber optics connecting the measuring device to the probe 10 . the probe 10 is designed to be placed in contact with the skin p in order to light up the part of the skin surface requiring to be examined . the connection 20 comprises three optical channels 21 , 22 , channel 21 conveys to the probe the light produced from a light - emitting device 31 in order to illuminate the skin surface to be examined . channel 22 transmits to a receiving device 32 the light reflected specularly ( normally ) by the examined part of surface whereas channel 23 transmits to the receiving device part of the light reflected in non - specular or diffuse manner . in the illustrated example , the diffuse reflection is measured in the direction opposite to the direction of incidence of the light on the surface to be examined . channels 21 and 23 can therefore be re - grouped , at least at their end portions connected to the probe , into a bi - directional optical cable . the emitting 31 and receiving 32 devices are connected to a control and processing device 33 via an interface circuit 34 . said device 31 comprises means of regulating the intensity of the emitted light and is operated by control signals issued by the processing device 33 . the receiving device 32 comprises photo - electrical transducers working out electrical signals representing the normal reflection and the diffuse reflection . said signals are transmitted to processing device 33 through the interface circuit 34 , this transmission being achieved under the control of signals produced by the processing device . in conventional manner , said processing device 33 comprises memory circuits 35 , an arithmetical and logical unit 36 and interface circuits 37 permitting the connection with a display device 38 , such as a cathod ray tube , with a keyboard 39 and with a printer 40 . the processing device may be constituted by any of the existing micro - computers , therefore it will not be described any further herein . supply of the different circuits of the apparatus is ensured by supply circuits ( not shown ). fig2 is a diagrammatical cross - section showing the probe 10 in more details . said probe 10 comprises a casing 11 of which the front face 12 is provided in its center with an opening 13 such as of circular shape . the casing also presents two connecting parts 14 , 15 in which are respectively secured the ends of channels 21 and 23 and the end of channel 22 . channels 21 , 23 are re - grouped at their ends into a bidirectional optical cable 24 provided with an end socket 25 screwed into the connecting part 14 , whereas optical cable 26 forming the channel 22 is provided with a ring 27 and is inserted in a tubular guide 17 housed in the connecting part 15 . the axis of optical cable 24 , namely the axis of connecting part 14 , traverses the center of aperture 13 and is inclined with respect to the perpendicular n to the front face 12 of an angle i , said angle i corresponding to the angle selected for the incidence under which the part of skin surface to be examined is illuminated . in the illustrated example , the angle of incidence i is equal to about 45 °, but another value could also be selected . the axis of optical cable 26 , namely the axis of connecting part 15 is symmetrical to the axis of cable 24 with respect to the perpendicular n traversing the center of aperture 13 since channel 22 is designed to pick up the normally reflected light . cables 24 and 26 are secured to the casing 11 in such a way that the ends of the fiber optics composing them are at predetermined distances d1 and d2 from the center of aperture 13 . adjustment of the position of the end of cable 24 is achieved by interposition of wedges 16 between the socket 25 and the connecting part 14 whereas the end of cable 26 is fixed in the required position in the guide 17 by a locking screw 18 traversing the connecting part 15 and resting against the ring 37 . by way of example , distances d1 and d2 are about 20 mm . the use of a flexible connection composed of fiber optics of which the ends are secured to the probe , presents several advantages . for example , the probe may be small , its overall dimensions being determined by the connecting means of the optical cables . moreover , the probe has no optical elements such as lenses which require high positioning accuracy . the measuring area , determined by the size of aperture 13 may then be small enough to allow significant measurements over a surface with as little rigidity and uniformity as the skin . for example , the surface of the measuring area may be between 10 and 50 mm2 , such as about 25 mm2 . the miniaturization of the probe and its flexible connection with the rest of the apparatus , also allow ready handling for taking measurements over different areas of the skin surface . fig3 diagrammatically illustrates the structure of the emitter of the light emitting device 31 . said emitter comprises a casing 311 to which is connected the starting end of optical channel 21 . said casing 311 is provided with walls 312 used as support for the different elements housed in the casing . the light source is a lamp 314 with tungsten filament . the beam produced by the lamp is focussed by means of a lens 315 in order to obtain an adequate light intensity at the input 21a to optical channel 21 . an infrared filter 316 may be interposed between the lamp 314 and the input to optical channel 21 in order to carry out measurements within the field of the infrared - free visible light . two photodiodes 317 , 318 are placed on both sides of the input to optical channel 21 so as to supply signals representing the light intensity at that input . photodiodes 317 and 318 are connected to a circuit 319 for regulating the light intensity produced by lamp 314 . regulation circuit 319 ( fig4 ) comprises a source of voltage consisting of a transistor t1 of which the collector is at potential + v of a supply source and the emitter is connected to a terminal at the reference potential ( earth ) via the lamp 314 . photodiodes 317 , 318 are connected to an amplifier circuit amp which delivers a voltage v mes representing the real intensity of the light beam applied to the input of channel 21 . voltage v mes is compared to a reference voltage v ref , supplied by a voltage - adjustable generator sv ; the comparison is carried out by means of a differential circuit cp which delivers a voltage v com which is function of the difference between v ref and v mes . the voltage v com is applied to the base of t1 and determines the voltage in the lamp 314 so as to return towards zero the difference between voltages v ref and v mes . the circuit 319 receives a start control signal sca applied via a resistor r1 to the base of a transistor t2 . the emitter thereof is connected to earth whereas its collector is connected , on the one hand , to the voltage source + v via a resistor r2 and , on the other hand , to the base of a transistor t3 via a resistor r3 . transistor t3 has its emitter - collector circuit connected between the base of t1 and the earth . when the start control signal is at a level between the triggering signal of transistor t2 ( sca = 0 , or low logic level ), transistor 2 is in the off state , but transistor t3 is in the on state , bringing the base of t1 to the earth potential ; lamp 314 is switched off . when the on control signal exceeds the triggering threshold of t2 ( sca = 1 , or high logic level ), transistor t2 is turned to the on state , this keeping t3 in the off state and lamp 314 is switched on , the intensity of the current through the lamp being determined by v com . two photodiodes 322 , 323 receive light beams transmitted respectively by optical channels 22 , 23 . diodes 322 , 323 are silicon diodes connected in reverse . the cathodes of diodes 322 , 323 are connected to the middle point of a voltage divider formed by two resistors r4 , r5 connected in series between the earth and a terminal of potential v . diodes 322 , 323 thus produce a voltage substantially proportional to the intensity of the picked up light beams . the anodes of diodes 322 , 323 are connected to two input contacts of an analog switch 324 of which the output contact is connected to the input of a logarithmic amplifier apl producing an analog signal s rfx representative of the specular reflection or of the diffuse reflection , depending on the position of switch 324 . the use of a logarithmic amplifier procures greater dynamics . moreover , the human eye constituting a logarithmic type receiver , the measuring apparatus makes it possible to come closer to the visual judgement which it is required to quantify . the receiving device receives a switch control signal scm controlling the position of the switch . for example , when signal scm has a high logic level ( scm = 1 ), switch 324 connects photodiode 232 with amplifier apl to measure the specular reflection , whereas when signal scm has a low logical level ( scm = 0 ) switch 234 connects photodiode 233 to amplifier apl to measure the diffuse reflection . interface circuit 34 comprises an analog - to - digital converter can which receives the signal s rfx to convert it in the form of a digit word n rfx of n bits . a connection circuit pia (&# 34 ; parallel interface adapter &# 34 ;) is interposed between the converter can and the micro - computer 33 . said circuit pia also transmits signals sca and scm as well as the control signals of converter can . circuit pia is controlled in known manner by control signals produced by the micro - computer . the emitting and receiving devices are controlled to produce a reflectance measurement from the specular and diffuse reflection values ; in the illustrated case , the worked out value represents the difference between the specular reflection intensity and the diffuse reflection intensity . moreover , in order to take into account the influence of ambient light , the reflection is measured according to a principle of &# 34 ; synchronous detection &# 34 ; namely by alternately controlling the switching on and off of the light source . the light flux φs carried by channel 22 ( specular reflection is composed of flux φsp effectively reflected by the skin , of flux φsa coming from the outside ( ambient light ) and from leaks from the detectors , and of flux φss sent back by the casing of the probe . likewise , the light flux φd carried by channel 23 ( diffuse reflection ) comprises components φdp , φda and φds . during a measuring cycle , the flux φda , φsa are successively measured by actuating switch 324 , the lamp being switched off , then after switching the lamp on , the flux φs and φd are measured successively by actuating the switch 324 . k being a corrective factor taking into account the geometry of the probe and of the optical channels 22 , 23 since the reflectance is assessed by differences between intensities of the specular and diffuse reflections , and not by differences between flux . the quantities φss , φds and k are determined by calibration . by placing the probe before a light trap ( instead of the skin ) φsa + φss and φda + φds are measured , when the lamp is switched on , and φsa and φda are measured when the lamp is switched off , wherefrom φss and φds are deduced . the value of k is thereafter determined by placing the probe before a matt surface used as a reference of nil reflectance ( re = 0 ) by measuring φd , φs , φda and φss , and by calculating : a scale coefficient sc is also determined by placing the probe before a reflecting surface of reference such as a calibrated mirror at 80 % reflection , the reflectance being then arbitrarily fixed to a predetermined value rem ( for example 1000 ). after measuring φd , φs , and φss , the coefficient sc is determined by dividing rem by the quantity : the values of φss , φds , k and sc , determined by calibration , are stored in the memory circuits 34 of the micro - computer . fig5 shows the variation in time of voltage s rfx in output of logarithmic amplifier apl . the times t . sub . φsa , t . sub . φda , t . sub . φd , t . sub . φs correspond to the times of measurement of quantities φsa , φda , φd and φs . the times t a and t e correspond to the switching on and switching off of the lamp , whereas times t s and t d correspond to the times of actuation of switch 234 , respectively , towards photodiode 232 ( specular reflection ) and towards photodiode 233 ( diffuse reflection ). the successive measuring cycles are performed under the control of the micro - computer . the duration of one cycle may be less than 1 sec ., for example around 0 . 7 sec ., said duration being for example function of the times necessary for the stabilization of the lamp when this is switched on and off . the values of reflectance re calculated during successive measurement cycles are displayed as successive positions of a cursor on the screen of tube 38 . the operator can thus correct any incorrect positioning of the probe by observing the position variations in y - axis of the cursor when moving the probe slightly . instantaneous display of the reflectance calculated value thus contributes to positioning the probe . the reflectance value finally retained may be a mean value worked out from the results of a predetermined number of measurement cycles . said final value may be edited on the printer 40 and is displayed on the screen . the resulting reflectance value is recorded in a computer file which may contain other information concerning the patient whose skin is being examined , the date of examination and any special conditions of examination . the recorded information may be edited on paper via the printer , at the operator &# 39 ; s request . the main programme including the operations of initialization of the system and the subroutines of recording on file and file readout are not specific phases of the proposed application ; therefore they are not explained hereinafter in details . the measuring and calibrating operations use programmes such as per flow - charts illustrated in fig6 and 7 . initialization of the graph , and tracing of the outline of the screen with a view to displaying the measurement results as a curve representing the variation of the reflectance ( phase 400 ); positioning of the cursor in abscissa l = 1 on the screen ( phase 401 ); if the operator , by actuating the keyboard , requests the exit of the subroutine ( test 403 ), return to the main programme ; if the operator , by actuating the keyboard , requests an integration on the reflectance values obtained during the successive cycles of measurement ( test 404 ), a subroutine ( 420 ) is called during which a test is carried out on the positioning of an averaging indicator ( e =- 1 ! ), so as , in the affirmative , to arrive at end of averaging , to return indicator e to zero , and to return to the programme , and , in the negative , to bring sum s and parameter n to zero , to position e to - 1 and to return to the programme ; measurement of the flux φda , the signals sca and scm being in zero position , and readout of the corresponding digital value ( phase 405 ); switching from channel 23 to channel 22 by placing scm in position 1 , measurement of flux φsa and readout of the corresponding digital value ( phase 406 ); switching on of the lamp by bringing sca to position 1 , measurement of the flux φs and readout of the corresponding digital value ( phase 407 ); switching from channel 22 to channel 23 by bringing scm to position 0 ; measurement of φd and readout of the corresponding digital value ( phase 408 ); calculation of re from the readout values of φda , φsa , φs and φd , and of the pre - recorded values of φss , φds , k and fe ( phase 409 ) if an integration is called ( test 410 ) calling of a summation subroutine 430 including updating of sum s ( s = s + re ), incrementing of n ( n = n + 1 ), calculation of an &# 34 ; instant mean value &# 34 ; of reflectance m i ( re )= s / n , control of the display on the screen of the digital value of m i ( re ) and return to the programme ; editing of the digital values of re or , optionally , of m i ( re )( phase 411 ); graphic display of the digital value of re by control of the ordinate of the cursor on the screen ( phase 412 ); if the value of l is equal to the maximum abscissa possible l max ( test 414 ), clearing of the screen ( phase 415 ) and return to initialization of the graph , if not , return to phase 402 ; display on the screen of a message ( phase 503 ) for placing the probe before the surface corresponding to the constant value to be determined ( light trap , matt surface of reference , reference mirror ); if the operator , by actuating the keyboard , requests the exit of the subroutine ( test 505 ), return to the main programme without changing the calibration ; for every constant to be determined k1 to k4 ( k1 = φss , k2 = φds , k3 = k and k4 = sc ), performance of m successive cycles of measurement , for example 10 cycles , ( phase 506 ) each one including : measurements of flux φda , φsa , φs and φd ( phases 405 to 408 of the aforesaid measuring programme ): calculations of mean value and standard deviation for every constant ( phase 507 ), namely mean value xi = si / m , standard deviation vi = σi / m - xi 2 and reduced standard deviation if the reduced standard deviation is greater than a predetermined threshold ( test 509 ), it is displayed on the screen , if not , then direct passage to the next phase ; if the operator , by actuating the keyboard , requests a new assessment of the same constant ( test 512 ), return to phase 503 ; if the operator , by actuating the keyboard , requests that the new constant be kept ( test 513 ), then ki = xi ( phase 514 ) and passage to the next constant ( phase 515 ); if the operator , by actuating the keyboard , refuses the value xi ( test 516 ), then the actual value of the constant is kept ( phase 517 ) with passage to the next constant ( phase 515 ); if the operator , by actuating the keyboard , requests the exit ( test 518 ), then return to the main programme without modifying the calibration ; when passing to the next constant ( phase 515 ) and if the four constants have not yet been calculated ( test 519 ), return to phase 503 ; if all the constants have been calculated , exit with modification of the calibration and return to the main programme . tests have been conducted with a mesuring apparatus suc as described hereinabove by using a scale of reflectance re ranging from 0 for the matt surface of reference to 1000 for the reflecting surface of reference ( mirror with 80 % reflection ). the measurements taken on 34 people have given reflectance values within a range of 8 to 12 . 5 for the fore - arm and from 6 to 13 . 9 for the forehead . in the case of people ( 7 cases ) whose skin appears to be greasy to the eye , the mean reflectance value measure on the forehead has been 11 . 7 , to be compared with the general means value of 9 . 56 obtained from measurements taken in 32 random cases . moreover , measurements taken on five subjects have shown a deviation of 5 . 4 between the mean reflectance values obtained before and after application of &# 34 ; vaselin &# 34 ; on the fore - arm . these results show the effective correlation between the visual aspect of reflectance and the measurements taken , thereby justifying the use of the measuring apparatus according to the invention as an &# 34 ; objective &# 34 ; means of quantifying the reflectance of the skin .

a probe comprising a casing of which one face which will be in contact with the skin is providied with an aperture , is connected to a measuring device by means of a flexible connection in fiber optics comprising at least three optical conductors which , at a first end , are secured in the casing of the probe such as to face the aperture thereof , the first and second conductors having their first end portions directed respectively in a first and a second directions which are symmetrical to each other with respect to an axis extending normally through the aperture , while the third conductor has its first end portion directed in another direction than said second direction .

embodiments of the presently disclosed merchandising system are described in detail with reference to the drawings wherein like numerals designate identical or corresponding elements in each of the several views . as is common in the art , the term “ proximal ” refers to that part or component closer to the user , e . g ., customer , while the term “ distal ” refers to that part or component farther away from the user . generally , with particular reference to fig1 - 3 , a merchandising system 10 is disclosed that includes a plurality of guide assemblies 100 . each guide assembly 100 includes a base 200 , a pusher assembly 300 , a pair of lateral guides 400 , a distal section 450 , and a proximal member 500 . the base 200 , which is designed to be placed on a horizontal or included store shelf , is configured to support a plurality of products “ p ” thereon . the pusher assembly 300 is configured to urge product ( s ) “ p ” on the base 200 toward the proximal member 500 . the lateral guides 400 are disposed in mechanical cooperation with base 200 ( e . g ., are integrally formed therewith , connectable thereto , etc .) and help maintain the products “ p ” on the base 200 . a distal rail 452 of the distal section 450 and the proximal member 500 are also configured to help maintain the products “ p ” on the base 200 . one merchandising system 10 includes a plurality guide assemblies 100 . in the embodiment illustrated in fig2 a , merchandising system 10 includes five guide assemblies 100 , which , as shown , includes six lateral guides 400 . in disclosed embodiments , merchandising system 10 includes more or fewer than five guide assemblies 100 and that the number of lateral guides 400 equals one more than the number of guide assemblies 100 . as can be appreciated , several merchandising systems 10 are able to be positioned adjacent one another on a shelf . with reference to fig4 - 9 , the base 200 includes a product - supporting surface 210 , a lower surface 220 , a gap 230 , a plurality of longitudinally extending ribs 240 , and a track 250 . the product - supporting surface 210 is the portion of the base on which products “ p ” are positioned . the lower surface 220 is the underside of the base 200 . the gap 230 is the space between the product - supporting surface 210 and the lower surface 220 . the ribs 240 extend along at least a portion of the base 200 between a proximal end 202 of the base 200 and a distal end 204 of the base 200 ( see fig3 ), and are configured to provide stability to base 200 and to reduce friction when a product “ p ” slides along the product - supporting surface 210 , for example . the track 250 includes a plurality of spaced - apart tabs 252 that are positioned within the gap 230 . the track 250 is configured to guide legs 340 of the pusher assembly 300 ( as discussed in further detail below ). referring now to fig3 - 13 , the pusher assembly 300 includes a pusher member 310 and a biasing member 360 ( e . g ., a coiled spring ). pusher member 310 includes a horizontal member 320 and a substantially vertical member 321 . in the illustrated embodiment , the vertical member 321 has an arcuate shape , which is configured to correspond to the contour of the product “ p ” ( e . g ., bottle ) supported thereagainst . the horizontal member 320 includes an upper surface 322 ( e . g ., for supporting a product “ p ”), and a lower surface ( or base - contacting surface ) 324 that is configured to longitudinally slide along the product - supporting surface 210 of the base 200 . the horizontal member 320 also includes a proximal portion 326 , and a distal portion 328 . the proximal portion 326 is configured to support a distal - most product “ p ” thereon , and the distal portion 328 supports at least a portion of the biasing member 360 thereon ( fig4 ). the horizontal member 320 also includes a track 330 ( fig5 and 11 ) within its lower surface 324 , and an opening 332 ( fig5 and 11 ) extending between the upper surface 322 and the lower surface 324 . a portion of the biasing member 360 extends through the opening 332 and along the track 330 . the pusher member 310 also includes a plurality of legs 340 ( fig5 a , 8b , 9 and 11 - 13 ) that extend below the lower surface 324 of the horizontal member 320 . with particular reference to fig1 , the pusher assembly 300 includes a first leg 340 a , a second leg 340 b , a third leg 340 c and a fourth leg 340 d . in the illustrated embodiments , each leg 340 includes a vertical portion 342 , and a horizontal portion 344 ( fig1 ) extending inwardly from the vertical portion 342 , such that each leg 340 includes a substantially l - shaped cross - section . when the pusher assembly 300 is engaged with the base 200 , the legs 340 of the pusher assembly 300 extend below the product - supporting surface 210 of the base 200 and mechanically engage the tabs 252 of the track 250 , and are longitudinally slidable along the track 250 . more particularly , and with particular reference to fig9 , when the pusher assembly 300 and the base 200 are mechanically engaged , the vertical portion 342 of each leg 340 abuts or is adjacent a lateral wall 254 of the tab 252 , and the horizontal portion 344 of each leg 340 abuts or is adjacent a lower wall 256 of the tab 252 . this engagement between the legs 340 of the pusher member 310 and the track 250 of the base 200 helps ensure the pusher member 310 remains on the base 200 during use of the merchandising system 10 . more particularly , when torque is applied to the merchandising system ( e . g ., during loading of the merchandising system 10 with products “ p ,” when a consumer &# 39 ; s shopping cart bumps into the merchandising system 10 or the shelf that the merchandising system 10 is positioned on , etc .) the engagement between the pusher member 310 ( e . g ., the legs 340 ) and the base 200 ( e . g ., the track 250 ) helps prevent the pusher member 310 from toppling over . for instance , when a downward force is applied to right side of the pusher member 310 ( e . g ., during torquing of the merchandising system 10 ), the legs 340 a and 340 b on the left side of the pusher member 310 are forced upward . there engagement between the horizontal portions 344 of these legs 340 a and 340 b and the lower wall 256 ( fig9 ) of a tab 252 of the track 250 helps prevent the pusher member 310 from becoming separated from the base 200 at that location . additionally , the engagement between the legs 340 and the track 250 helps prevent the pusher member 310 from intentionally being separated from the base 200 ( e . g ., by vandals ). with particular reference to fig4 , to install the pusher member 310 onto the base 200 , a user positions each leg 340 adjacent a shortened tab 253 ( i . e ., a discontinuity in the track 250 ), and moves the pusher member 310 proximally or distally such that the horizontal portion 344 of each leg is under a tab 252 or a shortened tab 253 of the track 250 . it is envisioned that in lieu of , or in addition to shortened tabs 253 , track 250 includes a space between adjacent tabs 252 that is large enough to accommodate the legs 340 of the pusher member 310 . it is further envisioned that shortened tabs 253 ( and / or the large space ) are located at one or a plurality of locations between the proximal end 202 and the distal end 204 of the base 200 ( e . g ., not the proximal - most portion of the base 200 and not the distal - most portion of the base 200 ). with reference to fig3 , the proximal member 500 of the merchandising system 10 is configured to attach to a proximal end of the base 200 via a snap - fit connection , for example . it is envisioned that at least a portion of the proximal member 500 is transparent or translucent to allow a consumer to view a portion of the proximal - most product “ p 1 ” on the merchandising system 10 therethrough . additionally , in the illustrated embodiment , the proximal member 500 has an arcuate shape , which is configured to correspond to the contour of the product “ p ” ( e . g ., bottle ) supported thereagainst . it is also envisioned that the proximal member 500 includes a scooped portion 510 . the scooped portion 510 allows the proximal - most product “ p 1 ” to be better viewed by a consumer , allows the proximal - most product “ p 1 ” to be tipped down by a consumer to facilitate shopping of the products “ p ,” and / or facilitates the loading of the products “ p ” onto the merchandising system 10 , e . g ., by a store employee . with particular reference to fig8 a and 8b , a lower surface 522 of a base 520 of the proximal member 500 includes a pin 530 extending downwardly therefrom . the pin 530 is configured to mechanically engage a hole 362 disposed on a proximal portion 364 of the biasing member 360 ( see also fig3 ). therefore , when the hole 362 is engaged with the pin 530 ( fig7 b ), the biasing member 360 , and thus the pusher assembly 300 , is mechanically coupled to the proximal member 500 . additionally , the merchandising system 10 is configured to be used on shelves of various depths ( i . e ., the distance the shelf extends from the wall / support ). specifically , portions of the guide assemblies 100 are able to be broken - off or otherwise removed to effectively shorten the length of the guide assemblies 100 . more particularly , and with reference to fig3 , 14a and 14b , the base 200 includes breakaway features 260 , and the lateral guides 400 include breakaway features 410 , that each allow for selective removal of portions of the base 200 and the lateral guides 400 to shorten the length of the guide assemblies 100 . referring now to fig1 a and 14b , the distal section 450 includes the distal rail 452 , a distal base 460 , and distal lateral walls 470 . the distal base 460 includes a proximally - extending finger 462 that is configured to engage and interlock with a corresponding cut - out 262 disposed at a distal end of the base 200 . accordingly , the distal section 450 is able to be removed ( fig1 a ), and re - installed ( fig1 b ) after one or more portions of the base 200 and lateral guides 400 have been removed . further , the pusher assembly 300 of the merchandising system 10 is still able to properly function across the breakaway features 260 and 410 , the proximally - extending finger 462 and the cut - out 262 , after some or all of the portions of the base 200 and the lateral guides 400 have been removed , and after the distal section 450 has been removed and re - installed . the present disclosure also includes a method of displaying items using the merchandising system 10 described above , and a method of engaging the pusher assembly 300 with the base 200 , as discussed above . while several embodiments of the disclosure have been shown in the figures , it is not intended that the disclosure be limited thereto , as it is intended that the disclosure be as broad in scope as the art will allow and that the specification be read likewise . therefore , the above description should not be construed as limiting , but merely as exemplifications of various embodiments . those skilled in the art will envision other modifications within the scope and spirit of the claims appended hereto .

a merchandising system for a displaying a plurality of products is disclosed . the system comprises a base and a pusher member . the base includes a product - supporting surface and a track disposed beneath the product - supporting surface . the base defines a longitudinal axis . the pusher member is disposed in mechanical cooperation with the base and is configured to slide longitudinally with respect to the base . the pusher member includes a base - contacting surface and a plurality of legs downwardly depending from the base - contacting surface . each of the plurality of legs is configured to mechanically engage the track . the track includes a discontinuity to enable the legs of the pusher member to selectively mechanically engage the track .

the exemplary embodiments of the present invention are described and illustrated below as a fluid container , referred to below as a “ sippy straw cup ”, comprising a cup and corresponding lid having a sliding actuator to regulate fluid communication between an interior of the sippy straw cup and an external environment . the various orientational , positional , and reference terms used to describe the elements of the present invention are therefore used according to this frame of reference . however , for clarity and precision , only a single orientational or positional reference will be utilized ; and , therefore it will be understood that the positional and orientational terms used to describe the elements of the exemplary embodiment of the present invention are only used to describe the elements in relation to one another . referring to fig1 and 2 , an exemplary embodiment of a sippy straw cup 10 includes a cup 12 , a lid 14 , a sliding actuator 16 , and a straw 18 providing a selectively sealed fluid reservoir 20 available for holding a fluid therein , that may include , without limitation , a beverage . in an open position , as shown , the straw 18 is erect and provides fluid communication between the fluid reservoir 20 and an external environment 22 . the straw 18 may include two or more sections , with a first section 24 being resilient and a second section 26 coupled to the first section 24 that is less resilient and not readily amendable to spatial deformation . referencing fig2 – 4 , the cup 12 includes a cavity 28 partially defined by an exterior wall 30 of an inner cup 32 and partially by an interior wall 34 of an outer cup 36 . the cavity 28 may be adapted to receive a graphical expression ( not shown ), in which case the outer cup may be transparent to facilitate visual appeal . the graphical expression may include a lenticular or holographic image on a medium positioned within the cavity 28 . those of ordinary skill in the art are familiar with the methods of forming lenticular , holographic , or other images onto various mediums . the inner cup 32 includes an interior wall surface 38 defining the reservoir 20 and a spout 40 having spiral protrusions 42 on an exterior surface 44 adapted to be received within corresponding grooves 70 within the lid 14 for securing the lid 14 to the cup 12 . the spout 40 includes a ledge 46 transitioning into a circumferential wall 48 forming a recess 50 between the circumferential wall 48 and the exterior wall 30 of the inner cup 32 . the recess 50 is adapted to receive a top portion 52 of the outer cup 36 , where the outer cup 36 and the inner cup 32 may be coupled together by spin sealing . the outer cup 36 transitions from the top portion 52 into a sill 54 circumferentially thereabout that tapers inward to create a first indentation 56 . the first indentation 56 leads into a first mound 58 that gives rise to a second indentation 60 and thereafter a second mound 62 . each indentation 56 , 60 and each mound 58 , 62 is circumferentially distributed about the outer cup 36 . the second mound 62 transitions into a smooth taper terminating at a bottom aspect 64 having a dome shaped underneath surface 66 . referencing fig5 – 8 , the lid 14 is substantially domed shaped having a plurality of raised areas 68 circumferentially distributed thereabout to facilitate gripping as the corresponding grooves 70 within an outer wall 72 receive the spiral protrusions 42 of the inner cup 32 to couple the lid 14 to the cup 12 ( see fig1 ). a fluidic seal is created between an interior surface 74 of the outer wall 72 and the exterior surface 42 of the inner cup 32 , as well as between an interior surface 76 of an inner lip 78 ( extending from the outer wall 72 ) and the interior surface 38 of the inner cup 32 . the outer wall 72 transitions upward from the inner lip 78 in an arcuate manner until terminating at a recess 80 . the recess 80 includes a side surface 82 being essentially square with an arcuate top surface 84 . the arcuate top surface 84 defines an orifice 86 therein and gives rise to a conduit 88 extending from the top arcuate surface 84 of the recess 80 to an underneath surface 90 of the lid 14 . the conduit 88 includes circumferential projection 92 separating a first cylindrical portion 94 and a second cylindrical portion 96 having a greater diameter than the first cylindrical portion 94 . a groove 97 , adapted to receive the straw 18 , is formed within the recess 80 and includes a finger 98 abutting the orifice 86 . the side surface 82 of the recess 80 includes a guide notch 100 cut therein following the generally arcuate shape of the recess that is adapted to receive guide pins 102 of the sliding actuator 16 ( see fig9 – 11 ). referring to fig9 – 12 , the sliding actuator 16 is adapted to be received within the recess 80 and includes a generally arcuate shape from the side , where an underneath surface 104 is adapted to ride along the top surface 84 of the recess 80 and a top surface 106 of the actuator 98 is adapted to be substantially flush with the outer wall 72 of the lid 14 upon being seated within the recess 80 . two guide pins 102 protrude from each side 108 of the actuator 16 and are operative to guide the actuator 16 within the recess 80 from a closed position where the straw 18 is wedged between the underneath surface 104 and the top surface 84 and an open position where the straw 18 is erect . a contoured ridge 110 extends across the actuator 16 and includes two sliding guides 112 adapted to slide along the outer wall 72 . the contoured ridge 110 provides an actuation point for a user to push against or pull on the ridge 110 to effect motion of the actuator 16 with respect to the recess 80 . the underneath surface 104 includes a pair of rectangular projections 113 forming a mating channel 114 therebetween . the front 116 of the actuator 16 is partially open to guide the cylindrical nature of the straw 18 into the mating channel 114 when the actuator 16 is in the closed position . the straw 18 may include exterior features such as guide grooves or ridges ( not shown ) to further facilitate alignment within the groove 97 and the mating channel 114 . referencing fig1 , the open position of the sippy straw cup 10 is shown having the first section 24 of the straw 18 partially received within the conduit 88 and includes an exposed section 120 with a tip 122 at the end not received within the conduit 88 . an orifice 124 defined by a wall 126 of the straw 18 provides a generally constant internal diameter providing a circular cross - sectional area available for fluid flow therethrough . this generally constant internal diameter continues for the length of the first cylindrical portion 94 and part of the second cylindrical portion 96 . the radius of orifice 124 and the radius of the wall 126 aggregate to approximate the internal diameter of the conduit 88 . the straw 18 includes an indentation 128 that receives the circumferential projection 92 seating the straw 18 within the conduit 88 . the wall 126 increases in thickness to abut an interior wall 130 of the second cylindrical portion 96 , and when teamed with the indentation 128 and the circumferential projection 92 , inhibits vertical movement of the straw 18 within the conduit 88 . just beyond the exit of the conduit 88 , a step change within the straw is present where the orifice 124 increases in cross - section to receive the second section 26 adapted be in direct contact with the beverage occupying the reservoir 20 of the sippy straw cup 10 . referring to fig1 , the closed position of the sippy straw cup 10 is shown having the straw 14 wedged between the underneath surface 104 of the actuator 16 and the top surface 84 of the recess 80 . in practice , as the actuator 16 is repositioned from the open position to the closed position , the front 116 of the actuator 16 contacts the external wall 126 of the exposed section 120 of the straw 18 and pushes the straw forward . the open section of the front 116 of the actuator 16 and the mating channel 114 receives the exposed section 120 of the straw 18 as the actuator 16 continues moving forward , thereby pushing the straw 18 over the finger 98 projecting outward from the conduit 88 and into the groove 97 formed within the recess 80 . as the straw 18 is received within the groove 97 and mating channel 114 , the finger 98 forces one side of the straw wall 126 against the other side of the straw wall 126 , discontinuing the orifice 124 within the straw 18 to inhibit fluid communication between the second section 26 and the tip 122 of the straw 18 . the forward movement of the actuator 16 pushes the straw 18 completely within the groove 97 and mating channel 114 while the rear section 118 of the actuator 16 covers the orifice 86 . when moving from the closed to the open position , the actuator 16 is moved backward , gradually uncovering the exposed section 120 of the straw 18 previously seated within the groove 97 and mating channel 114 such that the resiliency of first section 26 of the straw 18 gradually raises the straw 18 to an erect position abutting the front 116 of the actuator 16 . following from the above description and invention summaries , it should be apparent to those of ordinary skill in the art that , while the methods and apparatuses herein described constitute exemplary embodiments of the present invention , the inventions contained herein are not limited to these precise embodiments and that changes may be made to them without departing from the scope of the invention as defined by the claims . additionally , it is to be understood that the invention is defined by the claims and it is not intended that any limitations or elements describing the exemplary embodiments set forth herein are to be incorporated into the meanings of the claims unless such limitations or elements are explicitly recited in the claims . likewise , it is to be understood that it is not necessary to meet any or all of the identified advantages or objects of the invention disclosed herein in order to fall within the scope of any claim , since the invention is defined by the claims and since inherent and / or unforeseen advantages of the present invention may exist even though they may not have been explicitly discussed herein .

a closure for a container adapted to house a beverage therein , the closure comprising : a cap having a mating feature adapted to interface with a corresponding feature of a container to secure the cap thereto , the cap also including an orifice therethrough and a channel therewithin , the channel being adapted to receive a sliding member therein ; and a flexible conduit adapted to be in fluid communication with a beverage within the container , wherein the sliding member is operative to position the flexible conduit between an open position and a closed position , where the open position enables fluid communication between a drinking end and an interior of the container .

referring to the drawing , the invention comprises a mouthpiece 1 having an upper channel member 2 and a lower channel member 5 ( fig3 and 5 ). upper channel member 2 is essentially identical to the upper mouthpiece worn by a boxer but modified according to this invention ; and , similarly , lower channel member 5 is essentially identical to the lower mouthpiece worn by a boxer but modified according to this invention . this upper channel member 2 is designed to fit over the upper teeth of the user and to snugly fit against the upper gum and lower channel member 5 is designed to fit over the lower teeth of the user and to fit snugly against the lower gum . upper channel member 2 and lower channel member 5 are made of a relatively soft but semi - rigid material . holes 6 ( see fig4 and 6 ) are cut through both legs or sides of upper channel member 2 and lower channel member 5 . the function of these holes will be described later herein . a first or outer membrane 7 extends from upper channel member 2 downward to lower channel member 5 as is more clearly shown in fig3 . as shown in fig3 outer membrane 7 is integrally formed with the uppermost part of upper channel member 2 at one end and is integrally formed with the lowermost part of lower channel member 5 . instead of being integrally formed with upper and lower channel members 2 and 5 , respectively , outer membrane 7 can be and from a production standpoint preferably is secured by any suitable means such as a non - toxic adhesive at one end to upper channel member 2 and at its other end to lower channel member 5 . a second or inner membrane 8 extends from the uppermost part of upper channel member 2 downward to the lowermost part of lower channel member 5 ( see fig3 ). again , the top part of second membrane 8 is shown in fig3 as being integrally formed with upper channel member 2 at one end and with lower channel member 5 at its other end but can be and preferably is secured to the uppermost part of upper channel member 2 at one end and to the lowermost part of lower channel member 5 at its other end by any suitable means and is a non - toxic adhesive . outer membrane 7 and inner membrane 8 are conveniently made of a relative soft material that is somewhat elastic . from the foregoing description of outer member 7 and inner membrane 8 , it is apparent that the area between the uppermost part of upper channel member 2 and the lowermost part of the lower channel member 5 is enclosed by means of membranes 7 and 8 . although it is not clearly visible in fig1 and 2 , membranes 7 and 8 are brought around the back of upper and lower channel members 2 and 5 such that the closed area formed by membranes 7 and 8 is a sealed area . a plurality of the bite blocks 10 are located in both upper and lower channel members 2 and 5 . three bite blocks 10 are shown in upper channel member 2 . an identical number of bite blocks are located in lower channel member 5 directly below bite blocks 10 . one of these bite blocks , the bite block 11 , located in lower channel member 5 is shown in fig3 and 5 . referring specifically to fig3 and 5 , a rod or post 12 has one end secured to or integrally fabricated with bite block 10 . the other end of post or rod 12 is secured to or integrally fabricated with the block 13 . a rod or post 14 has one end secured to or integrally fabricated with bite block 11 and its other end is integrally fabricated with or secured to block 13 . a hole 15 is cut through block 13 . all three bite block structures are identical . thus , all three bite block structures comprise a bite block 10 in upper channel 2 , a bite block 11 in lower channel 5 , a post or rod 12 , a block 13 having a hole 15 and a post or rod 14 . while the number of bite block structures provided is not critical , it will be obvious later herein from the description of the operation that at least three bit block structures should be provided . a hose or tube 16 is positioned between the bottom of upper channel member 2 and the top of lower channel member 5 . the hose or tube 16 is shaped to extend along the entire bottom and top surfaces of upper channel members 2 and 5 , respectively , as is shown in fig2 . hose or tube 16 is threaded through holes 15 of blocks 13 as shown in fig3 and 5 . a plurality of air - sacks 17 are integrally formed along tube or hose 16 as shown in fig2 . conveniently , air - sacks 17 are areas formed along tube or hose 16 that are more elastic than the balance of hose 16 so that air - sacks 17 will expand when inflated by air while the balance of hose or tube 16 remains substantially unchanged when air - sacks 17 are inflated or deflated . while the number of air - sacks provided is not critical , four air - sacks located as shown in fig2 is probably the minimum number required for satisfactory operation . more air - sacks 17 could be provided or for that matter the entire hose or tube 16 could be made of the same material as air - sacks 17 so that the entire tube or hose 16 would expand when inflated except , of course , in the area where hose or tube 16 passes through the holes 15 of blocks 13 . air - sacks 17 are secured to upper and lower channel members 2 and 5 by a suitable adhesive or the like . referring specifically to fig1 and 2 , a hose or tube 18b has one end secured to or is integrally fabricated with hose 16 . the other end of hose 18b is secured to the coupler 18a . coupler 18a is secured to and passes through membrane 7 such that one end , the end secured to hose 18b , is located in the enclosed area formed by membranes 7 and 8 and the other end extends slightly beyond the outer surface of membrane 7 . a hose or tube 19b is secured along the outside of membrane 7 as shown more clearly in fig1 . both ends of tube 19b are open . a coupler 19a , one end of which communicates with the inside of hose 19b , is secured to hose 19b at approximately the mid - point of hose 19b . the other end of coupler 19a extends slightly beyond the outside surface of hose 19b . a hose or tube 20b is located in the area formed by membranes 7 and 8 . one end of hose 20b extends through membrane 8 . this end of hose 20b conveniently and preferably is flush with the outside surface of membrane 8 . the other end of hose 20b is secured to one end of the coupler 20a . coupler 20a is secured to membrane 7 such that one end of coupler 20a , the end secured to hose 20b , is located in the area formed by membranes 7 and 8 and the other end extends slightly beyond the outside surface of membrane 7 . a coupler 21a is secured to membrane 7 such that one end of coupler 21a extends into the enclosed area formed by membranes 7 and 8 and the other end extends slightly beyond the outer surface of membrane 7 . seals are provided around couplers 18a , 20a and 21a where they pass through membrane 7 so that a fluid tight seal is provided between membrane 7 and each of the couplers 18a , 20a and 21a . similarly , a seal is provided between hose 19b and the area adjacent the end of coupler 19a that communicates with the inside of hose 19b so that a fluid tight seal is provided between hose 19b and this end of coupler 19a . one end of each of the hoses or tubes 18 , 19 , 20 and 21 is coupled to a control box 22 . the other end of hoses 18 , 19 , 20 and 21 are coupled to couplers 18a , 19a , 20a and 21a , respectively . the end of each of the hoses 18 , 19 , 20 and 21 that is coupled to its mating coupler 18a , 19a , 20a and 21a , respectively , is preferably provided with a mating connector , not shown in the drawing , such that hoses 18 , 19 , 20 and 21 can be quickly coupled to and uncoupled from couplers 18a , 19a , 20a and 21a , respectively . any type of suitable well known quick connect and disconnect coupling arrangement can be used to couple hoses 18 , 19 , 20 and 21 to their respective couplers . in addition to quick disconnect , the couplers permit one control unit 22 to be used interchangeably with a plurality of mouthpieces . three on - off switches , the switches 23 , 24 and 25 , are provided on control box 22 . the outlet hoses 26 and 27 have one end coupled to control box 22 . control box 22 is provided with a remote control device 28 that is sized and shaped to be conveniently held in the hand of the user of the apparatus of this invention . remote control device 28 is provided with the switches 29 , 30 and 31 . the apparatus of this invention operates as follows : the user inserts mouthpiece 1 into his or her mouth such that upper channel member 2 fits over the upper teeth and snugly against the upper gum and lower channel 5 fits over the lower teeth and snugly against the lower gum . control box 22 is then activated to provide either air pulses and water or air pulses alone or water alone . the air pulses are provided to air - sacks 17 from control box 22 through hose 18 , coupler 18a , hose 18b and hose 16 . control box 22 is provided with an air pump that operates cyclically to alternately provide pulses of air with periods of no air between the air pulses . when air pulses are provided , air - sacks 17 are inflated and during the period between air pulses air - sacks 17 are deflated . the elasticity of air - sacks 17 and the elasticity of membranes 7 and 8 forces the air out of air - sacks 17 through hose 16 , hose 18b , coupler 18a and hose 18 during the period between air pulses . instead of relying solely on the elasticity of air - sacks 17 to drive out the air , the pump of control box 22 could alternately pump air in and such air out ; thereby ensuring positive inflation and deflation of air - sacks 17 . in any event , control box 22 must operate such that air - sacks 17 are alternately inflated and deflated . referring to fig4 and 5 , fig4 shows a single air - sack 17 in its inflated condition and fig5 shows an air - sack 17 deflated . all of the air - sacks 17 are inflated or deflated at the same time . when the air - sacks 17 are inflated , upper channel member 2 rides up on the upper gum and lower channel member 5 rides down on the lower gum . when air - sacks 17 are deflated , the upper channel member 2 will ride down on the upper gum and lower channel member 5 will ride up on the lower gum . thus , as air - sacks 17 are inflated and deflated , upper and lower channel members 2 and 5 provide a massaging action on the gums . the teeth are held in place by the bite blocks 10 and 11 so that the upper and lower channel members 2 and 5 will ride up and down on the gums with the teeth staying in place . the elasticity of the membranes and the air - sacks pulls upper and lower channel members toward each other when air - sacks 17 are deflated . at the same time that control box 22 is providing air to massage the gums , control box 22 also provides a source of water and / or cleaning fluid through hose 21 and coupler 21a into the area formed by membranes 7 and 8 . this water and / or cleaning fluid flows through holes 6 in upper and lower channel members 2 and 5 to clean and flush out the teeth and gums . this fluid is preferably introduced into mouthpiece 1 as a gentle steady stream . in addition to providing a cleaning action , the fluid serves as a lubricant during the massaging action . since some fluid will seep out between the gums and upper and lower channel members 2 and 5 , suction hose 9 is provided on the outside of membrane 7 . suction hose 9 is coupled to control box 22 by means of coupler 19a and hose 19 . control box 22 sucks any fluid seepage out of the mouth of the user through hose 9 , coupler 19a and hose 19 . similarly , hose 20b serves as a suction hose to suck out the fluid that seeps into the area of the mouth outside of inner membrane 8 . this seepage is drawn out by control box 22 through hose 20b , coupler 20a and hose 20 . a source of water is provided to control box 22 by means of the hose 26 . this water can be mixed with a cleaning fluid that is stored inside of control box 22 . if no cleaning fluid is to be used , no such fluid will be stored in control box 22 . similarly , if only cleaning fluid is used , the source of water is cut off . also , a mixture of water and cleaning fluid can be stored in control box 22 and hose 26 eliminated , if control box 22 is provided with a sufficiently large storage compartment for the fluid . the fluid drawn out of the mouth around mouthpiece 1 through hoses 19 and 20 is drained out of control box 22 by means of hose 27 . if a drain pan is provided in control box 22 , hose 27 can be eliminated . while under most circumstances , the apparatus will be used with both cleaning fluid and with air to provide the massaging action , the apparatus can be operated such that either air only is provided or cleaning fluid only is provided , or both air and cleaning fluid are provided . control box 22 is provided with three on - off switches to provide the three modes of operation . for example , switch 23 would provide both air and water , switch 24 air only and switch 25 water only . while the apparatus can be operated from control box 22 , a remote control device 28 is preferably provided . remote control device 28 is of such size and shape that it is easily hand held and is provided with switches 29 , 30 and 31 that correspond in operation to switches 23 , 24 and 25 , respectively . alternately , remote control device 28 can be and preferably is provided with a single on - off pushbuttom switch with the mode of operation set by switches 23 , 24 and 25 . this single switch or remote control device 28 would then operate to merely activate the control box 22 . while the invention has been described with reference to a specific embodiment , it will be obvious to those skilled in the art that various changes and modifications can be made to this embodiment without departing from the spirit and scope of the invention as set forth in the claims . for example , bristles can be added to the upper and lower channels to assist the massaging action and a single coupling arrangement could be used to couple the control panel to the mouthpiece .

apparatus for cleaning teeth and the gingival crevices and for massaging the gums is disclosed . the apparatus comprising a mouthpiece having an upper channel member adapted to fit over at least a part of the upper dentation and to snugly engage the upper gum and a lower channel member adapted to fit over at least a part of the lower dentation and to snugly engage the lower gum . the upper and lower channels are joined by a membrane means which form fluid chambers . pneumatic means are provided to move the upper and lower channel members upward and downward over the respective gums to massage the gums . in addition water or any suitable cleaning fluid is introduced into and out of the apparatus to clean the teeth and gingival crevices and to provide lubrication for the massaging action of the pneumatic means .

the base member 22 is shown in fig1 , 2 and 3 . referring particularly to fig3 , the base member is a molded plastic part with a projecting ridge 34 around the periphery with slight extensions of the ridge at 35 . the projections 35 are used as grippers to hold the body member with one &# 39 ; s fingers when the cover 24 is being removed or replaced on the body . the vertical walls are curved as at 62 and 64 in a shape approximating the curvature of a typical ear of corn . the base member is shaped to accommodate the ear of corn , both on the bottom surface 38 and the upper surface 36 . the brush structure 40 is illustrated in fig1 , 4 and 5 . the brush structure is a single molded part comprising a molded bristle base 42 and molded brush bristles formed in the same molding operation . low density polyethylene is the material of which the base and bristles are made so as to make them relatively soft and flexible . the underside of the brush unit is shown in fig5 . flexible vertical plastic walls 80 form an elongated rectangular shape to match that of the base member 22 and to fit into the cavity 60 shown in fig3 with an interference fit . tabs extend from the opposite short ends 44 of the bristle base to facilitate removing and replacing the bristle base in the base member 22 , thus providing means for separating the parts for washing . as it can be seen in fig4 , the upper surface of the bristles and the upper edge of the bristle base 42 are given with a curvature approximating that of an ear of corn . referring again to fig5 , in the longitudinal center of the bristle base structure shown in fig5 is a reinforcing rib 82 . a projection 84 is formed which , when the bristle base 42 is fitted into the base member 22 , extends downwardly by a predetermined distance to abut against a surface 90 ( see fig6 ) of a bridge member 86 which is fitted into the cavity 60 of the base member 22 shown in fig3 . this provides vertical support for the flexible bristle base and bristles to prevent undue distortion under the scrubbing force or cutting force applied by the user . the cover 24 , which is shown in fig1 , 2 and 4 , has a thumb - shaped recess 43 ( fig1 ), two pairs of slight projections 49 located above and below the projection or flange 34 , and two slight vertical projections on the internal surface of the side wall 28 of the cover to mate with the projections 49 to provide a secure but releasable friction fit between the cover and the base member . the thumb recess 43 increases the degree of effective projection outwardly of the areas 35 which facilitates gripping of the cover and the base to push them together or pull them apart . the cutter 48 and its blade 52 are best seen in fig2 , 4 and 8 . the cutter 48 comprises a blade which is generally u - shaped with a curvature in the direction shown in fig3 so as to approximate the curvature of an ear of corn . referring again to fig3 , the base member 22 has a pair of through holes 72 and 74 , and a pair of upstanding projections , 76 and 78 near the holes . referring to fig2 , the cutter 48 includes the blade 52 with two legs 54 extending through the body 22 . fig3 shows those legs 54 are attached to the projections 76 and 78 to anchor the legs of the cutter solidly . the legs are attached by adhesive and ultrasonic bonding . the bridge member 86 is shown in fig7 and it forms two vertical receptacles 92 and 94 into which the projections 76 and 78 fit , with a pair of tabs 98 and 100 to fit into the holes 72 and 74 . the bridge has a curved undersurface as shown at 96 to match the curvature of the lower surface of the structure shown in fig3 . that curvature includes a raised portion 66 flanked by recessed portions 68 and 70 . referring to fig2 , the cutter 48 includes a blade 52 with serrated cutting teeth 50 . the cutter blade preferably is made of hard stainless steel of the type and quality used in food processor blades so that it maintains its sharpness for a long time . the undersurface 38 of the cutter / de - silker device has a longitudinal recess 46 which helps to allow the corn kernels to pass underneath the blade without being cut up any more than necessary . fig8 is a broken - away , cross - sectional view of the blade 52 . the forward cutting edge is ground to be beveled on both sides of the cutting edge , as shown at 102 and 104 . this has the advantage that the edge shape does not force the blade downwardly towards the corn cob to cut more of the corn kernels than is desired , nor upwardly to cut too little . this is in contrast to those prior cutters whose blades have been ground only on one side . some of the advantages of the invention have been described above . others include the fact that the assembled device 20 is relatively broad compared with prior devices . this allows a somewhat greater width for the cutting blade of the cutter , therefore allowing more to be cut with each stroke than in some prior devices , and yet does not require the use of excessive force . similarly , the greater width increases the width of the brush 40 compared with some prior devices , thereby increasing the coverage of the brush and , hence , the speed of the de - silking process . some of the materials of which the device shown in the drawings is made have been mentioned above . the base 22 and the bridge 86 preferably are made of high impact polystyrene , and the cover 24 preferably is made of san . these materials can be replaced by other suitable materials , within the skill of those experienced in the art . the above description of the invention is intended to be illustrative and not limiting . various changes or modifications in the embodiments described may occur to those skilled in the art . these can be made without departing from the spirit or scope of the invention .

a device is provided for cutting and / or de - silking corn on the cob . a single unit has a base and a removable cover . a brush for use in removing silks is mounted on one side of the base , and a cutter is mounted on the other side . when it is desired to use the tool on one side instead of the other , the cover is placed over the other tool . the cover then is used as an easy - to - grip palm - fitting structure to push the brush or the cutter along the ear of corn .

with further reference to the drawings , there is illustrated a frame 10 having a front cross member 11 , a rear cross member comprising upper and lower plates 12 and 13 , right and left side members 14 and 15 extending perpendicularly rearwardly from the front cross member 11 , and inclined side members 16 and 17 extending to the ends of the rear cross member 12 and 13 . at the rear of the front cross member 11 an arcuate plate 20 bridges the sides 14 and 15 for purposes which will be described . extending upwardly from the central and forward portion of the front cross member is an upper hitch plate 22 , in two parallel sections , and having a hitch pin 23 extending therethrough for the purposes of attaching to the hitch point of the tractor &# 39 ; s three point hitch . spaced at either side of the upper hitch plate 22 are right and left lower hitch plates 25 and 26 each of which comprises a pair of spaced plate side members that are connected to the front cross member 11 . between the side members of each lower hitch plate is a cylinder and piston assembly including cylinders 27 and 28 , pistons 29 and 30 , which are connected to clevises 31 and 32 carrying hitch pins 33 and 34 projecting from the sides of the outer hitch plates where the hitch pin may be received by the lower connections of the three point hitch on the tractor . the cylinders 27 and 28 are mounted by pins 34 and 35 across the tops of the spaced hitch plates in order to permit any necessary swinging movement of the cylinder and piston assemblies . in order to reduce the wear on the hitch plates , a replaceable and reversible metal wear plate 36 is mounted at the rear of each of the clevises 31 and 32 . this protects the slot in which the pin 33 reciprocates from excessive wear . the frame mounts a longitudinal beam which may be in two sections 40 and 41 . the forward section 40 is received intermediate the upper and lower rear cross members 12 and 13 and connected thereto by a pivot 42 which permits the beam to swing laterally of the frame . the forward end of the frame has a ledge plate with upper and lower sections 45 , 45 and wear strips 46 , 47 which ride on the top and bottom of the arcuate plate 20 previously described , in order to support the forward end of the longitudinal beam . in order to control the position of the longitudinal beam within the frame 10 a pair of cylinders 50 and 51 are mounted , one on each side of the beam . thus a right cylinder 50 is mounted with its cylinder intermediate the upper and lower portions of the rear cross member 12 and 13 by a pivot or trunnion mounting 52 , its piston 53 extending to a pin 54 mounted between a pair of lugs 55 which are in spaced relation from the forward end of the beam . similarly the cylinder 51 has a trunnion mounting 56 and a piston 57 which is connected to a pin 58 between lugs 59 on the opposite side of the beam . it will be apparent therefore that by the simultaneous operation of the piston assemblies that the forward portion of the longitudinal beam may be angularly shifted from side to side within the frame 10 . the front and rear portions of the longitudinal beam 40 - 41 have a series of spaced brackets 60 which are connected to mounting plates 61 for holding a series of spaced moldboards 62 . for purposes of convenience and flexibility , as previously indicated , the longitudinal beam may be divided into two portions 40 and 41 . the rear portion 41 of the beam has supports 70 and 71 for a rear wheel beam 72 for carrying a gauge wheel 73 . suitable adjusting means 74 are carried in the support 71 in order that the height of the gauge wheel may be adjusted . with reference to fig1 , the moldboards 62 may be made of curved metal frame sections 90 having upper bracket means 91 , central bracket means 92 and lower bracket means 93 with protective follower members 94 that aid in the control of the tractor . the frame sections 90 are faced with a wear sheet 95 secured by fasteners 96 and holder strip 97 for reducing the wear on the moldboards and the need for frequent replacement . the hydraulic control circuit for the positioning cylinders and tilt cylinders is illustrated in fig1 . in this figure lines 100 - 101 may connect to the hydraulic control lines of the tractor . these are connected to a double dual lock out box 102 . in box 102 line 100 is connected to joints 104 and 105 ; line 101 is connected to joints 106 and 107 . joints 104 is connected to lines 110 and 111 to one side of tilt cylinders 27 and 28 . joint 105 is connected to lines 113 and 114 to one side of positioning cylinders 50 and 51 . the return side of tilt cylinders 27 and 28 are connected by lines 115 and 116 to joint 106 and line 101 back to the tractor . similarly , the return lines 118 and 119 from the positioning cylinders 50 and 51 are connected to the joint 107 and line 120 to the line 101 to the tractor . in the operation of the tractor hydraulics , the opening of the circuit will generally unlock the circuit with the less pressure , which is usually the positioning cylinder circuit , permitting movement of these cylinders until the plow beam goes the maximum extent and hits the stop , either on the right or the left side . at this point the pressure build up and causes the tilt cylinders to operate . after all of the hydraulic functions have been completed additional pressure will bleed over to the tractor relief . when the tractor lever is returned to neutral , the double dual lockout will lock all of the cylinders , preventing them from any movements during the plowing operation . it will be understood that at the end of each row , the tractor three - way hitch is generally operated to raise the frame and the beam with the moldboards attached clear of the field until the tractor has turned 180 ° and is in position to resume plowing in the opposite direction . then the three - way hitch is lowered in order that plowing in the opposite direction may be done . during the time that the three way hitch is raised the hydraulic circuit may be operated in order to properly position the beam with the moldboards in the proper position for plowing ( see fig4 ) and also to properly position the frame in its appropriately tilted position . fig8 - 11 illustrate a modification of the invention . the modification is in the mounting by means of which the height of the left and right hitch pins are controlled . instead of having a separate cylinder and piston assembly for each of the hitch pins , the modification includes a hitch plate pivot assembly , as particularly illustrated in fig8 and 9 . the assembly includes a hitch plate 150 that is mounted on and depends downwardly from the front cross member 11 , substantially centrally thereof . the hitch plate has a center pivot 152 which supports a hitch bar 153 that is pivotally mounted between left and right lower hitch plates 154 and 155 . the hitch plates have openings 156 and 157 , respectively , for receiving the ends of the hitch bar as it oscillates , the hitch bar carrying left and right lift pins 159 and 160 . a pair of spaced lugs 162 - 163 are mounted over an opening 164 on the right side of the front cross member 11 and substantially over the right lower hitch plate 155 . the lug 162 carries a pivot pin 166 which mounts a cylinder 167 which operates a piston 168 connected to a web 169 of a clevis 170 which engages the hitch bar 153 by means of a pin 171 . accordingly , by operation of the cylinder and piston assembly the hitch bar may be caused to pivot about the pivot support 152 in order to raise and lower the right and left lift pins 160 and 159 . a replacement tee - shaped wear plate 173 is held by a clamp 174 connected to the hitch plate 155 and engaging the clevis 170 . in order to control the operation of the positioning cylinders and the single tilt cylinder of the modification a hydraulic hookup as indicated on fig1 is provided . the hookup includes the lines 100 - 101 to the tractor disconnects . the line 100 is connected to joint 180 and joint 181 which are connected to lines 182 and 183 , respectively , to one side of the positioning cylinders and the tilt cylinder . the other line 101 is connected to line 184 and line 185 to the other side of the cylinders of the positioning cylinders and the tilt cylinder . ordinarily , activating the tractor hydraulics will unlock the circuit with the lesser pressure , usually the position cylinder circuit , permitting movement of the cylinders until the plow beam hits the stop on either the right or the left side . this will then permit the tilt cylinder to function . after all of the hydraulic functions have been completed the additional pressure bleeds over to the tractor relief . when the tractor lever is returned to neutral the double dual lock - out , as previously described , will lock all the cylinders preventing any movement during plowing .

a reversible moldboard plow has a plow carrying beam swingably mounted at the rear crossbar of a frame which carries trunnion mounted cylinders connected to the beam for moving the beam , the front of the frame carrying hitch pins for connection to a tractor hitch , the hitch pins being vertically movable in alternate relation in order to tilt the frame and the beam with the moldboards supported thereon . the hitch pins may be moved by independent cylinders and pistons or , alternately , by the movement of a transverse hitch bar on which they are mounted .

in the following detailed description , numerous specific details are set forth in order to provide a thorough understanding of the invention . however , it will be understood by those skilled in the art that the present invention may be practiced without these specific details . in some instances , well - known methods , procedures , components and circuits have not been described in detail , for the sake of brevity . fig1 illustrates an anterior implant according to one embodiment of the present invention . anterior implant 1 includes four straps 10 , each ending with a looped end 20 . anterior implant 1 may also include a loop 8 between two interior straps 10 . anterior implant 1 may include spaces 4 for reducing the weight thereof . fig2 illustrates an anterior view of the pelvic area before installing the anterior implant . the anterior view of pelvic area 34 refers to the side allowing surgical access through the patient &# 39 ; s vaginal opening . denoted bones are the ischial spine 27 extending from the posterior border of the ischium 26 , and the sacrum 46 . also shown are the perineal body 52 , and the cervix 50 extending from the uterus ( womb ) 48 . pelvic area 34 includes two ligaments of arcus tendineous fascia pelvic ( atfp ) 30 and two ligaments of sacrospinous ( ss ) 28 . fig3 illustrates the view of fig2 after installing the anterior implant . anterior implant 1 is used for reconstructing the anterior pelvic floor , including prolapse of the urinary bladder and / or the colon and the small intestine . two straps 10 of anterior implant 1 are threaded into two atfp ligaments 30 , and the other two straps 10 are inserted into two ss ligaments 28 . loop 8 may be sutured to cervix 50 for improving strength and security of the anchoring of anterior implant 1 . fig4 illustrates a posterior implant according to one embodiment of the present invention . posterior implant 2 includes two straps 10 , each ending with a looped end 20 . posterior implant 2 may include a loop 36 between two interior straps 10 , and another loop 9 at the opposing side . posterior implant 2 may include spaces 4 for reducing the weight thereof . fig5 illustrates the view of fig2 after installing the posterior implant . posterior implant 2 is used for reconstructing the posterior pelvic floor , including prolapse of the colon , the small intestine and / or the uterus ( womb ). two straps 10 of posterior implant 2 are inserted into two ss ligaments 28 . loop 36 may be sutured to cervix 50 , and loop 9 may be sutured to perineal body 52 for improving the strength and security of the connection . fig6 illustrates the head of a needle for threading the straps of the implants , according to one embodiment of the present invention . a needle 6 is used for threading each of straps 10 through atfp ligaments 30 and ss ligaments 28 . the head of needle 6 includes a rod 18 , which may be manually slid back and forth in a track 16 within a body 14 , as in brake cables . the edge 42 of rod 18 may be inserted into a niche 40 . the tip 12 of needle 6 is located at the edge of body 14 . fig7 illustrates the first step of threading the straps of the implants , using the needle of fig6 . the surgeon inserts looped end 20 of strap 10 into niche 40 , and traps it by rod edge 42 of rod 18 into looped end 20 . in case that the surgeon has not succeeded in inserting rod 18 into looped end 20 , the surgeon may trap looped end 20 by applying physical force of rod edge 42 towards the limiting wall thereof in niche 40 . according to another embodiment the surgeon may trap strap 10 directly by applying physical force of rod edge 42 on the end of strap 10 towards the limiting wall thereof in niche 40 . fig8 illustrates the second step of threading the straps of the implants , using the needle of fig6 . the surgeon then pushes tip 12 together with body 14 into an atfp ligament 30 or into an ss ligament 28 , threading looped end 20 and strap 10 through the ligament . fig9 illustrates the third step of threading the straps of the implants , using the needle of fig6 . the surgeon then slides rod edge 42 out of niche 40 , releasing looped end 20 from rod edge 42 . fig1 illustrates the fourth step of threading the straps of the implants , using the needle of fig6 . the surgeon then pulls body 14 together with tip 12 out of atfp ligament 30 or ss ligament 28 . since looped end 20 has been released at the third step , and since ligament 30 ( or 28 ) shrinks tightly , as shown by the arrows , strap 10 remains threaded while tip 12 exits . fig1 illustrates the needle of fig6 and its operation . the surgeon holds handle 24 of needle 6 , and slides rod 18 by toggling a toggle arm 22 , which is connected to rod 18 . needle 6 as a whole may be flexible like a brake cable , thin and long enough to occupy minimal surgery space . since tip 12 is inserted into the pelvic area , and toggle arm 22 is far away tip 12 , toggle arm is located outside the body of the patient and may be located farther and outside the surgical area . it may be appreciated according to these steps that the surgeon can thread strap 10 from the side having surgical access , without requiring any additional perforations of the body from the opposing direction . fig1 illustrates the operation of the needle of fig6 in aspect of the surgeon &# 39 ; s access to the pelvic area . the surgeon inserts finger 32 thereof into the vagina 44 between the patient &# 39 ; s legs 38 and reaches pelvic area 34 ( the lines of the parts inside are dashed ). the surgeon then separates an ss ligament 28 from the other organs , locates tip 12 of needle 6 on a selected threading point on ss ligament 28 , and traps trapping looped end 20 to niche 40 of needle 6 . the surgeon then penetrates tip 12 through ss ligament 28 and pushes into the desired depth ; then releases looped end 20 from needle 6 by toggling toggle arm 22 , using the other hand thereof . the surgeon can then pull tip 12 back , leaving looped end 20 and strap 10 at the side beyond , having tight shrinking of ss ligament 28 towards strap 10 at the threaded point . tying of strap 10 is not required due to natural tying of ss ligament 28 to strap 10 . fig1 illustrates the operation of the needle of fig6 in aspect fig1 , to another ligament . the surgeon inserts the finger 32 thereof into vagina 44 , then separates an atfp ligament 30 , and locates tip 12 of needle 6 on the selected threading point , after trapping looped end 20 to niche 40 of needle 6 . the surgeon then penetrates tip 12 through atfp ligament 30 and on to the desired depth ; then releases looped end 20 from needle 6 by toggling toggle arm 22 , using the other hand thereof , then pulls tip 12 back leaving looped end 20 and strap 10 at the side beyond , having tight shrinking of atfp ligament 30 towards strap 10 at the threaded point . in the figures and description herein , the following numerals and symbols have been mentioned : numeral 4 denotes a space for reducing the weight of an implant ; numeral 6 denotes a needle according to one embodiment of the present invention ; numeral 8 denotes a loop in the anterior implant for anchoring it to the cervix ; numeral 9 denotes a loop in the posterior implant for anchoring it to the perineal body ; numeral 16 denotes a track within the body of the needle ; numeral 18 denotes a rod traveling within the body of the needle ; numeral 20 denotes a looped end at the edge of the implant strap ; numeral 22 denotes a toggle arm for trapping and releasing the looped end ; numeral 30 denotes an arcus tendineous fascia pelvic ( atfp ) ligament ; numeral 36 denotes a loop in the posterior implant for anchoring it to the cervix ; numeral 40 denotes a niche in the needle for trapping the looped end of the strap ; numeral 42 denotes the edge of the rod sliding in the track ; numeral 44 denotes the vagina , into which the surgeon inserts the finger thereof ; while certain features of the invention have been illustrated and described herein , the invention can be embodied in other forms , ways , modifications , substitutions , canchores , equivalents , and so forth . the foregoing description of the embodiments of the invention has been presented for the purposes of illustration and description . it is not intended to be exhaustive or to limit the invention to the precise form disclosed . many modifications and variations are possible in light of this disclosure . it is intended that the scope of the invention be limited not by this detailed description , but rather by the claims appended hereto .

in one aspect , the present invention may be directed to a needle for surgical threading of a strap of an implant through a tissue , the needle comprising : a trap for trapping the strap to the needle while the needle may be at the accessible side of the tissue ; a tip for threading the trapped strap from the accessible side to the opposing side ; and a mechanism for releasing the trap , the mechanism driven from the accessible side of the tissue , thereby allowing return of the tip to the accessible side of the tissue while abandoning the strap at the threaded point , thus performing the threading from the accessible side of the tissue .

the two embodiments to be described are ventilators that operate in a manner that seeks to simultaneously achieve the three goals stated above . apparatus to give effect to a first embodiment of the apparatus is shown in fig1 a . a blower 10 supplies a breathable gas to mask 11 in communication with the subject &# 39 ; s airway via a delivery tube 12 and exhausted via a exhaust diffuser 13 . airflow to the mask 11 is measured using a pneumotachograph 14 and a differential pressure transducer 15 . the mask flow signal from the transducer 15 is then sampled by a microprocessor 16 . mask pressure is measured at the port 17 using a pressure transducer 18 . the pressure signal from the transducer 18 is then sampled by the microprocessor 16 . the microprocessor 16 sends an instantaneous mask pressure request signal to the servo 19 , which compares said pressure request signal with actual pressure signal from the transducer 18 to the control fan motor 20 . the microprocessor settings can be adjusted via a serial port 21 . it is to be understood that the mask could equally be replaced with a tracheotomy tube , endotracheal tube , nasal pillows , or other means of making a sealed connection between the air delivery means and the subject &# 39 ; s airway . the microprocessor 16 is programmed to perform the following steps , to be considered in conjunction with tables 1 and 2 . 1 . set desired target values for the duration of inspiration ti tgt , duration of expiration te tgt , and minute ventilation v tgt . choose suitable constants p 0 and a std where p 0 is the desired end expiratory pressure , and a std is the desired increase in pressure above p 0 at end inspiration for a breath of duration tt tgt = ti tgt + te tgt . 2 . choose a suitable pressure waveform function π ( φ ), such as that shown in fig2 , such that the desired delivery pressure at phase φ will be given by : where the amplitude a equals the difference between the end inspiratory pressure and end expiratory pressure . however , other waveforms may be suitable for subjects with particular needs . 3 . initialize the phase φ in the respiratory cycle to zero , and initialize the current estimates of actual inspiratory and expiratory duration ti and te to ti tgt and te tgt respectively . 4 . initialize the rate of change of phase during inspiration δφ i between sampling intervals of length t to : 5 . initialize the rate of change of phase during expiration δφ e to : 8 . low pass filter the respiratory airflow with an adjustable time constant τf , where τf is a fixed small fraction of tt . 9 . calculate the instantaneous ventilation v , as half the absolute value of the respiratory airflow : 10 . from the target ventilation v tgt and the measured minute ventilation v , derive an error term v err , such that large values of v err indicate inadequate ventilation : 11 . take v bar as the result of low pass filtering v with a time constant τv bar which is long compared with tt . 13 . from f norm , calculate the degree of membership in each of the fuzzy sets whose membership functions are shown in fig3 . 14 . calculate a normalized rate of change df norm / dφ , equal to df norm / dt divided by the current estimate of the average respiratory cycle time tt . 15 . from the normalized rate of change , calculate the degree of membership in each of the fuzzy sets shown in fig4 . 16 . for each row n in table 1 , calculate the degree of membership g n in the fuzzy set shown in the column labelled fuzzy phase , by applying the fuzzy inference rules shown . 17 . associate with the result of each of the n rules a phase φ n as shown in table 2 , noting that φ 10 is the current phase φ . 18 . increase each of the φ n excepting φ 10 by 0 . 89 τ / tt , to compensate for the previous low pass filtering step . 19 . calculate a new instantaneous phase φ inst as the angle to the center of gravity of n unit masses at polar coordinates of radius g n and angle φ n revolutions . 20 . calculate the smallest signed difference δφ inst bewteen the phase estimated in the previous step and the current phase . δφ inst = 1 − ( δφ inst − φ ) ( φ inst − φ & gt ; 0 . 5 ) δφ inst = φ inst − φ + 1 ( φ inst − φ & lt ; − 0 . 5 ) δφinst = φ inst − φ ( otherwise ) 21 . derive a revised estimate δφ rev equal to a weighted mean of the value calculated in the previous step and the average value ( δφ i or δφ e as appropriate ). δφ = ( 1 − w ) δφ i + wδφ inst ( 0 & lt ; φ & lt ; 0 . 5 ) δφ = ( 1 − w ) δφ i + wδφ inst ( otherwise ) smaller values of w will cause better tracking of phase if the subject is breathing regularly , and larger values will cause better tracking of phase if the subject is breathing irregularly . 22 . derive a blending fraction b , such that the blending fraction is unity if the subject &# 39 ; s ventilation is well above v tgt , zero if the subject is breathing near or below v tgt , and increasing proportionally from zero to unity as the subject &# 39 ; s ventilation increases through an intermediate range . 23 . calculate δφ blend influenced chiefly by δφ calculated in step 21 from the subject &# 39 ; s respiratory activity if the subject &# 39 ; s ventilation is well above v tgt ; influenced chiefly by the target respiratory duration if the subject is breathing near or below v tgt ; and proportionally between these two amounts if ventilation is in an intermediate range : δφ blend = b δφ + 0 . 5 ( 1 − b ) t / ti tgt ( 0 & lt ; φ & lt ; 0 . 5 ) δφ blend = b δφ + 0 . 5 ( 1 − b ) t / te tgt ( otherwise ) 25 . update the average rate of change of phase ( δφ i or δφ e as appropriate ). δφ i = t / τ vbar ( δφ blend − δφ i ) ( 0 & lt ; φ & lt ; 0 . 5 ) δφ e = t / τ vbar ( δφ blend − δφ e ) ( otherwise ) 26 . recalculate the approximate duration of inspiration ti and expiration te : 27 . calculate the desired mask pressure modulation amplitude a d : a d = a std / 2 ( tt & lt ; tt std / 2 ) a d = 2 · a std ( tt & gt ; 2 · tt std ) a d = a std · tt / tt std ( otherwise ) 28 . from the error term v err , calculate an additional mask pressure modulation amplitude a e : a e = k · v err ( for v err & gt ; 0 ) a e = 0 ( otherwise ) where larger values of k will produce a faster but less stable control of the degree of assistance , and smaller values of k will produce slower but more stable control of the degree of assistance . 29 . set the mask pressure p mask to : p mask = p 0 +( a d + a e ) π ( φ ) 30 . wait for a sampling interval t , short compared with the duration of a respiratory cycle , and then continue at the step of measuring respiratory airflow . as follows from above , it is necessary to respiratory airflow , which is a standard procedure to one skilled in the art . in the absence of leak , respiratory airflow can be measured directly with a pneumotachograph placed between the mask and the exhaust . in the presence of a possible leak , one method disclosed in european publication no 0 651 971 incorporated herein by cross - reference is to calculate the mean flow through the leak , and thence calculate the amount of modulation of the pneumotachograph flow signal due to modulation of the flow through the leak induced by changing mask pressure , using the following steps : 1 . measure the airflow at the mask f mask using a pneumotachograph 2 . measure the pressure at the mask p mask 3 . calculate the mean leak as the low pass filtered airflow , with a time constant long compared with a breath . 4 . calculate the mean mask pressure as the low pass filtered mask pressure , with a time constant long compared with a breath . 5 . calculate the modulation of the flow through the leak as : a convenient extension as further disclosed in ep 0 651 971 ( incorporated herein by cross - reference ) is to measure airflow f turbine and pressure p turbine at the outlet of the turbine , and thence calculate p mask and f mask by allowing for the pressure drop down the air delivery hose , and the airflow lost via the exhaust : 1 . δp hos e = k 1 ( f turbine )− k 2 ( f turbine ) 2 2 . pmask = p turbine − δp hose 3 . f exhaust = k3 √ p mask 4 . f mask = f turbine − f exhaust the following embodiment is particularly applicable to subjects with varying respiratory mechanics , insufficient respiratory drive , abnormal chemoreceptor reflexes , hypoventilation syndromes , or cheyne stokes breathing , or to subjects with abnormalities of the upper or lower airways , lungs , chest wall , or neuromuscular system . many patients with severe lung disease cannot easily be treated using a smooth physiological pressure waveform , because the peak pressure required is unacceptably high , or unachievable with for example a nose - mask . such patients may prefer a square pressure waveform , in which pressure rises explosively fast at the moment of commencement of inspiratory effort . this may be particularly important in patients with high intrinsic peep , in which it is not practicable to overcome the intrinsic peep by the use of high levels of extrinsic peep or cpap , due to the risk of hyperinflation . in such subjects , any delay in triggering is perceived as very distressing , because of the enormous mis - match between expected and observed support . smooth waveforms exaggerate the perceived delay , because of the time taken for the administered pressure to exceed the intrinsic peep . this embodiment permits the use of waveforms varying continuously from square ( suitable for patients with for example severe lung or chest wall disease or high intrinsic peep ) to very smooth , suitable for patients with normal lungs and chest wall , but abnormal respiratory control , or neuromuscular abnormalities . this waveform is combined either with or without elements of proportional assist ventilation ( corrected for sudden changes in leak ), with servo - control of the minute ventilation to equal or exceed a target ventilation . the latter servo - control has an adjustable gain , so that subjects with for example cheyne stokes breathing can be treated using a very high servo gain to over - ride their own waxing and waning patterns ; subjects with various central hypoventilation syndromes can be treated with a low servo gain , so that short central apneas are permitted , for example to cough , clear the throat , talk , or roll over in bed , but only if they follow a previous period of high ventilation ; and normal subjects are treated with an intermediate gain . the integral gain of the servo - control of the degree of assistance is adjustable from very fast ( 0 . 3 cmh 2 o / l / sec / sec ) to very slow . patients with cheyne - stokes breathing have a very high ventilatory control loop gain , but a long control loop delay , leading to hunting . by setting the loop gain even higher , the patient &# 39 ; s controller is stabilized . this prevents the extreme breathlessness that normally occurs during each cycle of cheyne - stokes breathing , and this is very reassuring to the patient . it is impossible for them to have a central apnea . conversely , subjects with obesity - hypoventilation syndrome have low or zero loop gain . they will not feel breathless during a central apnea . however , they have much mucus and need to cough , and are also often very fidgety , needing to roll about in bed . this requires that they have central apneas which the machine does not attempt to treat . by setting the loop gain very low , the patient is permitted to take a couple of deep breaths and then have a moderate - length central apnea while coughing , rolling over , etc , but prolonged sustained apneas or hypopneas are prevented . sudden changes in leakage flow are detected and handled using a fuzzy logic algorithm . the principle of the algorithm is that the leak filter time constant is reduced dynamically to the fuzzy extent that the apparent respiratory airflow is a long way from zero for a long time compared with the patient &# 39 ; s expected respiratory cycle length . rather than simply triggering between two states ( ipap , epap ), the device uses a fuzzy logic algorithm to estimate the position in the respiratory cycle as a continuous variable . the algorithm permits the smooth pressure waveform to adjust it &# 39 ; s rise time automatically to the patient &# 39 ; s instantaneous respiratory pattern . the fuzzy phase detection algorithm under normal conditions closely tracks the patient &# 39 ; s breathing . to the extent that there is a high or suddenly changing leak , or the patient &# 39 ; s ventilation is low , the rate of change of phase ( respiratory rate ) smoothly reverts to the specified target respiratory rate . longer or deeper hypopneas are permitted to the extent that ventilation is on average adequate . to the extent that the servo gain is set high to prevent cheyne stokes breathing , shorter and shallower pauses are permitted . airflow filtering uses an adaptive filter , which shortens it &# 39 ; s time constant if the subject is breathing rapidly , to give very fast response times , and lenthens if the subject is breathing slowly , to help eliminate cardiogenic artifact . the fuzzy changing leak detection algorithm , the fuzzy phase detection algorithm with its differential handling of brief expiratory pauses , and handling of changing leak , together with the smooth waveform severally and cooperatively make the system relatively immune to the effects of sudden leaks . by suitably setting various parameters , the system can operate in cpap , bilevel spontaneous , bilevel timed , proportional assist ventilation , volume cycled ventilation , and volume cycled servo - ventilation , and therefore all these modes are subsets of the present embodiment . however , the present embodiment permits states of operation that can not be achieved by any of the above states , and is therefore distinct from them . note 1 : in this second embodiment , the names and symbols used for various quantities may be different to those used in the first embodiment . note 2 : the term “ swing ” is used to refer to the difference between desired instantaneous pressure at end inspiration and the desired instantaneous pressure at end expiration . note 3 : a fuzzy membership function is taken as returning a value between zero for complete nonmembership and unity for complete membership . fuzzy intersection a and b is the lesser of a and b , fuzzy union a or b is the larger of a and b , and fuzzy negation not a is 1 − a . note 4 : root ( x ) is the square root of x , abs ( x ) is the absolute value of x , sign ( x ) is − 1 if x is negative , and + 1 otherwise . an asterisk (*) is used to explicitly indicate multiplication where this might not be obvious from context . the apparatus for the second embodiment is shown in fig1 b . the blower 110 delivers air under pressure to the mask 111 via the air delivery hose 112 . exhaled air is exhausted via the exhaust 113 in the mask 111 . the pneumotachograph 114 and a differential pressure transducer 115 measure the airflow in the nose 112 . the flow signal is delivered to the microprocessor 116 . pressure at any convenient point 117 along the nose 112 is measured using a pressure transducer 118 . the output from the pressure transducer 118 is delivered to the microcontroller 116 and also to a motor servo 119 . the microprocessor 116 supplies the motor servo 119 with a pressure request signal , which is then compared with the signal from the pressure transducer 118 to control the blower motor 120 . user configurable parameters are loaded into the microprocessor 116 via a communications port 121 , and the computed mask pressure and flow can if desired be output via the communications port 121 . max permissible maximum permissible mask pressure pressure max swing maximum permissible difference between end inspiratory pressure and end expiratory pressure . min swing minimum permissible difference between end inspiratory pressure and end expiratory pressure . epap end expiratory pressure min permissible minimum permissible mask pressure pressure target ventilation minute ventilation is sevo - controlled to equal or exceed this quantity target frequency expected respiratory rate . if the patient is achieving no respiratory airflow , the pressure will cycle at this frequency . target duty cycle expected ratio of inspiratory time to cycle time . if the patient is achieving no respiratory airflow , the pressure will follow this duty cycle . linear resistance resistive unloading = linear resistance * f + andquad resistance quad_resistance * f 2 sign ( f ), where f is the respiratory airflow . where sign ( x ) = − 1 for x & lt ; 0 , + 1 otherwise elastance unload at least this much elastance servo gain gain for servo - control of minute ventilation to at least exceed target ventilation . waveform time constant elastic unloading waveform time constant as a fraction of inspiratory duration . ( 0 . 0 = square wave ) hose resistance δp from pressure sensing port to inside mask = hose resistance times the square of the flow in the intervening tubing . diffuser conductance flow through the mask exhaust port = diffuser conductance * root mask pressure the expected duration of a respiratory cycle , of an inspiration , and of an expiration are set respectively to : the standard rates of change of phase ( revolutions per sec ) during inspiration and expiration are set respectively to : the instantaneous elastic support at any phase φ in the respiratory cycle is given by : π ( φ ) = e − 2 τφ during inspiration , e − 4 t ( φ − 0 . 5 ) during expiration if τ = 0 , then π ( φ ) is a square wave . the maximum implemented value for τ = 0 . 3 , producing a waveform approximately as shown in fig5 . π bar = 0 . 5 ⁢ ∫ 0 . 05 ` ⁢ π ⁡ ( ϕ ) ⁢ ⁢ ⅆ ϕ the following is an overview of routine processing done at 50 hz : measure flow at flow sensor and pressure at pressure sensing port calculate mask pressure and flow from sensor pressure and flow calculate conductance of mask leak calculate instantaneous airflow through leak calculate respiratory airflow and low pass filtered respiratory airflow calculate mask on - off status and lead - in calculate instantaneous and recent peak jamming calculate time constant for leak conductance calculations calculate phase in respiratory cycle update mean rates of change of phase for inspiration and expiration , lengths of inspiratory and expiratory times , and respiratory rate add hose pressure loss to epap pressure add resistive unloading calculate instantaneous elastic assistance required to servo - control ventilation estimate instantaneous elastic recoil pressure using various assumptions weight and combine estimates add servo pressure to yield desired sensor pressure servo - control motor speed to achieve desired sensor pressure flow is measured at the outlet of the blower using a pneumotachograph and differential pressure transducer . pressure is measured at any convenient point between the blower outlet and the mask . a humidifier and / or anti - bacterial filter may be inserted between the pressure sensing port and the blower . flow and pressure are digitized at 50 hz using an a / d converter . the pressure loss from pressure measuring point to mask is calculated from the flow at the blower and the ( quadratic ) resistance from measuring point to mask . where sign ( x )=− 1 for x & lt ; 0 , + 1 otherwise . the mask pressure is then calculated by subtracting the hose pressure loss from the measured sensor pressure : the flow through the mask exhaust diffuser is calculated from the known parabolic resistance of the diffuser holes , and the square root of the mask pressure : the foregoing describes calculation of mask pressure and flow in the various treatment modes . in diagnostic mode , the patient is wearing only nasal cannulae , not a mask . the cannula is plugged into the pressure sensing port . the nasal airflow is calculated from the pressure , after a linearization step , and the mask pressure is set to zero by definition . the time constant for the two low pass filtering steps is initialized to 10 seconds and adjusted dynamically thereafter ( see below ). the instantaneous flow through the leak is calculated from the instantaneous mask pressure and the conductance of the leak : the respiratory airflow is the difference between the flow at the mask and the instantaneous leak : low pass filter the respiratory airflow to remove cardiogenic airflow and other noise . the time constant is dynamically adjusted to be 1 / 40 of the current estimated length of the respiratory cycle t tot ( initialized to std_t tot and updated below ). this means that at high respiratory rates , there is only a short phase delay introduced by the filter , but at low respiratory rates , there is good rejection of cardiogenic airflow . the mask is assumed to initially be off . an off - on transition is taken as occurring when the respiratory airflow first goes above 0 . 2 l / sec , and an on - off transition is taken as occurring if the mask pressure is less than 2 cmh 2 o for more than 1 . 5 seconds . lead - in is a quantity that runs from zero if the mask is off , or has just been donned , to 1 . 0 if the mask has been on for 20 seconds or more , as shown in fig6 . j is the fuzzy extent to which the impedance of the leak has suddenly changed . it is calculated as the fuzzy extent to which the absolute magnitude of the respiratory airflow is large for longer than expected . the fuzzy extent a i to which the airflow has been positive for longer than expected is calculated from the time t zi since the last positive - going zero crossing of the calculated respiratory airflow signal , and the expected duration std t i of a normal inspiration for the particular subject , using the fuzzy membership function shown in fig7 . the fuzzy extent b i to which the airflow is large and positive is calculated from the instantaneous respiratory airflow using the fuzzy membership function shown in fig8 . the fuzzy extent i i to which the leak has suddenly increased is calculated by calculating the fuzzy intersection ( lesser ) of a i and b i . precisely symmetrical calculations are performed for expiration , deriving i e . as the fuzzy extent to which the leak has suddenly decreased . a e is calculated from t ze and t e , b e is calculated from minus f resp , and i e is the fuzzy intersection of a e and b e . the instantaneous jamming index j is calculated as the fuzzy union ( larger ) of indices i i and i e . if the instantaneous jamming index is larger than the current value of the recent peak jamming index , then the recent peak jamming index is set to equal the instantaneous jamming index . otherwise , the recent peak jamming index is set to equal the instantaneous jamming index low pass filtered with a time constant of 10 seconds . an electrical analogy of the calculation is shown in fig9 . if the conductance of the leak suddenly changes , then the calculated conductance will initially be incorrect , and will gradually approach the correct value at a rate which will be slow if the time constant of the low pass filters is long , and fast if the time constant is short . conversely , if the impedance of the leak is steady , the longer the time constant the more accurate the calculation of the instantaneous leak . therefore , it is desirable to lengthen the time constant to the extent that the leak is steady , reduce the time constant to the extent that the leak has suddenly changed , and to use intermediately longer or shorter time constants if it is intermediately the case that the leak is steady . if there is a large and sudden increase in the conductance of the leak , then the calculated respiratory airflow will be incorrect . in particular , during apparent inspiration , the calculated respiratory airflow will be large positive for a time that is large compared with the expected duration of a normal inspiration . conversely , if there is a sudden decrease in conductance of the leak , then during apparent expiration the calculated respiratory airflow will be large negative for a time that is large compared with the duration of normal expiration . therefore , the time constant for the calculation of the conductance of the leak is adjusted depending on j peak , which is a measure of the fuzzy extent that the leak has recently suddenly changed , as shown in fig1 . in operation , to the extent that there has recently been a sudden and large change in the leak , j peak will be large , and the time constant for the calculation of the conductance of the leak will be small , allowing rapid convergence on the new value of the leakage conductance . conversely , if the leak is steady for a long time , j peak will be small , and the time constant for calculation of the leakage conductance will be large , enabling accurate calculation of the instantaneous respiratory airflow . in the spectrum of intermediate situations , where the calculated instantaneous respiratory airflow is larger and for longer periods , j peak will be progressively larger , and the time constant for the calculation of the leak will progressively reduce . for example , at a moment in time where it is uncertain whether the leak is in fact constant , and the subject has merely commenced a large sigh , or whether in fact there has been a sudden increase in the leak , the index will be of an intermediate value , and the time constant for calculation of the impedance of the leak will also be of an intermediate value . the advantage is that some corrective action will occur very early , but without momentary total loss of knowledge of the impedance of the leak . the current phase φ runs from 0 for start of inspiration to 0 . 5 for start of expiration to 1 . 0 for end expiration = start of next inspiration . nine separate features ( peaks , zero crossings , plateaux , and some intermediate points ) are identified on the waveform , as shown in fig1 . the filtered respiratory airflow is normalized with respect to the user specified target ventilation as follows : next , the fuzzy membership in fuzzy sets large negative , small negative , zero , small positive , and large positive , describing the instantaneous airflow is calculated using the membership functions shown in fig1 . for example , if the normalized airflow is 0 . 25 , then the airflow is large negative to extent 0 . 0 , small negative to extent 0 . 0 , zero to extent 0 . 5 , small positive to extent 0 . 5 , large positive to extent 0 . 00 . the rate of change of filtered respiratory airflow is calculated and normalized to a target ventilation of 7 . 5 l / min at 15 breaths / min as follows : now evaluate the membership of normalized df / dt in the fuzzy sets falling , steady , and rising , whose membership functions are shown in fig1 . ventilation = abs ( respiratory airflow ), low pass filtered with a time constant of stdt tot . hypopnea is the fuzzy extent to which the normalized ventilation is zero . the membership function for hypopnea is shown in fig1 . recent ventilation is also a low pass filtered abs ( respiratory airflow ), but filtered with an adjustable time constant , calculated from servo gain ( specified by the user ) as shown in fig1 . for example , if the servo gain is set to the maximum value of 0 . 3 , the time constant is zero , and recent ventilation equals instantaneous abs ( respiratory airflow ). conversely , if servo gain is zero , the time constant is twice std t tot , the expected length of a typical breath . hyperpnea is the fuzzy extent to which the recent ventilation is large . the membership function for hyperpnea is shown in fig1 . the fuzzy extent to which there is a big leak is calculated from the membership function shown in fig1 . membership in fuzzy sets switch negative and switch positive are calculated from the normalized respiratory airflow using the membership functions shown in fig1 , and membership in fuzzy sets insp_phase and exp_phase are calculated from the current phase f using the membership functions shown in fig1 . procedure w ( y ) calculates the area of an isosceles triangle of unit height and unit base , truncated at height y as shown in fig2 . in the calculations that follow , recall that fuzzy intersection a and b is the smaller of a and b , fuzzy union a or b is the larger of a and b , and fuzzy negation not a is 1 − a . the first fuzzy rule indicates that lacking any other information the phase is to increase at a standard rate . this rule is unconditionally true , and has a very heavy weighting , especially if there is a large leak , or there has recently been a sudden change in the leak , or there is a hypopnea . the next batch of fuzzy rules correspond to the detection of various features of a typical flow - vs - time curve . these rules all have unit weighting , and are conditional upon the fuzzy membership in the indicated sets : w peak insp = w ( large positive and steady and not recent peak jamming ) the next rule indicates that there is a legitimate expiratory pause ( as opposed to an apnea ) if there has been a recent hyperpnea and the leak has not recently changed : w pause =( hyperpnea and not j peak )* w ( steady and zero ) recalling that the time constant for hyperpnea gets shorter as servo gain increases , the permitted length of expiratory pause gets shorter and shorter as the servo gain increases , and becomes zero at maximum servo gain . the rationale for this is that ( i ) high servo gain plus long pauses in breathing will result in “ hunting ” of the servo - controller , and ( ii ) in general high servo gain is used if the subject &# 39 ; s chemoreceptor responses are very brisk , and suppression of long apneas or hypopneas will help prevent the subject &# 39 ; s own internal servo - control from hunting , thereby helping prevent cheyne - stokes breathing . finally , there are two phase - switching rules . during regular quiet breathing at roughly the expected rate , these rules should not strongly activate , but they are there to handle irregular breathing or breathing at unusual rates . they have very heavy weightings . for each of the ten fuzzy rules above , we attach phase angles f n , as shown in table zzz . note that φ are in revolutions , not radians . we now place the ten masses w ( n ) calculated above at the appropriate phase angles φ n around the unit circle , and take the centroid . rule n φ n standard 1 current φ trig insp 2 0 . 00 early insp 3 0 . 10 peak insp 4 0 . 30 late insp 5 0 . 50 trig exp 6 0 . 5 + 0 . 05 k early exp 7 0 . 5 + 0 . 10 k peak exp 8 0 . 5 + 0 . 20 k late exp 9 0 . 5 + 0 . 4 k exp pause 10 0 . 5 + 0 . 5 k note that if the user has entered very short duty cycle , k will be small . for example a normal duty cycle is 40 %, giving k = 40 / 60 = 0 . 67 . thus the expiratory peak will be associated with a phase angle of 0 . 5 + 0 . 2 * 0 . 67 = 0 . 63 , corresponding 26 % of the way into expiratory time , and the expiratory pause would start at 0 . 5 + 0 . 5 * 0 . 67 = 0 . 83 , corresponding to 67 % of the way into expiratory time . conversely , if the duty cycle is set to 20 % in a patient with severe obstructive lung disease , features 6 through 10 will be skewed or compressed into early expiration , generating an appropriately longer expiratory pause . the new estimate of the phase is the centroid , in polar coordinates , of the above ten rules : centroid = arc ⁢ ⁢ tan ⁡ ( ∑ w n ⁢ sin ⁢ ⁢ ϕ n ∑ w n ⁢ cos ⁢ ⁢ ϕ n ) the change in phase dφ from the current phase φ to the centroid is calculated in polar coordinates . thus if the centroid is 0 . 01 and the current phase is 0 . 99 , the change in phase is dφ = 0 . 02 . conversely , if the centroid is 0 . 99 and the current phase is 0 . 01 , then dφ =− 0 . 02 . the new phase is then set to the centroid : this concludes the calculation of the instantaneous phase in the respiratory cycle φ . estimated mean duration of inspiration , expiration , cycle time , and respiratory rate if the current phase is inspiratory ( φ & lt ; 0 . 5 ) the estimated duration of inspiration t i is updated : lp ( dφ i )= low pass filtered dφ with a time constant of 4 * stdt tot conversely , if the current phase is expiratory , ( φ & gt ;= 0 . 5 ) the estimated duration of expiration t e is updated : lp ( dφ e )= low pass filtered dφ with a time constant of 4 * stdt tot the purpose of the clipping is firstly to prevent division by zero , and also so that the calculated t i and t e are never more than a factor of 4 shorter or a factor of 2 longer than expected . finally , the observed mean duration of a breath t tot and respiratory rate rr are : the resistive unloading is the pressure drop across the patient &# 39 ; s upper and lower airways , calculated from the respiratory airflow and resistance values stored in sram the purpose of the instantaneous elastic assistance is to provide a pressure which balances some or all of the elastic deflating pressure supplied by the springiness of the lungs and chest wall ( instantaneous elastic pressure ), plus an additional component required to servo - control the minute ventilation to at least exceed on average a pre - set target ventilation . in addition , a minimum swing , always present , is added to the total . the user - specified parameter elastance is preset to say 50 - 75 % of the known or estimated elastance of the patient &# 39 ; s lung and chest wall . the various components are calculated as follows : the quantity servo swing is the additional pressure modulation amplitude required to servo - control the minute ventilation to at least equal on average a pre - set target ventilation . minute ventilation is defined as the total number of litres inspired or expired per minute . however , we can &# 39 ; t wait for a whole minute , or even several seconds , to calculate it , because we wish to be able to prevent apneas or hypopneas lasting even a few seconds , and a pi controller based on an average ventilation over a few seconds would be either sluggish or unstable . the quantity actually servo - controlled is half the absolute value of the instantaneous respiratory airflow . a simple clipped integral controller with no damping works very satisfactorily . the controller gain and maximum output ramp up over the first few seconds after putting the mask on . if we have had a sudden increase in mouth leak , airflow will be nonzero for a long time . a side effect is that the ventilation will be falsely measured as well above target , and the amount of servo assistance will be falsely reduced to zero . to prevent this , to the extent that the fuzzy recent peak jamming index is large , we hold the degree of servo assistance at its recent average value , prior to the jamming . set recent servo swing = servo swing low pass filtered with a time constant of 25 sec . the instantaneous servo assistance is calculated by multiplying servo swing by the previously calculated pressure waveform template : the instantaneous pressure required to unload the elastic work of inspiring against the user - specified elastance is the specified elastance times the instantaneous inspired volume . unfortunately , calculating instantaneous inspired volume simply by integrating respiratory airflow with respect to time does not work in practice for three reasons : firstly leaks cause explosive run - away of the integration . secondly , the integrator is reset at the start of each inspiration , and this point is difficult to detect reliably . thirdly , and crucially , if the patient is making no efforts , nothing will happen . therefore , four separate estimates are made , and a weighted average taken . estimate 1 : exact instantaneous elastic recoil calculated from instantaneous tidal volume , with a correction for sudden change in leak the first estimate is the instantaneous elastic recoil of a specified elastance at the estimated instantaneous inspired volume , calculated by multiplying the specified elastance by the integral of a weighted respiratory airflow with respect to time , reset to zero if the respiratory phase is expiratory . the respiratory airflow is weighted by the fuzzy negation of the recent peak jamming index j peak , to partly ameliorate an explosive run - away of the integral during brief periods of sudden increase in leak , before the leak detector has had time to adapt to the changing leak . in the case where the leak is very steady , j peak will be zero , the weighting will be unity , and the inspired volume will be calculated normally and correctly . in the case where the leak increases suddenly , j peak will rapidly increase , the weighting will decrease , and although typically the calculated inspired volume will be incorrect , the over - estimation of inspired volume will be ameliorated . calculations are as follows : estimate 2 : based on assumption that the tidal volume equals the target tidal volume the quantity standard swing is the additional pressure modulation amplitude that would unload the specified elastance for a breath of a preset target tidal volume . estimate 3 : based on assumption that the tidal volume equals the target tidal volume divided by the observed mean respiratory rate rr calculated previously . estimate 4 : based on assumption that this breath is much like recent breaths the instantaneous assistance based on the assumption that the elastic work for this breath is similar to that for recent breaths is calculated as follows : lp elastic assistance = instantaneous elastic assistance low pass filtered with a time constant of 2 stdt tot the above algorithm works correctly even if π ( φ ) is dynamically changed on - the - fly by the user , from square to a smooth or vice versa . for example , if an 8 cmh 2 o square wave ( π bar = 1 ) adequately assists the patient , then a sawtooth wave ( π bar = 0 . 5 ) will require 16 cmh 2 o swing to produce the same average assistance . next , calculate the pressure required to unload a best estimate of the actual elastic recoil pressure based on a weighted average of the above . if π ( φ ) is set to the smoothest setting , the estimate is based equally on all the above estimates of instantaneous elastic recoil . if π ( φ ) is a square wave , the estimate is based on all the above estimates except for estimate 1 , because a square wave is maximal at φ = 0 , whereas estimate 1 is zero at φ = 0 . intermediate waveforms are handled intermediately . quantity smoothness runs from zero for a square wave to 1 for a waveform time constant of 0 . 3 or above . now add the estimates based on minimum and servo swing , truncate so as not to exceed a maximum swing set by the user . reduce ( lead in gradually ) if the mask has only just been put on . truncate i to be less than preset maximum permissible swing instantaneous elastic assistance = i * lead - in in the final step , the measured pressure at the sensor is servo - controlled to equal the desired sensor pressure , using for example a clipped pseudodifferential controller to adjust the motor current . reference can be made to fig1 in this regard . fig2 - 27 each show an actual 60 second recording displaying an aspect of the second embodiment . all recordings are from a normal subject trained to perform the required manoeuvres . calculated respiratory airflow , mask pressure , and respiratory phase are calculated using the algorithms disclosed above , output via a serial port , and plotted digitally . in fig2 - 26 respiratory airflow is shown as the darker tracing , the vertical scale for flow being ± l / sec , inspiration upwards . the vertical scale for the pressure ( light trace ) is 0 . 2 cmh 2 o . fig2 is recorded with the servo gain set to 0 . 1 cmh 2 o / l / sec / sec , which is suitable for subjects with normal chemoflexes . the subject is breathing well above the minimum ventilation , and a particularly deep breath ( sigh ) is taken at point ( a ). as is usual , respiratory effort ceases following the sigh , at point ( c ). the device correctly permits a short central apnea ( b ), as indicated by the device remaining at the end expiratory pressure during the period marked ( b ). conversely fig2 shows that if there is no preceding deep breath , when efforts cease at ( a ), the pressure correctly continues to cycle , thus preventing any hypoxia . fig2 is recorded with servo gain set high , as would be appropriate for a subject with abnormally high chemoreflexes such as is typically the case with cheyne - stokes breathing . now when effort ceases at arrow ( a ), pressure continues to cycle and a central apnea is no longer permitted , despite preceding deep breathing . this is advantageous for preventing the next cycle of cheyne - stokes breathing . the above correct behaviour is also exhibited by a time mode device , but is very different to that of a spontaneous mode bilevel device , or equally of proportional assist ventilation , both of which would fail to cycle after all central apneas , regardless of appropriateness . fig2 shows automatically increasing end - inspiratory pressure as the subject makes voluntarily deeper inspiratory efforts . the desirable behaviour is in common with pav , but is different to that of a simple bilevel device , which would maintain a constant level of support despite an increased patient requirement , or to a volume cycled device , which would actually decrease support at a time of increasing need . fig2 is recorded with a somewhat more square waveform selected . this figure shows automatically increasing pressure support when the subject voluntarily attempts to resist by stiffening the chest wall at point ( a ). this desirable behaviour is common with pav and volume cycled devices , with the expectation that pav cannot selectively deliver a squarer waveform . it is distinct from a simple bilevel device which would not augment the level of support with increasing need . fig2 shows that with sudden onset of a severe 1 . 4 l / sec leak at ( a ), the flow signal returns to baseline ( b ) within the span of a single breath , and pressure continues to cycle correctly throughout . although timed mode devices can also continue to cycle correctly in the face of sudden changing leak , the are unable to follow the subject &# 39 ; s respiratory rate when required ( as shown in fig2 ). other known bilevel devices and pav mis - trigger for longer or shorter periods following onset of a sudden sever leak , and pav can deliver greatly excessive pressures under these conditions . fig2 shows an actual 60 second tracing showing respiratory airflow ( heavy trace ± 1 l / sec full scale ) and respiratory phase as a continuous variable ( light trace , 0 to 1 revolution ), with high respiratory rate in the left half of the trace and low respiratory rate in the right half of the trace . this trace demonstrates that the invention can determine phase as a continuous variable . in the prior art , phase is taken as a categorical variable , with two values : inspiration and expiration . errors in the detection of start of inspiration and start of expiration produce categorical errors in delivered pressure . conversely , here , phase is treated as a continuous variable having values between zero and unity . thus categorical errors in measurement of phase are avoided . by using a short time constant when the subject is breathing rapidly , and a long time constant when the subject is breathing slowly , the filter introduces a fixed phase delay which is always a small fraction of a respiratory cycle . thus unnecessary phase delays can be avoided , but cardiogenic artifact can be rejected in subjects who are breathing slowly . furthermore , because phase is treated as a continuous variable , it is possible to largely compensate for the delay in the low pass filter . with all prior art there is an intrusive discontinuous change in pressure , either at the start of inspiration or at the start of expiration . here , the pressure change is continuous , and therefore more comfortable . with proportional assist ventilation , the instantaneous pressure is a function of instantaneous volume into the breath . this means that a sudden large leak can cause explosive pressure run - away . here , where instantaneous pressure is a function of instantaneous phase rather than tidal volume , this is avoided . average inspiratory duration is easier to calculate in the presence of leak than is tidal volume . by taking advantage of a correlation between average inspiratory duration and average tidal volume , it is possible to adjust the amplitude of modulation to suit the average tidal volume . provision of a pressure component for unloading turbulent upper airway resistance , and avoiding cardiogenic pressure instabilities . although younes describes the use of a component of pressure proportional to the square of respiratory airflow to unload the resistance of external apparatus , the resistance of the external apparatus in embodiments of the present invention is typically negligible . conversely , embodiments of the present invention describes two uses for such a component proportional to the square of respiratory airflow that were not anticipated by younes . firstly , sleeping subjects , and subjects with a blocked nose , have a large resistance proportional to the square of airflow , and a pressure component proportional to the square of airflow can be used to unload the anatomical upper airway resistance . secondly , small nonrespiratory airflow components due to heartbeat or other artifact , when squared , produces negligible pressure modulation , so that the use of such a component yields relative immunity to such nonrespiratory airflow . there is a smooth , seamless gradation from flexibly tracking the subject &# 39 ; s respiratory pattern during spontaneous breathing well above the target ventilation , to fully controlling the duration , depth , and phase of breathing if the subject is making no efforts , via a transitional period in which the subject can make progressively smaller changes to the timing and depth of breathing . a smooth transition avoids categorization errors when ventilation is near but not at the desired threshold . the advantage is that the transition from spontaneous to controlled ventilation occurs unobtrusively to the subject . this can be especially important in a subject attempting to go to sleep . a similar smooth transition can occur in the reverse direction , as a subject awakens and resumes spontaneous respiratory efforts .

the apparatus provides for the determination of the instantaneous phase in the respiratory cycle , subject &# 39 ; s average respiration rate and the provision of ventilatory assistance . a microprocessor receives an airflow signal from a pressure transducer coupled to a port at a mask . the microprocessor controls a servo , that in turn controls the fan motor and thus the pressure of air delivered by the blower . the blower is coupled to a subject &# 39 ; s mask by a conduit . the invention seeks to address the following goals : while the subject is awake and making substantial efforts the delivered assistance should be closely matched in phase with the subject &# 39 ; s efforts ; the machine should automatically adjust the degree of assistance to maintain at least a specified minimum ventilation without relying on the integrity of the subject &# 39 ; s chemoreflexes ; and it should continue to work correctly in the pesence of large leaks .

a dispensing container comprises a housing 14 , which encloses an interior 15 . the interior 15 has a cylinder shape and is open at the rear end . at the front end , the housing 14 has a discharge tip 17 with an outlet channel 18 in the interior thereof . a needle 19 extends in a continuation of the discharge tip 17 . in the state when ready for use , the interior 15 of the dispensing container is filled with a dental compound , and the open end of the interior 15 is closed off by a plunger 29 as shown in fig2 . the plunger 29 is guided by the inner surface of the housing , which inner surface serves as a slide surface 32 . when pressure is applied to the dental compound via the plunger 29 , the dental compound moves through the needle 19 and emerges at the front end of the needle . since the needle 19 is long and thin , the dental compound can be discharged with precision even at sites that are otherwise difficult to access . in order to apply pressure to the plunger 29 , a discharge tool ( not shown ) is provided that has a ram for pressing the plunger 29 forward . according to fig3 , the outlet channel 18 of the housing 14 comprises a first channel portion 20 and a second channel portion 21 . in the first channel portion 20 , the inner surface of the outlet channel 18 is adapted to the outer surface of the needle 19 . the needle 19 can be inserted into the first channel portion 20 only when the needle 19 is centered and correctly aligned . at the rear end of the first channel portion 20 , a limit stop 23 is formed against which the needle 19 abuts when it has reached its end position . in the first channel portion 20 , a slight gap is at most present between the outer wall of the needle 19 and the inner wall of the outlet channel 18 , such that the needle 19 can be inserted without great resistance . in a second channel portion 21 , the diameter of the outlet channel 18 narrows in the direction of the rear end . at the rear end , the diameter coincides with the first channel portion 20 , such that there is a seamless transition between the channel portions 20 , 21 . the second channel portion 21 is adjoined by a widening mouth 22 , by means of which the channel diameter markedly increases toward the mouth . the needle 19 has a length of approximately 20 mm , and the outlet channel 18 has a length of approximately 6 mm . the needle 19 therefore protrudes forward by 14 mm from the discharge tip 17 . depending on the embodiment , the diameter of the needle 19 can be between 0 . 5 mm and 1 . 8 mm . the needle 19 is made of a soft - annealed steel . the needle 19 can therefore be bent to the side without breaking or without the channel in the interior being closed . when the needle 19 is in its final position in the outlet channel , a gap 16 between the outer wall of the needle 19 and the outlet channel 18 remains in the area of the widening mouth 22 and of the second channel portion 21 . using a suitable tool , an adhesive 24 is injected into the area of the widening mouth 22 , such that the adhesive penetrates rearward along the gap 16 . adhesive 24 is introduced in such a quantity as to ensure that the gap 16 is filled completely with adhesive 24 . it is possible for some of the adhesive 24 also to penetrate into the first channel portion 20 . when the adhesive 24 has hardened and has formed a firm connection with the needle 19 and with the outlet channel 18 , the needle 19 is securely fixed in the outlet channel 18 . in fig4 , view a on the left shows a discharge tip 17 in which the outlet channel 18 has a smaller diameter , and view b on the right shows a discharge tip 17 in which the outlet channel has a greater diameter . it is a considerable advantage that a single injection mold suffices to produce both of the embodiments according to fig4 a and fig4 b . for this purpose , another insert , which defines the dimension of the outlet channel 18 , simply has to be fitted into the injection mold . alternatively , it is also possible to insert into the outlet channel 18 a needle 19 that has a smaller diameter than the outlet channel 18 along the entire length . the needle 19 is fixed only when the adhesive fills the gap and hardens . in this embodiment , the housing with the outlet channel 18 can be produced as a single injection - molded part and can be provided with needles 19 of different diameter depending on the intended use . a further difference from the embodiment according to fig3 is that , in the second channel portion 21 , elongate depressions 25 are formed in the wall of the outlet channel 18 . as a result of the depressions 25 , the adhesive 24 has more space to force its way rearward in the gap 16 . fig5 shows a dispensing container in which a cap 26 is fitted onto the discharge tip 17 . the cap 26 protects the dental compound from contact with the ambient air and protects the needle 19 from damage caused by impacts . to make fitting and removing the cap 26 easier , longitudinal ribs ( not visible in the cross - sectional view in fig6 ) are formed on the outer face of the cap 26 . the needle 19 is closed at its front end and instead has outlet openings 31 facing to the side . peripheral webs 27 are formed on the inner wall of the cap 26 and are adapted to the circumference of the discharge tip 17 . the webs 27 bear on the discharge tip 17 , as a result of which the cap 26 is held in place and a seal is provided with respect to the environment . at its rear end , the cap 26 is provided with an outwardly facing bulge 28 . according to fig7 , the bulge 28 can be used as an abutment for bending the needle 19 with the aid of the cap 26 . the cap 26 comprises a limit stop 30 at its rear end . the limit stop 30 abuts against the discharge tip 17 when the needle 19 is bent at the correct angle , about 30 ° in the example shown . in the embodiment in fig8 , the discharge tip 17 extends at an angle of about 40 ° relative to the longitudinal axis of the housing 14 . in this configuration , it is not necessary to bend the needle 19 before it can be inserted into the cavity of a molar . the needle 19 is made of elastic polypropylene , such that the needle 19 , during insertion , can easily follow the course of the root canal . in the embodiment in fig9 , the discharge tool 45 contains dispensing container 42 . inside the dispensing container 42 there is a dental compound 41 and a plunger 29 . the discharge tool 45 comprises a ram 43 for pressing the plunger 29 forward . the ram is operated by pushing the handle , which is shown in the left side of the figure . the ram 43 pushes against the back surface of the plunger 29 , thereby pressing the dental compound 41 through outlet channel 18 . in the embodiment depicted in fig9 , the dispensing container 42 is a disposable part . once the dispensing container 42 is used , it may be separated from the discharge tool 45 . in order to use the discharge tool 45 once again , another dispensing container 42 with another amount of dental compound 41 is attached to the discharge tool 45 . the plunger 29 is pushed against the ram 43 of the new dispensing container 42 for dispensing the dental compound . in the depicted embodiment , the plunger 29 and dental compound 41 are incorporated into a single , replaceable dispensing container 42 . in alternate embodiments , the plunger 29 may be separate from the dispensing container 42 and may be replaced separately .

a dispensing system comprising a discharge tool in the form of a compule gun and a replaceable dispensing container in the form of a compule for dental compound . the dispensing container comprises a housing , on the inside of which a slide surface is formed that is intended for engagement with a plunger . the housing encloses an interior and is provided with an outlet channel . a portion of a needle is inserted into the outlet channel . a gap is present between the circumference of the needle and the outlet channel . an adhesive is introduced into the gap . a ram in the discharge tool engages the plunger . a method also produces a dispensing system of this kind .

while the present invention may be susceptible to embodiment in different forms , there is shown in the drawings , and herein will be described in detail , an embodiment with the understanding that the present description is to be considered an exemplification of the principles of the invention and is not intended to limit the invention to that as illustrated and described herein . fig1 shows a grinder 20 of the present invention including a cabinet 22 having an upper portion 24 , a lower portion 26 and a lid 28 covering the upper portion . a discharge assembly 30 is positioned on a front side 32 of the cabinet 22 for dispensing a ground substance therethrough . a container or bag 34 ( shown herein in phantom line in the interest of clarity ) is positioned beneath the discharge assembly 30 and against a substance settling assembly 36 which is described in greater detail hereinbelow . the present invention includes the grinder 20 as well as various systems associated with and / or used with the grinder . while the grinder of the present invention is broadly used for grinding a material to produce a ground substance and the systems of the grinder may be used in a variety of different applications , the present description will generally refer to material as whole bean coffee or coffee beans and the ground substance as ground coffee . as the grinder may be used in other applications as will be evident upon review of this description , the description is not intended to limit the description of the present invention solely to a coffee grinder . with further reference to fig2 - 10 , the present invention includes a container retaining assembly 38 ( see fig2 and 4 - 7 ), a magnetic assembly 40 ( see fig2 ), an active ventilation system 42 ( see fig2 and 10 ), an activation switch assembly 44 ( see fig4 - 7 and 10 ), and a chaff retainer 46 operated by a clean - out member 48 ( see fig2 and 7 - 9 ). each of the foregoing portions of the present invention shall be described in greater detail hereinbelow . also , fig1 - 3 provide an illustration of the substance settling assembly 36 of the present invention . as shown in fig2 the substance settling assembly 36 includes a shaker arm 50 which has a shaker plate 52 on end thereof extending outside of the cabinet 22 and a mounting end 54 retained inside the cabinet 22 . the substance settling assembly 36 also includes an agitating device 56 which is coupled to a drive shaft 58 driven by a motor 60 . the motor 60 drives the drive shaft 58 to operate a grinder mechanism 62 . the agitating device 56 utilizes the rotary motion of the motor shaft 58 to agitate , reciprocate or move the shaker arm 50 . movement of the shaker arm 50 moves or gently shakes the container 34 positioned near the discharge assembly 30 in order to settle ground coffee dispensed by the grinder . the agitating device 56 includes an eccentric cam assembly 64 retained on the drive shaft 58 and an actuator rod 66 positioned to abut both the eccentric cam assembly 64 and the shaker arm 50 . the actuator rod 66 is retained in a bore 68 which permits axial movement of the actuator rod 66 in response to the eccentric movement of the cam assembly 64 . the actuator rod 66 translates the eccentric movement of the cam assembly 64 to displace or move the shaker arm 50 positioned thereagainst . the mounting end 54 of the shaker arm 50 is attached to the grinder 20 by a spring 70 . the spring 70 has a first end 72 and a second end 74 . the first end 72 is mounted to the grinder 20 on a wall 76 of the grinder body . the second end 74 of the spring 70 is attached to the mounting end 54 of the shaker arm 50 . as such , the spring 70 facilitates movement of the shaker arm 50 in response to the reciprocating action of the actuator rod 66 . in use , the substance settling assembly 36 operates to automatically move or shake ground coffee dispensed through the discharge assembly 30 into the container 34 . the shaking helps to settle the ground coffee which , as a result of grinding , has greater loft than the whole bean . for example , if the container 34 is filled with whole bean coffee and the whole bean coffee is then deposited into a hopper 78 of the grinder 20 , the resultant ground coffee will have a greater volume than the whole bean coffee which originally filled the container . as a result , the settling assembly 36 helps to prevent overflowing the container 34 . when operated , the drive shaft 58 rotates and thereby rotating the cam assembly 64 retained thereon . with further reference to fig3 the cam assembly 64 is mounted on an eccentric portion 80 of the shaft 58 . because the eccentric portion 80 of the shaft 58 is offset from a central axis 82 of the shaft 58 , the cam assembly 64 will oscillate relative to the axis 82 . the oscillating motion of the cam assembly 64 will drive against the actuator rod 66 to drive the rod 66 outwardly through the bore 68 and against the abutting portion of the shaker arm 50 . as can be seen from fig1 and 2 , the arm 50 extends from the cabinet 22 a sufficient distance to abut a container 34 retained relative to the discharge assembly 30 . the combination of the spring 70 to which the arm 50 is attached and the position of the arm 50 relative to the container creates a return force on the arm 50 as the container 34 fills with ground coffee . therefore , the container 34 rests against the plate 52 of the arm 50 to produce a return force on the actuator rod 66 to promote the reciprocating action of the rod 66 and the subsequent reciprocal movement of the arm 50 . with reference to fig3 as the actuator rod 66 is driven towards the shaker arm 50 as a result of the movement of the cam 64 , the arm 50 will create a return force driving the rod 66 towards the cam 64 in response to the continued eccentric rotation of the cam 64 relative to the axis 82 of the shaft 58 . ultimately , the operation of the substance settling assembly 36 while grinding coffee will result in simultaneously grinding coffee , dispensing coffee into the container 34 , and settling the ground coffee in the container during the grinding process . at the end of the grinding process , the user of the grinder will not need to tap or manually settle the ground coffee . also , the ground coffee will not overflow the container as a result of the lofting or fluffing of the ground coffee during the grinding process because the ground coffee will already be settled . settling of the ground coffee will help to prevent waste , cleanup , and clogging or entrapment of ground coffee in components of the grinder . having now described the substance settling assembly 36 , attention is now turned to the container retainer or container retaining assembly 38 and the activation switch assembly 44 . the container retaining assembly 38 and activation switch assembly 44 work in combination to retain a container 34 relative to the discharge assembly 30 and to prevent inadvertent operation of the grinder 20 in the absence of a container 34 . the retaining assembly 38 and switch assembly 44 are shown in fig2 and 4 - 7 . as shown in fig2 - 6 , the container retaining assembly 38 includes a cam body 84 which is pivotally retained on a portion of the grinder body 86 by attachment to a control rod 88 extending through the grinder body 86 and cam body 84 . a set screw 90 extends through the cam body 84 to hold the cam body 84 to the control rod 88 . as such , the cam body 84 may be moved from a release position ( see fig4 ) to a retaining position ( see fig5 ) whereby a portion of a container 34 is retained between the cam body 84 and a portion of the discharge assembly 30 . the length of the cam body 84 from an axis of rotation 92 to a distal end 94 thereof is greater than a dimension from the axis of rotation 92 to the portion of the discharge assembly against which the container is held . the cam body 84 also includes at least one and , as illustrated , a pair of o - rings 96 which increase the frictional contact between the cam body 84 and the surface of the container 34 engaged by the cam body 84 . the shape , mounting location and position of the cam body 84 prevents inadvertent disengagement of the container 34 from the discharge assembly 30 when the cam body 84 is in the retaining position ( see fig5 ). in fact , forces applied to the container to disengage the container from the discharge assembly will produce increased gripping forces by the cam body 84 on the container 34 . the ability of the container retaining assembly 38 to increase the engaging force against a container 34 upon applying a disengaging force to the container 34 is useful in combination with the substance settling assembly 36 of the present invention . the substance settling assembly acts against a side of the container 34 and thus applies a degree of disengaging force to the container . additionally , as the container 34 fills with ground coffee downward forces created by the weight of the coffee tend to work to disengage the container from the discharge assembly 30 . as such , the container retaining assembly 38 holds a container 34 in proper position below the discharge assembly 30 during the grinding process . in the present invention , as illustrated , the switch assembly 44 operates in combination with the container retaining assembly 38 . the switch assembly 44 includes a roller switch 100 generally of known construction . the roller switch 100 is attached to a switch bracket 102 and is positioned relative to an extending portion 104 of the control rod 88 . the switch 100 is coupled to the motor 60 to enable or disable the motor as a result of the presence or absence of a container beneath the discharge assembly for receiving ground coffee therein . the switch disables the motor when the container retaining assembly is in the release position ( see , fig4 ) thereby preventing grinding of coffee and dispensing of ground coffee through the discharge assembly when a container is not present . as shown in fig5 the switch 100 enables operation of the motor 60 when the container retaining assembly is in the retaining position . as such , the switch enables operation of the motor when a container is positioned relative to the discharge assembly . a switch arm 106 extends from the roller switch 100 towards the extending portion 104 of the control rod 88 . the terminal end of the extending portion 104 includes an arcuate portion 108 and a generally planar portion 110 . as shown in fig4 the switch arm 106 advances forwardly against the planar portion 110 when the cam body 84 is raised into the release position . as the cam body 84 is rotated towards the discharge assembly 30 to engage a container therebetween , the switch arm 106 is displaced by the arcuate portion 108 thereby enabling the operation of the motor 60 . the structure of the extending portion 104 is more clearly shown in fig6 and 7 and in which the cam body 84 is generally shown in the &# 34 ; retaining &# 34 ; position . in the preceding description , reference has been made to the discharge assembly 30 . as shown in fig1 and 7 - 9 , the discharge assembly 30 includes a number of components . as shown in fig1 the discharge assembly 30 includes a hood 112 extending from the cabinet 22 . underneath the hood 112 is a channel chute 114 which is positioned over a passage 116 extending from the grinder mechanism 62 to the discharge assembly 30 . the channel chute 114 is positioned with a discharge hole 118 coincident with the passage 116 to allow coffee dispensed from the grinder mechanism 62 to flow into the channel chute 114 and into a container positioned below the discharge assembly 30 . as shown in fig2 and 7 , a deflector 120 is attached to the channel chute 114 to deflect ground coffee dispensed through the passage 116 downwardly into the channel chute 114 . a pivoting cover 122 is attached to the channel chute proximate to the deflector 120 . the pivoting cover 122 allows for some degree of movement to accommodate fluctuation in the flow through the discharge assembly 30 . the chaff retaining plate or chaff retainer 46 is positioned over the discharge hole 118 to provide a degree of back pressure on the flow of ground coffee through the passage in order to retain chaff in the ground coffee . the retention of chaff in the ground coffee is generally known by the use of a chaff retaining plate . the chaff retaining plate 46 retained on the upper portion of the channel chute 114 by a pivot pin 124 . a torsion spring 126 is retained on the pivot pin 124 and biases the chaff retaining plate 46 over the discharge hole 118 against the dispensing flow of ground coffee through the passage 116 . a lever arm 127 extends from the pivot pin 124 and abuts a side of the chaff retaining plate 46 facing the discharge hole 118 . in use , as whole bean coffee flows under the influence of gravity from the hopper 78 to the grinder mechanism 62 , it is dispensed from the grinder mechanism 62 through the passage 116 and discharge hole 118 . ground coffee is initially deflected downwardly by the deflector 120 into and through the channel chute 114 . during the grinding process , as ground coffee is dispensed through the discharge hole 118 , the chaff retaining plate 46 acts against the flow of ground coffee to promote retention of the chaff within the ground coffee . the pivoting cover 122 freely pivots in response to fluctuations in the flow of ground coffee through the discharge assembly 30 . at the end of the grinding cycle , the pivot pin 124 is manually rotated in order to release chaff which may have accumulated on the surface thereof . rotation of the pivot pin upwardly ( see arrow 129 in fig8 ) engages the lever arm 127 against the plate 46 to overcome the biasing force of the spring 126 and move the plate 46 away from the hole 118 . chaff may also accumulate on the inside surfaces of the deflector 120 , the channel chute 114 and the pivoting cover 122 . as such , it would be desirable to quickly and easily remove the accumulated chaff from these surfaces . the present invention includes the clean - out rod or member 48 which is operated to remove the chaff from these surfaces . the clean - out member 48 includes a protruding portion 128 which extends to engage an arm 130 of the pivot pin 124 to move or tap the chaff retaining plate 46 ( see fig8 ). the clean - out member 48 can be rotated upwardly so that the protruding portion 128 taps against a shoulder 132 of the pivoting cover 122 . as such , the clean - out member 48 can be moved upwardly and downwardly to quickly and efficiently knock off the chaff from the chaff retaining plate 46 and the pivoting cover 122 , respectively . additionally , action of the pivoting cover 122 against the channel chute may vibrate chaff from the internal surfaces of the channel chute 114 as well as the deflector 120 . as briefly discussed hereinabove , the magnetic assembly 40 ( as shown in fig2 ) is positioned in the hopper 78 to prevent magnetic pieces , usually metallic pieces , from falling into the grinder mechanism 62 . the magnetic assembly 40 is important to prevent magnetic pieces from entering the ground coffee and to prevent such pieces from becoming mixed in a beverage brewed therefrom . additionally , it is important to keep magnetic pieces out of the grinder mechanism 62 to prevent damage to the grinding burrs . a top burr 134 is positioned over a bottom burr 136 . the top and bottom burrs 134 , 136 have faces with a plurality of grinding teeth or structures thereon . as at least one of the burrs is rotated , whole bean coffee is forced through the grinding burrs 134 , 136 and dispensed through the passage 116 . the magnetic assembly 40 includes a support 138 and a magnetic body 140 attached thereto . the support 138 is designed to position the magnetic body 140 in a throat area 142 of the hopper 78 communicating with the grinder mechanism 62 . the supports 138 and magnetic body 140 are sized and dimensioned to allow beans to flow from the hopper 78 through the throat 142 and into the grinder mechanism 62 . additionally , the supports 138 abut an internal surface of the hopper 78 and allow the magnetic assembly 40 to be fastened in place . this allows the magnetic assembly 40 may be periodically removed to clean magnetic pieces therefrom . as shown in fig2 the hopper 78 is positioned above the grinder mechanism 62 in a gravity feed relationship such that upon activation of the grinder mechanism 62 , beans will flow through the throat 142 for grinding . as the beans pass in close proximity or in contact with the magnetic body 140 , any magnetic pieces which may have been accidentally introduced into the coffee supply will be captured for later removal . a generally small clearance is provided between the hopper and / or throat and the magnetic body in order to facilitate a thorough removal of any metallic particle from the bean as a result of close or intimate contact with the magnetic body 140 . a problem which commonly limits the grinding activity of prior art grinders is that operation of the grinder motor 60 and grinder mechanism 62 creates a considerable amount of waste heat . in prior art devices , the accumulation of heat , or more appropriately heated air , in the cabinet may produce a temporary or permanent failure of the grinder . in order to prevent accumulation of heated air , the present invention incorporates an active ventilation system 42 . the active ventilation system 42 primarily include a thermostatic element or thermostat 144 , a fan 146 and vents 148 formed in the cabinet 22 . the active ventilation system 42 is operated when the thermostat 44 senses the temperature of the air within the cabinet 22 as being within a predetermined range . air is moved through the cabinet by the fan 146 for removal therefrom . as shown in the illustrated embodiment in fig2 the vents 148 are positioned in the upper area 24 of the grinder 20 . the fan 146 is positioned in the lower portion 26 of the grinder 20 . preferably , the thermostatic element 144 is positioned near the grinder mechanism 62 in order to accurately sense the temperature range of the grinder mechanism 62 . also shown in fig2 the fan 146 is positioned to draw air into the cabinet 22 and force air upwardly through the vents 148 . this configuration facilitates and exploits the natural convection phenomenon of heated air rising . even before the fan 146 is activated , the position of the vents 148 in the upper portion 24 of the body 30 facilitate natural removal of heated air from the cabinet . turning now to fig1 , a circuit diagram is provided . the electrical control of the present invention consists of a master on / off switch 150 which enables or disables power to the motor 60 . when the master switch 150 is in the on position and the switch assembly 44 is activated by positioning the cam body 84 in the retaining position , the motor 60 will start . if the cam body 84 is in the release position , the switch 100 will be open and thus prevent operation of the motor 60 . once the motor is started and it has achieved a running condition , an electric start switch in the motor 60 will open thus removing a start capacitor 152 from the circuit . a run capacitor 154 will be maintained in the circuit even after the start capacitor 152 has been removed from the circuit . the thermostatic element or motor temperature sensor 144 and fan 146 are also included in the circuit to remove heated air from the cabinet when the thermostat 144 senses excessive heat . while a preferred embodiment of the present invention is shown and described , it is envisioned that those skilled in the art may devise various modifications and equivalents without departing from the spirit and scope of the invention as defined by the appended claims . the invention is not intended to be limited by the foregoing disclosure .

a grinder for grinding materials to produce a ground substance . the grinder includes a cabinet , a grinder motor retained in the cabinet , and a grinder mechanism coupled to the motor to grind the materials . a hopper is positioned in communication with the grinder mechanism to deliver materials for grinding . the container retainer is attached to the grinder for retaining a container in close proximity for capturing ground material dispensed thereby . an activation switch assembly is included with the grinder to selectively control the grinder and activate the grinder when a container is placed in a desired location . a substance settling assembly is included with the grinder for removing a container retained by the grinder to settle the substance as it is dispensed from the grinder to the container . a chaff retainer is provided for maintaining chaff included with the ground substance in mixture with the ground substance . a clean - out member is operatively attached to the grinder and selectively engageable with the chaff retainer for removing chaff from the grinder . a magnetic collection device is positioned in the hopper for capturing magnetic pieces which may be deposited in the hopper . an active ventilation system is also included with the grinder for actively and controllably removing heat from the grinder cabinet .

preferred embodiments of the presently disclosed anastomosis apparatus will now be described in detail with reference to the drawing figures wherein like reference numerals identify similar or identical elements . in the drawings and in the description which follows , the term “ proximal ”, as is traditional , will refer to the end of the surgical device or instrument of the present disclosure which is closest to the operator , while the term “ distal ” will refer to the end of the device or instrument which is furthest from the operator . an anastomosis apparatus 100 , in accordance with an embodiment of the present disclosure , is shown in fig1 - 12 . although anastomosis apparatus 100 offers significant advantages to a radical prostatectomy procedure , it will be understood that the device is applicable for use in any anastomotic procedure where two body vessels are to be brought together and joined . as seen in fig1 - 6 , anastomosis apparatus 100 includes at least one fastener 102 and preferably a plurality of fasteners 102 radially disposed about a lumen 184 of an insertion sleeve 180 ( see fig7 ). each fastener 102 includes a first fastener portion 104 and a second fastener portion 106 . first fastener portion 104 of fastener 102 includes a locking leg portion 108 and an anchoring leg portion 110 integrally formed with locking leg portion 108 . in particular , locking leg portion 108 includes a proximal end 112 and a distal end 114 from which anchoring leg portion 110 extends . anchoring leg portion 110 includes a distal end 116 integrally coupled to distal end 114 of locking leg portion 108 and a sharpened proximal tip 118 . desirably , sharpened proximal tip 118 of anchoring leg portion 110 is oriented towards proximal end 112 of locking leg portion 108 . anchoring leg portion 110 has a first position “ a ” in which sharpened proximal tip 118 is spaced a distance from locking leg portion 108 and can be biased to a second position “ c ” ( as seen in phantom in fig2 and 3 ) in which sharpened proximal tip 118 is in close proximity to locking leg portion 108 . preferably , locking leg portion 108 of first fastener portion 104 includes fixing elements for engaging second fastener portion 106 . the fixing elements in certain embodiments comprise a series of projections 120 formed along a side thereof and extending from proximal end 112 toward distal end 114 . first fastener portion 104 of fastener 102 further preferably includes a lip 122 projecting distally from distal end 110 of locking leg portion 108 . second fastener portion 106 of fasteners 102 includes a locking leg portion 124 and an anchoring leg portion 126 integrally formed with locking leg portion 124 . in particular , locking leg portion 124 includes a distal end 128 and a proximal end 130 from which anchoring leg portion 126 extends . anchoring leg portion 126 includes a proximal end 132 integrally coupled to proximal end 130 of locking leg portion 124 and a sharpened distal tip 134 . desirably , sharpened distal tip 134 of anchoring leg portion 126 is oriented towards distal end 128 of locking leg portion 124 . anchoring leg portion 126 has a first position “ a ” in which sharpened distal tip 134 is spaced a distance from distal end 128 of locking leg portion 124 and can be biased to a second position “ c ” ( as seen in phantom in fig2 and 4 ) in which sharpened distal tip 134 is in close proximity to locking leg portion 124 . preferably , locking leg portion 124 of second fastener portion 106 includes a locking passage 136 formed along a side surface thereof . as seen in fig6 , locking passage 136 is defined by an upper wall 138 extending from an upper surface of locking leg portion 124 , a lower wall 140 extending from a lower surface of locking leg portion 124 and an interconnecting side wall 142 extending between the terminal ends of upper wall 138 and lower wall 140 . locking passage 136 includes at least one , and desirably a plurality of fixing elements for engaging the fixing elements of the first fastener portion 104 . the locking passage 136 shown has fixing elements in the form of a plurality of projections 144 formed along an inner surface of interconnecting side wall 142 and oriented toward locking leg portion 124 . locking passage 136 is sized and dimensioned to slidably receive an end of first fastener portion 104 therethrough . in particular , when locking leg portion 108 of first fastener portion 104 is inserted into locking passage 136 of second fastener portion 106 , projections 120 of locking leg portion 108 engage projections 144 of locking passage 136 to thereby effectively lock first fastener portion 104 of fastener 102 in position with respect to second fastener portion 106 of fastener 102 . similar to first fastener portion 104 of fastener 102 , second fastener portion 106 of fastener 102 includes a lip 148 projecting proximally from proximal end 130 of locking leg portion 124 . as seen in fig5 , it is contemplated that projections 120 of locking leg portion 108 and projections 144 of side wall 142 of locking passage 136 are teeth - like ( e . g ., saw toothed ) projections 146 a , 146 b , respectively , configured and adapted to permit locking leg portion 108 to be inserted into locking passage 136 and hindering withdrawal of locking leg portion 108 therefrom . in particular , projections 146 a , 146 b are configured and adapted to permit locking leg portion 108 to slide in direction “ d ” while locking passage 136 is permitted to slide in direction “ e ”. however , once projections 146 a and projections 146 b engage one another , projections 146 a , 146 b prevent locking leg portion 108 from sliding in a direction opposite to direction “ d ” and prevent locking passage 136 from sliding in the direction opposite from “ e ”. in other words , projections 146 a , 146 b are configured and adapted to allow uni - directional movement of locking leg portion 108 relative to locking passage 136 and in turn uni - directional movement of first fastener portion 104 relative to second fastener portion 106 . while projections 120 of locking leg portion 108 and locking passage 136 are shown and described as being formed along a side surface of first fastener portion 104 and second fastener portion 106 , respectively , it is envisioned and within the scope of the present disclosure that projections 120 can be provided along any surface of locking leg portion 108 of first fastener portion 104 and locking passage 136 can be provided along any surface of locking leg portion 124 of second fastener portion 106 . first fastener portion 104 and second fastener portion 106 of fastener 102 can be made from any surgical grade material , such as stainless steel or titanium . it is envisioned that first and second fastener portions 104 , 106 are preferably made from a medical grade bio - absorbable material , such as , for example , polyglycolic acid ( pga ) and / or polylactic acid ( pla ). preferably , the material and dimensions of fasteners 102 are selected such that fasteners 102 will dissolve after a predetermined period of time while retaining their structural integrity for a period of time sufficient to assure proper healing of the anastomosis site . as seen in phantom in fig3 and 4 , anastomosis apparatus 100 includes an anvil 150 , a pusher 170 , and a shaft 190 for mounting the fasteners 102 in an insertion sleeve 180 ( see fig7 ). anvil 150 includes an elongate body portion 152 and a hook 154 formed at a distal end 156 thereof . hook 154 of anvil 150 is configured and adapted to engage lip 120 of first fastener portion 104 of fastener 102 . pusher 170 includes an elongate body portion 172 and a recess 174 formed at a distal end 176 thereof . recess 174 of pusher 170 is configured and adapted to engage lip 146 of second fastener portion 106 of fastener 102 . as seen in fig7 - 11 , insertion sleeve 180 includes a distal end 182 , a proximal end ( not shown ) and defines a lumen 184 extending therethrough which defines a central axis . shaft 190 is configured and adapted to be slidably received in lumen 184 of insertion sleeve 180 . it is envisioned that shaft 190 include a plurality of radially oriented longitudinally extending grooves ( not shown ) formed therein . accordingly , each groove of shaft 190 can be configured and adapted to receive a respective anvil 150 , pusher 170 and fastener 102 . preferably , shaft 190 is sized such that when shaft 190 is inserted into sleeve 180 , anchoring leg portion 108 of first fastener portion 104 and anchoring leg portion 124 of second fastener portion 106 are in the second position “ c ” ( see fig7 ). anvil 150 and pusher 170 are arranged with respect to one another so as to form a recess for receiving fastener 102 between hook 154 and lip 120 . fastener 102 is disposed in the recess so that first fastener portion 104 and second fastener portion 106 are engaged with one another , leaving room for advancing the anchoring leg portions toward one another . anvil 150 , pusher 170 and fastener 102 are disposed in insertion sleeve 180 , with shaft 190 disposed therebetween . ( see fig7 ). a preferred method of use and operation of anastomosis apparatus 100 in performing a radical prostatectomy anastomosis will now be described in greater detail with reference to fig1 - 12 and in particular with reference to fig7 - 12 . anastomosis apparatus 100 can be used in either the retropubic or the perineal prostatectomy approaches . with the prostate removed , the bladder neck “ n ” of the bladder “ b ” is first reconstructed by everting the inner mucosal lining of bladder “ b ” and suturing it down to the outer wall of bladder “ b ”, using known surgical techniques . likewise , urethral stump “ s ” of urethra “ u ” is reconstructed by everting the inner mucosal lining of urethral stump “ s ” and suturing it down to the outer wall of urethra “ u ”, using known surgical techniques . preferably , with bladder neck “ n ” reconstructed , bladder neck “ n ” is sized to properly accommodate and retain distal end 180 of sleeve 180 within bladder “ b ” using a standard tennis racket type closure ( i . e ., the opening of the bladder neck constituting the head of the tennis racket and a radial incision extending from the bladder neck constituting the handle portion of the tennis racket ). the size of the bladder neck will vary depending on the patient . typically , the bladder neck “ n ” is sized to be approximately 7 - 8 mm in diameter . with bladder neck “ n ” reconstructed , apparatus 100 is passed trans - urethrally through urethra “ u ” until distal end 182 of insertion sleeve 180 extends out of urethral stump “ s ” and into bladder “ b ” through bladder neck “ n ”, as seen in fig7 . with apparatus 100 so positioned , insertion sleeve 180 is withdrawn in a proximal direction to expose sharpened proximal tips 118 of first fastener portions 104 . with sharpened proximal tips 118 exposed from within insertion sleeve 180 , anchoring leg portions 110 of first fastener portions 104 are deployed to the first position “ a ”. ( see fig8 ). with anchoring leg portions 110 deployed , hooks 154 of anvils 150 are withdrawn in a proximal direction to engage lips 122 of first fastener portions 104 and to drive sharpened proximal tips 118 through the wall of bladder “ b ”, see fig9 . as seen in fig9 , insertion sleeve 180 is further withdrawn in a proximal direction until sharpened distal tips 134 and anchoring leg portion 126 of second fastener portion 106 are exposed . with anchoring leg portions 126 completely exposed from within insertion sleeve 180 , anchoring leg portions 126 of second fastener portions 106 are deployed to first position “ a ”. ( see fig9 ). with anchoring leg portions 126 deployed , pushers 170 are advanced in a distal direction to engage lips 148 and to drive sharpened distal tips 134 through the wall of urethral stump “ s ”. with sharpened proximal tips 118 of first fastener portions 104 penetrating the wall of bladder “ b ” and with sharpened distal tips 134 penetrating the wall of urethral stump “ s ”, hooks 154 of anvils 150 are approximated toward recesses 174 of pushers 170 to thereby approximate anchoring leg portions 110 of first fastener portion 104 and anchoring leg portions 126 of second fastener portion 106 towards one another . concomitantly , as anchor leg portions 110 and 126 are approximated towards one another bladder neck “ n ” is approximated towards urethral stump “ s ”. ( see fig1 ). in accordance with the present disclosure , approximation of anchor legs 110 and 126 towards one another results in projections 120 and 144 incrementally engaging one another and maintaining the position of anchor leg 110 relative to anchor leg 126 . accordingly , projections . 120 and 144 prevent bladder “ b ” from separating from urethra “ u ”. after bladder neck “ n ” has been approximated toward urethral stump “ s ”, pushers 170 and shaft 190 are withdrawn from insertion sleeve 180 and anvils 150 unhooked from lips 122 . ( see fig1 ). thereafter , anvils 150 and insertion sleeve 180 are withdrawn from urethra “ u ”. an alternate embodiment of a fastener 200 , in accordance with the present disclosure , is shown in fig1 a and 13b . unlike fastener 102 from above , fastener 200 includes a first fastener portion 202 and a second fastener portion 204 . first fastener portion 202 includes a locking leg portion 206 and an anchoring leg portion 208 pivotally coupled to a proximal end of locking leg portion 206 . in the embodiment shown , anchoring leg portion 208 is pivotally coupled to locking leg portion 206 by a pivot pin 210 , but other means known in the art may also be used . alternatively , locking leg portion 206 or anchoring leg portion 208 can be provided with an integrally formed pin that extends outwardly for receipt in an aperture formed in the other of locking leg portion 206 or anchoring leg portion 208 . first fastener portion 202 includes a suture 212 connected to anchoring leg portion 208 for pulling on anchoring leg portion 208 and lifting a distal end of anchoring leg portion 208 away from locking leg portion 206 ( e . g ., from first position “ a ” to second position “ c ”). it is contemplated that the proximal end of locking leg portion 206 includes a stop ( not shown ) for stopping the lifting of anchoring leg portion 208 beyond a predetermined amount . as seen in fig1 b , second fastener portion 204 includes a locking leg portion 214 and an anchoring leg portion 216 pivotally coupled to a distal end of locking leg portion 214 by a pivot pin 218 . alternatively , locking leg portion 214 or anchoring leg portion 216 can be provided with an integrally formed pin and extending outwardly for receipt in an aperture formed in the other of locking leg portion 214 or anchoring leg portion 216 . second fastener portion 204 further includes a suture 220 connected to anchoring leg portion 216 , extending around the distal end of locking leg portion 214 , for pulling on anchoring leg portion 216 and lifting a proximal end of anchoring leg portion 216 away from locking leg portion 214 ( e . g ., from first position “ a ” to second position “ c ”). it is contemplated that the distal end of locking leg portion 214 includes a stop ( not shown ) for stopping the lifting of anchoring leg portion 216 beyond a predetermined amount . while apparatus in accordance with the present disclosure have been described as being used in connection with a radical prostatectomy procedure , it is envisioned that apparatus having similar structures and modes of operation can be used in various other surgical procedures . it will be understood that various modifications may be made to the embodiments of the presently disclosed anastomosis device and method disclosed herein . for example , one or more fasteners may be arranged in the insertion sleeve . in further embodiments , the insertion sleeve is sized to accommodate the fastener without requiring the anchoring leg portions to collapse to position “ c ”. the fastener may comprise a single part with a corrugated , hinged or collapsible portion . the fasteners , in certain embodiments , comprise a fixing element comprising a separated part . therefore , the above description should not be construed as limiting , but merely as an exemplification of a preferred embodiment . those skilled in the art will envision other modifications within the scope of the present disclosure .

apparatus and methods for performing a surgical anastomotic procedure are disclosed herein . apparatus according to the present disclosure include at least one fastener including a first fastener portion having an anchoring leg portion , a second fastener portion including an anchoring leg portion , wherein the first and second fastener portions are operatively associated with one another to selectively fix the position of the first fastener portion relative to the second fastener portion .

referring now to the drawings , there is seen in fig1 a first embodiment of the electro - surgical dissecting and cauterizing instrument 10 including a distal , working end 12 and a proximal end 14 which includes an electric plug such that instrument 10 may be releasably and operably connected to a conventional , electro - surgical control unit 16 . control unit 16 is supplied high frequency , electrical energy via power supply 18 and further includes a switch means 20 which is used to control the flow of electrical energy from unit 16 to instrument 10 . as such , a surgeon manually grasps unit 16 to work instrument 10 as described below . although unit 16 is shown and described herein for the purpose of illustrating a typical electrical unit with which instrument 10 would be used , it is understood that plug 14 may be easily adapted to connect to a variety of electro - surgical units available today . dissecting and cauterizing instrument 10 is used primarily in surgical procedures which may or may not include the use of an endoscope to view the operation site . for purposes of description , the surgical procedure using an endoscope will be discussed . also , surgical procedures of the type discussed herein are termed laparoscopic because they target the abdominal area . the type of endoscope used in the abdomen is therefore termed a laparoscope . in particular , the surgeon inserts distal end 12 into the abdomen of the anesthetized patient through a trochar ( not shown ) positioned within an incision made in the abdominal wall . the operation site is viewed at the eyepiece of the laparoscope and / or on a crt screen by passing the laparoscope ( also not shown ) through an adjacent incision in the abdomen which has been previously inflated with co 2 as is customary surgical procedure in laparoscopic surgery of this type . the raising of the abdominal wall above the innards of the patient with the co 2 creates a space therebetween which increases maneuverability of instrument 10 within the abdomen besides increasing the viewing area of the surgical site with the laparoscope . examples of typical laparoscopic procedures in which dissecting and cauterizing instrument 10 would be used are lysis of adhesions , cholecystectomy and appendectomy . dissecting and cauterizing instrument 10 includes a rigid insulating sleeve 22 which surrounds conducting rod 24 extending from plug 14 to distal end 12 . distal end 12 is seen to include a rigid arm 26 extending from substantially the center of the distal end 21 of sleeve 22 . a working tip 28 electrode in the shape of a hook in the embodiment of tool 10 seen in fig1 - 4 integrally extends from arm 26 . arm 26 and working tip electrode 28 are formed of electrically conductive material such as stainless steel and are supplied electrical energy via a conductive rod 24 extending through sleeve 22 . a thin layer or jacket of insulating material 30 in the form of a teflon heat - shrink tubing is disposed upon arm 26 from sleeve 22 to the base of working tip electrode 28 . prior art electro - surgical instruments of which the present inventors are aware do not include an arm such as 26 extending between the working tip electrode 28 and end of sleeve 22 but instead have their working tip electrodes extend directly from the sleeve . as such , the view of the operation site is obstructed because of the close proximity of the sleeve to the working tip electrode since the diameter of the sleeve is substantially larger than the size of the working tip electrodes . to overcome this problem , the present dissecting and cauterizing instrument 10 includes arm 26 to effectively space working tip electrode 28 from sleeve 22 . furthermore , arm 26 is seen to include portions laterally offset from the linear axis x -- x extending through the center of sleeve 22 and arm 26 . this feature also increases the visualization of the surgical work site by having the working tip electrode 28 extend from a portion of the arm 26 which lies along an axis y -- y which is parallel to and spaced from linear axis x -- x of sleeve 22 . referring to fig3 arm 26 is seen to extend linearly from sleeve 22 for a first length having a distance d 1 and bend downwardly at an approximately 150 degree angle a 1 , with respect thereto for a second length having a distance d 2 . arm 26 then bends upwardly at an approximately 150 degree angle a 2 to extend for a third length having a distance d 3 . as such , it may be seen that the first length of arm 26 labeled d 1 extends along linear axis x -- x of sleeve 22 which is spaced from and extends parallel to third length d 3 . working tip electrode 28 is seen to integrally extend from the distal end of third length d 3 and bend toward axis x -- x to form a hook which is used primarily for pulling at tissue . the electricity which flows through arm 26 and electrode hook 28 at the control of the surgeon augments the cutting capability of hook 28 and cauterizes bleeding blood vessels . to prevent unintentional cauterization with portions of instrument 10 other than hook 28 , an insulating jacket 30 is disposed upon the entire length of arm 26 . referring to fig5 and 6 , a second embodiment of instrument 10 is seen . in this second embodiment , arm 26 &# 39 ; linearly extends from sleeve 22 &# 39 ; for a first length having a distance d 1 as with the embodiment of fig1 - 4 , bending downwardly and then upwardly at approximately 135 degree angles a 1 and a 2 for second and third lengths having distances of d 2 and d 3 , respectively . as such , the third length of arm 26 &# 39 ; spanning distance d 3 lies along an axis y -- y which is parallel to and spaced downwardly from the linear axis x -- x of sleeve 22 &# 39 ; where the first length of arm 26 &# 39 ; spanning distance d 1 lies . arm 26 &# 39 ; includes a third bend in an upwardly direction at an approximately 159 degree angle a 3 and extends linearly therefrom for a fourth length having a distance d 4 , crossing linear axis x -- x such that the working tip electrode 32 lies on the side of axis x -- x opposite to which axis y -- y lies . it will be noticed in fig5 - 7 that working tip electrode 32 is in the shape of a flattened spatula which has a radial axis r -- r which intersects linear axis y -- y . spatula 32 proves especially useful for cauterizing bleeding blood vessels rather than removing tissue from the patient &# 39 ; s body . an insulating jacket 30 &# 39 ; is disposed upon arm 26 &# 39 ; from the distal end of sleeve 22 &# 39 ; to the base of working tip electrode 32 to prevent any portion of arm 26 &# 39 ; from unintentionally contacting and cauterizing healthy tissue surrounding the operation site . referring now to fig8 and 10 which show yet a third embodiment of the invention , arm 26 &# 34 ; is entirely linear and extends from sleeve 22 &# 34 ; along an axis z -- z which makes an approximately 6 degree acute angle a 4 with linear axis z -- z of sleeve 22 &# 34 ;. working tip electrode 32 &# 39 ;, which is also in the shape of a substantially circular , planar spatula , extends upwardly from arm 26 &# 34 ; toward axis z -- z . working tip electrode 32 &# 39 ; has a radial axis r -- r which intersects linear axis z -- z at an obtuse angle a 5 . an insulating jacket 30 &# 34 ; is disposed upon arm 26 &# 34 ; from sleeve 22 &# 34 ; to working tip electrode 32 &# 39 ;. based on the foregoing description of three embodiments of the invention , it may be realized that the length and configuration of the arms 26 , 26 &# 39 ; and 26 &# 34 ; permit each of the respective working tip electrodes 30 , 32 and 32 &# 39 ; to be significantly spaced from and laterally offset from the longitudinal axis of the sleeve . this permits an enhanced viewing area of the surgical work site and working tip electrode for the surgeon . while the invention has been shown and described with particular reference to preferred embodiments thereof , it will be appreciated to those skilled in the art that variations in working tip electrode configuration and specific lengths and angles of the arm portion of the tool may be made to fit a particular surgical need without departing from the full scope of the invention as is set forth in the claims which follow .

an electro - surgical dissecting and cauterization tool comprises a linear , rigid insulating sleeve surrounding means providing an electric conducting path between a proximal , electric plug end and working tip electrode distal end . the plug attaches the tool to a conventional electro - surgical unit which supplies electrical energy to the working tip electrode end of the tool . a rigid arm extends between the sleeve and the working tip electrode and includes portions laterally offset from the main axis of the sleeve to increase visualization of the working tip electrode during surgery .

the apparatus in fig1 has a support plate 1 that is arranged in longitudinally placeable fashion inside an examination volume of a magnet . within the scope of invention , the magnet can for example a cylindrical magnet 18 as shown in fig3 ( solenoid ) or a horseshoe magnet ( c - arm ) 19 as shown in fig2 . given cylindrically shaped magnets , the patient receptacle is fashioned as a patient tube as own in fig3 . the longitudinal displaceability of the support plate 1 is indicated with a double arrow 2 . due to the longitudinal displaceability of the support plate 1 , larger body sections of a patient 3 lying on the support plate 1 can be examined . the nuclear spin resonance apparatus shown in the drawing additionally has a predetermined number of transmit coils 4 and a predetermined number of receive coils 5 . the transmit coils 4 can be connected , in a desired configuration , to a generator 7 by means of a transmit coil changeover switch 6 . the generator 7 supplies the transmit coils 4 with current via a - transmit amplifier 8 and via a matching element 9 . the receive coils 5 can be connected , in a desired configuration , to a receiver 11 by means of a receive coil changeover switch 10 . the signals of the connected receive coils 5 are given to the receiver 11 via . a matching element 12 and via a receive amplifier 13 . the configurations of the transmit coils 4 and the receive coils 5 , defined by the transmit coils changeover switch 6 and by the receive coils changeover switch 10 , are supplied to an adjustment unit 14 as inputs . as a further input , the position of the support plate 1 , which is determined by a position sensor 15 , is supplied to the adjustment unit 14 . the adjustment unit 14 processes the inputs that it has received from the transmit coils changeover switch 6 , from the receive coils changeover switch 10 , and from the position sensor 15 , and at its output supplies corresponding control signals to the generator 7 , to the transmit amplifier 8 , to the matching elements 9 and 12 , as well as to the receive amplifier 13 and to the receiver 11 . in addition , the adjustment unit 14 supplies a control signal to a shim coil system 16 . the inputs and the control signals ( outputs ) are stored , as adjustment parameters , in a memory 17 until the conclusion of the examination . with the embodiment shown in the drawing of the inventive apparatus , larger bodily segments of the patient 3 can be examined . such examinations are , for example , the tracking of doses of contrast agent over a larger body region , as carried out for example in subtraction angiography or in physiologically controlled imaging . in the context of the preparation for measurement , which in the case of a peripheral angiography at the leg , includes slice positioning along the vascular tree , several measurements are already made without contrast agent . due to the homogeneity volume of the magnet being too small , in these measurements the support plate 1 must be displaced , and so must be newly adjusted . the associated adjustment parameters for each position of the support plate 1 are stored in the memory 17 . as additional adjustment parameters , the connected configuration of the transmit coils 4 , as well as the connected configuration of the receive coils 5 , are stored in the memory 17 . in addition , the adjustment parameters include the corresponding control signals for the generator 7 , for the transmit amplifier 8 , for the matching elements 9 and 12 , as well as for the receive amplifier 13 , for the receiver 11 and for the shim coil system 16 . after the conclusion of the measurement preparation , which includes the determination of the adjustment parameters , the support plate 1 is guided back into the initial position , and the contrast agent is administered . in the imaging measurement that now takes place , each of the positions of the support plate 1 used in the measurement preparation is newly set in succession , and the transmit coils 4 and the receive coils 5 are connected as in the measurement preparation . subsequently , an imaging measurement ( exposure ). is immediately carried out with the known adjustment parameters stored in the memory 17 , i . e . without a new adjustment . in the inventive apparatus , the required adjustment parameters are thus not determined immediately before each individual imaging measurement ; rather , the required adjustment parameters are completely determined in a preceding adjustment process , in the context of the measurement preparation . according to the invention , the adjustment process thus precedes the exposure process . only after the determination of the required adjustment parameters are the exposures ( imaging measurement ) carried out , in a separate exposure process . in examinations with the inventive apparatus , high - contrast exposures . are thereby obtained , since it is not necessary to omit an adjustment . in addition , due to the fact that the adjustment parameters are stored in a memory 17 until the conclusion of the examination , reduced examination times result . due to the short examination times , in subtraction angiography the course of the contrast agent can thus be tracked without chronological gaps . although modifications and changes may be suggested by those skilled in the art , it is the intention of the inventors to embody within the patent warranted hereon all changes and modifications as reasonably and properly come within the scope of their contribution to the art .

a magnetic resonance imaging apparatus has a magnet with at least one patient receptacle and at least one support plate , as well as a predetermined number of transmit and / or receive coils . in at least two predetermined exposure positions , at least one exposure respectively takes place using predetermined adjustment parameters . high - contrast exposures can be obtained in a short time , by the required adjustment parameters being determined in a preceding adjustment process , and the exposures are carried out in a subsequent exposure process .

turning now to the drawings , instrument 10 of the present invention is composed of a forcep body 11 having a pair of resilient legs 12 , 13 secured to and extending from body 11 ; an open ended tubular sleeve member 14 integrally secured to a leg extension 13a ; a linkage spring 15 having a pair of legs 16 , 17 ; linkage mount 18 ; and ejection collar 19 . sleeve member 14 is integrally secured to leg extension 13a which is set at a predetermined angle &# 34 ; x &# 34 ; ( fig5 ) appropriate to use of the instrument and is shown as approximately 120 °. leg 13 is slightly longer in length than leg 12 so that sleeve 14 resides outwardly from the free end of leg 12 . a mount 18 is integrally secured to the outer free end of leg 12 and comprises a small sleeve having a bore 20 extending throughout its length . linkage spring 15 is formed so that it passes through mount 18 by way of bore 20 and its legs 16 , 17 extend outwardly and at their outer ends are bent inwardly to resiliently engage ejection collar 19 and provide a pivotal connection . ejection collar 19 is designed to be slidably received by sleeve member 14 . collar 19 moves freely on sleeve member 14 between extension 13a which acts as a stop and the outer end of travel on sleeve member 14 . a pair of holes 21 , 22 are formed in the walls of collar 19 and receive the ends of legs 16 , 17 so that collar 19 is retained on sleeve member 14 . in a relaxed position , collar 19 rests against leg extension 13a and prevents any movement past this position . when leg 12 is forced toward leg 13 by the fingers of the operator , mount 18 abuts against leg 13 and spring legs 16 , 17 force collar 19 forward on sleeve member 14 to the hood or band ejection position seen in fig6 . turning now to a description of the operation of instrument 10 , instrument 10 as shown in fig1 - 6 receives a vacuum line 23 which is slidably mounted on the rear end of sleeve member 14 . with ejection collar 19 in a retracted position , see fig1 - 3 , a fimbrial hood 25 is placed on the forward , free end of sleeve member 14 , see fig4 . in order to do this , shoulder 26 must be stretched over the free end of sleeve member 14 as best seen in fig4 . once in position , shoulder 26 abuts against collar 19 . next , through application of vacuum through vacuum line 23 , hood 25 is inverted to the position of fig5 . sometimes , in addition to vacuum , hood 25 must be urged inward by the operator nudging hood 25 with some instrument at hand . once hood 25 is in position adjacent fimbria 28 as in fig5 fimbria 28 of fallopian tube 29 is guided into hood 25 , see fig5 . once fimbria 28 is positioned within hood 25 , leg 12 is depressed causing spring legs 16 , 17 and correspondingly collar 19 to move forward until shoulder 26 of hood 25 is forced from sleeve member 14 and engages fallopian tube 29 . at this point , instrument 10 is withdrawn allowing hood 25 to regain its form as illustrated in fig7 . hood 25 is now anchored in place on tube 29 by placing a sufficient number of sutures 35 through shoulder 26 and into tube 29 . another application of instrument 10 , although not illustrated , would be for situations where permanent occlusion is desired . such permanent occlusion may be desired for permanent sterilization , permanent occlusion of blood vessels or permanent occlusion of polyps . in this application , an elastomeric , silastic band 30 as illustrated in fig8 is employed and mounted on sleeve 14 and is ejected in the same manner as previously described with respect to hood 25 . the fact that the central axis of the longer leg member 13 resides at an obtuse angle with respect to the central axis of the sleeve member provides a convenient working arrangement . also , the natural resiliency of the leg members 12 , 13 is used to always bring the collar 19 to its retracted position . thus , the invention instrument may be used rapidly and efficiently in an occlusion procedure .

a forcep - like instrument is provided for mounting and ejecting either an elastic band or a hood for an occlusion procedure .

the fig1 , as mentioned above , shows a schematic diagram of the respiratory cycle with re - inhalation of a respiratory device provided with the ventilation system of the present invention . as illustrated in fig1 , the fresh gas coming from the anesthesia equipment ( 1 ), that adequately adjusts the composition of gases and the concentration of anesthetic agents , is introduced in the respiratory circuit through the fresh gas inlet ( 2 ). the gas is collected in a bag ( 3 ) or bellows ( 4 ), depending on the application requirements and according to the position of the selecting key ( 5 ), which determines the mode of operation of the device : manual or automatic through a lung ventilator ( 6 ). in case the selecting key ( 5 ) is in the manual position , the bag ( 3 ) is filled in with gas , so that the anesthesia physician or any other specialist may manually pump the gas to patient . when the bag is pressed , the gas passes through a carbon dioxide absorber ( 7 ), through the inhaling unidirectional valve ( 8 ), through the inhaling tube ( 9 ), and insufflates the lung of the patient . when the anesthesia physician releases the bag ( 3 ), the gas exhaled by the patient passes through the exhaling tube ( 10 ), through the unidirectional exhaling valve ( 11 ), and returns to the bag ( 3 ). the purpose of the unidirectional valves ( 8 ) ( 11 ) is to force the passage of the gas flow through the carbon dioxide absorber ( 7 ) before the re - inhalation by the patient . for this case , an adjustable pressure limit valve ( 12 ) releases to the environment the excess of gas within the respiratory circuit by means of an appropriate exhaustion system ( 13 ), since the fresh gas is continuously fed within the circuit . in case the selecting key ( 5 ) is in the ventilator / auto mode , the respiratory circuit works analogously to the manual mode . however , pumping is made by the bellows ( 4 ), which is filled in through the exhaling valve ( 21 ) by the route ( 14 ). pumping is made through the lung ventilator ( 6 ) that pressurizes the internal side of the rigid reservoir ( 15 ), where said bellows ( 4 ) is assembled , through the inhaling route ( 16 ). in this case , the control of gas excess is made by a set of release valves , which comprises a release valve ( 17 ) activated by said bellows ( 4 ) and a release valve ( 18 ) activated by the lung ventilator ( 6 ) through the route ( 26 ). said release valves ( 17 ), ( 18 ) are activated during the exhaling stage . this allows the excess of gas located inside the circuit to escape and to avoid circuit pressurization with values above the set up exhaling pressure value . the inhaling stage of the respiratory circuit starts with the ventilator ( 6 ) sending inhaling flow through the routes ( 16 ), ( 19 ), and ( 20 ) into the rigid reservoir ( 15 ). at the same time , the exhaling valve ( 21 ) and the release valve ( 18 ) are closed in order to pressurize the internal side of the rigid reservoir ( 15 ) and to compress the bellows ( 4 ). through the ventilation system according to the present invention , all parameters controlled by the lung ventilator ( 6 ), such as flow , pressure and volume , are fully transmitted to the gas located inside the bellows ( 4 ) and consequently transmitted to the gas flow inhaled by the patient . for these reasons , the ventilation system of this invention can be used in various modes of ventilation , including but not limited to volume control ventilation — vcv , pressure control ventilation — pcv , pressure support — psv , vaps , aprv , pav , etc . after the end of the inhaling stage , the exhaling stage starts . in this stage , the route ( 16 ) flow is closed , and the exhaling valve ( 21 ) and the release valve ( 18 ) are opened . the gas located inside the reservoir ( 15 ) is exhaled through the routes ( 20 ), ( 22 ), thus permitting the bellows ( 4 ) to expand up to the end of the exhaling stage of the patient . said bellows ( 4 ) fully expands and activates the release valve ( 17 ), causing the exhaustion of the excess gas from the respiratory circuit through the routes ( 23 ), ( 24 ), ( 25 ) and through the release valve ( 18 ) activated by the ventilator ( 6 ). fig2 illustrates the set constituted by the bellows ( 4 ) located upwardly within the reservoir ( 15 ) and by a manifold ( 27 ). said bellows ( 4 ) is manufactured with flexible and sterilizable material , preferably silicone , which shape presents an accordion - like shape ( 28 ) to allow the expansion and contraction of the bellows ( 4 ) and thus offering low resistance and inertia . the base of said bellows ( 4 ) is provided with a ring - shaped opening ( 29 ) with circular cross section that is fitted in the base ( 30 ) of said rigid reservoir ( 15 ). the top of said bellows ( 4 ) is formed by a hard disk ( 31 ), preferably manufactured with aluminum with relatively small thickness , which is fitted under pressure through an external ring ( 32 ) in order to hermetically fix the accordion - like profile ( 28 ) to the hard disk ( 31 ), thus forming a flat and stable surface at the top of the bellows ( 4 ), as better observed in the detail of fig2 . furthermore , said external ring ( 32 ) has the purpose to avoid eventual mixing between the control gas and the gas inhaled by the patient . therefore , the configuration of said bellows ( 4 ) permits the full transmission of all the pressure exerted over the external surface of the bellows to the gas of the respiratory circuit by the control gas inside the reservoir ( 15 ). furthermore , it permits the inhaling effort exerted by the patient to be transmitted by the gas of the respiratory circuit to the control gas located inside the reservoir ( 15 ), thus not generating any resistance to the spontaneous breathing of the patient . said reservoir ( 15 ) comprises a main body ( 33 ), a base ( 30 ) and a manifold ( 27 ). said main body ( 33 ) is manufactured with a transparent material , preferably polycarbonate or acrylics . said base ( 30 ) is provided with a first connection ( 35 ) to couple the re - inhalation tube ( not shown ) and a second connection ( 36 ) which is connected to the manifold ( 27 ) in the release valve ( 17 ) for the exit of excess gases . said base ( 30 ) is fitted in the lower portion of the main body ( 33 ) by means of a pressure screw ( 37 ). the edge of the circular opening ( 29 ) of said bellows ( 4 ) is hermetically pressed between said base ( 30 ) and the main body ( 33 ) to avoid the mixing between the respiratory circuit gas and the control gas . the manifold ( 27 ) is assembled over the main body ( 33 ) by means of pins ( 38 ) located alongside the main body . the pins are fitted in indentations ( 39 ) located at the edge of said manifold ( 27 ), also provided with a sealing ring ( 40 ) to seal the main body ( 33 ) against the manifold ( 27 ). the volume capacity of the bellows ( 4 ) may vary according to the application . bellows with varying capacity , for example from 250 to 1400 ml , are commonly used . for applications to newly born patients , the volume capacity should be small in order to minimize the total compressible volume of the respiratory circuit . fig3 shows an alternative embodiment of the bellows ( 4 ) and reservoir ( 15 ) set , which presents a lower volume capacity than that shown in fig2 , but keeping the same principle of operation . however , said set uses the same manifold ( 27 ) used for reservoirs with a higher volume capacity , since the diameter of the upper end of the reservoir ( x ) is equal to the diameter of the reservoir used in the embodiment shown in fig2 . the ventilation system of the invention may be used in various applications . no matter which is the volumetric capacity of the gases in the respiratory circuit , it is just required the substitution of the bellows / reservoir set . fig4 shows in detail said manifold ( 27 ), preferably of aluminum , comprising the exhaling valve ( 21 ) and the release valves ( 17 ), ( 18 ) responsible for the control of gas excess in the respiratory circuit . the exhaling valve of the control gas ( 21 ) comprises an air nozzle ( 41 ), which is opened and closed by means of the action of a flexible diaphragm ( 42 ), which in turn is activated by the pilot pressure through the gas inlet ( 43 ), with said pilot pressure being controlled by the lung ventilator ( 6 ) through a proportional solenoid valve and by an electronic control circuit provided with a pressure transducer , a microprocessor , and a pid control algorithm , such as those known by the man skilled in the art . in the inhaling stage , the lung ventilator ( 6 ) pressurizes the internal side of the reservoir ( 15 ) through the channel ( 44 ) in order to control the pilot pressure in the gas inlet ( 43 ), thus closing the air nozzle ( 41 ) and consequently closing the exhaustion channel ( 45 ). in the exhaling stage , the pilot pressure at the gas inlet ( 43 ) will be reduced , thus permitting said flexible diaphragm ( 42 ) to open the air nozzle ( 41 ) and permitting the control gas to be exhausted through the channel ( 44 ), through the air nozzle ( 41 ), and through the channel ( 45 ). in this stage , it is possible to control the pilot pressure with the purpose to keep a positive pressure over the bellows ( 4 ), which is called peep ( positive end expiratory pressure ). the control of gas excess in the respiratory circuit is made by means of the release valves ( 17 ), ( 18 ). each one of them is responsible for a control stage . more specifically , the first stage is performed by the valve ( 17 ), which is activated by the bellows ( 4 ) and comprises a cursor ( 46 ) which higher end is supported , under the action of a spring ( 47 ), over an air nozzle located within said manifold ( 27 ), and which lower end is supported over a flexible diaphragm ( 49 ). a second cursor ( 50 ) is assembled at the opposite side of the flexible diaphragm ( 49 ), which projects to the internal side of the reservoir ( 15 ) and has a disk ( 51 ) in its free end , which contacts the bellows ( 4 ). therefore , when the bellows ( 4 ) is fully filled in , the hard disk ( 31 ), located at the top of the bellows ( 4 ), touches the disk ( 51 ) of the cursor ( 50 ) and consequently activates the cursor ( 46 ) that opens the air nozzle ( 48 ), thus permitting the passage of the flow of gas excess from the inlet channel ( 52 ) to the outlet channel ( 53 ) and conducing the gas to the release valve ( 18 ) responsible for the second control stage . said inlet channel ( 52 ) is connected to the outlet connection for gas excess ( 36 ) located at the base ( 30 ) of the reservoir ( 15 ). furthermore , said diaphragm ( 49 ) safely separates the control gas located inside the reservoir ( 15 ) from the gas coming from the inlet channel ( 52 ), which is the excess of gas exhaled by the patient coming from the respiratory circuit . therefore , the mixing between gases is inhibited and consequently a safe and healthy respiratory circuit is obtained . the second stage is made by the release valve ( 18 ), similar to the exhaust valve of the control gas ( 21 ). the lung ventilator ( 6 ) also controls the release valve by the pilot pressure in the channel ( 54 ), which is equal to the pilot pressure of the channel ( 43 ). the release valve ( 18 ) is also provided with a flexible diaphragm ( 55 ) that closes and opens an air nozzle ( 56 ) according to the pilot pressure in the channel ( 54 ). during the inhaling stage , the lung ventilator ( 6 ), through the channel ( 44 ), sends control gas flow into the reservoir ( 15 ) simultaneously closing air nozzles ( 41 ) and ( 56 ) through the flexible diaphragms ( 42 ), ( 55 ) and consequently pressurizing the reservoir ( 15 ), compressing said bellows ( 4 ) and the gas contained inside it . the gas is pumped to the patient , passing through the carbon dioxide absorbing system , through the inhaling unidirectional valve and insufflating patient &# 39 ; s lung . as previously explained , during the exhaling stage , the pilot pressure in the channel ( 43 ) is reduced , and consequently the pilot pressure of the channel ( 54 ) is also reduced . the pressure within diaphragms ( 42 , 55 ) remain reduced , thus allowing the opening of the air nozzles ( 41 , 56 ) and allowing the control gas exhalation through the channels ( 44 , 55 ) and the interconnection of the channels ( 53 , 57 ). however , the first stage to control the excess of gas remains closed due the force of the spring ( 47 ) that acts over the cursor ( 46 ) of the release valve ( 17 ). the air nozzle ( 48 ) remains closed and inhibits the exhaustion of the excess of gases through the channels ( 53 ), ( 57 ). therefore , only when the bellows ( 4 ) is fully filled in , the hard disk ( 31 ) located on its top will activate the cursor ( 50 ), which will move the cursor ( 46 ) to open the air nozzle ( 48 ) to allow the passage of the excess of gas between the first stage and the second stage through the channels ( 53 , 57 ). the valve ( 18 ) of the second stage is controlled by the same pilot pressure of the exhaustion valve for the control gas ( 21 ). for this reason , the exhaustion pressure of the control gases and consequently the pressure inside the bellows is the same pressure kept by the ventilator inside the reservoir . this system allows the set up exhaling pressure value to be kept no matter which is the supplied fresh gas flow value , thus keeping the ventilation base line and allowing the spontaneous breathing of the patient with no additional effort to balance an eventual intrinsic peep . in an alternative embodiment of the manifold ( 27 ), as shown in fig5 , the control of gas excess is made by one stage . the control is formed by the release valve ( 58 ), which comprises an air nozzle ( 59 ) supporting a flexible diaphragm ( 60 ) activated by the pilot pressure through the channel ( 61 ), no matter which is the pilot pressure supplied through the channel ( 43 ) of the control gas exhaustion valve ( 21 ). in this case , the pilot pressure in the channel ( 61 ) is controlled by means of a second proportional solenoid that keeps the channel ( 62 ) closed during the inhaling stage . during the exhaling stage and only after the patient fully exhales , the air nozzle ( 59 ) is opened to allow the flow of gas excess to pass through the exhaustion channel ( 63 ). the release valve ( 58 ) opens in a proportionally manner depending on the monitoring of the internal pressure increase of the respiratory circuit . the monitoring in turn is made by means of a pressure transducer , since it is required to keep the pressure in the circuit at the same value of the peep set up exhaling pressure value , in order to balance the pressure exerted by the weight of said bellows ( 4 ) itself . the full exhalation by the patient can be monitored , for example , by means of a specific device , such as a pneumotacograph located at the “ y ” connection of the patient or even in the exhaling route . therefore , the release system for the excess of gases in the respiratory circuit of the invention solves the problems described in the state of the art , thus eliminating the risk of gas escape during the start of exhalation , besides keeping minimum residual pressure , of about 1 hpa , even by using high flow of fresh gas . additionally , the ventilation system of the present invention comprises a valve for the free flow of oxygen ( 64 ) provide with a solenoid valve ( 69 ) which is activated by the lung ventilator ( 6 ) synchronously with the inhaling stage of the respiratory cycle of the patient . the purpose of this valve ( 64 ) is quickly renewing the gases inside the respiratory circuit . the valve for the free flow of oxygen ( 64 ) is constituted by two stages , a pilot ( 65 ) and a main one ( 66 ). oxygen is fed through the channel ( 67 ) to the main stage and through the channel ( 68 ) by the “ usually open ” route of the solenoid valve ( 69 ), which is itself connected to the pilot stage through the channel ( 90 ) which in turn is interconnected to the manual activating valve ( 71 ). the oxygen flow to the respiratory circuit is released through the channel ( 72 ) and occurs simultaneously when the solenoid ( 69 ) is turned off and the cursor ( 73 ) is manually activated by the key ( 74 ), therefore overcoming the spring ( 75 ) pressure and consequently allowing the oxygen flow between the channel ( 70 ) and the chamber ( 76 ). hence , the activation of the pressure of the pilot stage over the diaphragm ( 77 ) causes the movement of the cursor ( 78 ), overcoming the force of the spring ( 79 ) and interconnecting the inlet ( 67 ) and outlet ( 72 ) channels of the main stage . the manual valve ( 71 ) is closed by the action of the spring ( 75 ) over the cursor ( 73 ) and by the depressurization of the chamber ( 76 ), which occurs through the restrictor ( 80 ) located in the channel ( 81 ), thus closing the main stage due to the action of the spring ( 79 ) under the cursor ( 78 ). the solenoid ( 69 ) is activated by the lung ventilator ( 6 ) synchronously with the inhaling stage of the respiratory cycle of the patient , i . e . during the inhaling stage . the feeding of oxygen through the channel ( 70 ) is interrupted and consequently the pilot pressure over the diaphragm ( 77 ) and the flow of oxygen through the outlet channel ( 72 ) is interrupted , even if the pilot stage had been manually activated . the valve for the free flow of oxygen of the present invention remains in operation even in the lack of power supply , thus allowing its operation for example by means of manual ventilation . this promotes a better safety during the administration of anesthesia , since it is possible to work even in case of lack of power supply or failure in the electronic system of the equipment . the synchronization of the free flow of oxygen during the exhaling stage avoids the risks of the equipments of the state of the art , allowing the operator to activate the flow at any moment of the ventilation , without the need to change the controlled standards , such as the respiratory frequency , and without need to interrupt the ventilation .

the present invention refers to a ventilation system used in hospital respiratory devices for the administration of anesthesia to newly born , pediatric and adult patients . more specifically , the present invention refers to a ventilation system that promotes a respiratory circuit with re - inhalation for the administration of anesthesia and that overcomes all inconveniences and deficiencies existing in respiratory devices of the state of the art . the ventilation system in respiratory devices comprises a bellows assembled within a reservoir , which is provided with a manifold with various gas exhaling valves , more specifically release valves to take out the excess of gases , and an exhaling valve for control gases . it is additionally constituted of a valve for the free flow of oxygen to quickly renew or replace the gases inside the respiratory circuit .

the present invention is directed to a massaging device that is particularly effective in stimulating body parts such as female genitalia . with reference to fig1 - 3 of the drawings , a massaging device 10 includes a motorized vibrator 12 mounted in an elongate housing 13 , a screw - on cap 14 detachably connected to the housing and having a control button 15 projecting therefrom , a battery pack 16 inserted within the housing , a control module 18 and a sensor module 20 mounted in the housing and including a sensor circuit board 21 supporting a longitudinally distributed plurality of sensor elements 22 according to the present invention , the elements being individually designated 22 a , 22 b , and 22 c , the element 22 c being closest to the control button 15 , the element 22 a being closest to the opposite end of the device 10 . the housing 13 is also covered with a sleeve 24 , and the assembly is sealed with an elastic o - ring 25 interposed between the sleeve and the cap 14 . in the exemplary configuration shown in the drawings , the device 10 has a cylindrical shape with spherically rounded ends , the control button 15 projecting from one end of the device . the control button 15 operates a “ push - on / push - off ” power switch 26 that is mounted on a switch structure 19 within the cap 15 for activating the device 10 . also included is appropriate wiring or other conductors ( not shown ) between the vibrator 12 , the battery pack 16 , the control module 18 , the sensor module 20 , and the control switch 26 . when activated , the device assumes an idle state unless and until a user &# 39 ; s body part comes into close proximity with one of the sensor elements 22 . as more particularly described in connection with fig2 and 3 below , proximity with the sensor element 22 a only produces a first or low level of activation of the vibrator 12 ; proximity with the sensor element 22 b ( but not 22 c ) produces a second or medium level of activation ; and proximity with the sensor element 22 c produces a third or high level of activation of the vibrator 12 . with further reference to fig4 and 5 , an alternative configuration of the massaging device , designated dildo 30 , includes counterparts of the motorized vibrator 12 , the housing , designated 13 ′, control button , designated power button 15 ′, the battery pack , designated 16 ′, the control module , designated 18 ′ and the control circuit board , designated 19 ′, the sensor module , designated 20 ′ and the sensor circuit board , designated 21 ′ with counterparts of the sensor elements , designated 22 ′ ( individually 22 ′ a , 22 ′ b , and 22 ′ c ), and a momentary counterpart of the power switch , designated 26 ′. the battery pack 16 ′ is supported within a handle 32 and retained in place by a screw - in cap 34 . the power button 15 ′ projects through the handle 32 , the control module 18 ′ being located within the handle . an elastic counterpart of the sleeve , designated 36 has a main portion 37 covering the housing 13 ′ and having the form of an erect penis with a head portion 38 , and an arm portion 39 projecting to one side in a shape and dimension preferably facilitating contact with the clitoris of a user of the dildo , the arm portion enclosing a motorized secondary vibrator 40 that is locatingly supported within an arm cavity 42 of the arm portion 39 . each of the sensor elements 22 ′ is biasingly pressed against the sleeve by a sensor spring 42 , the element 22 ′ a being closest to the head portion 38 of the sleeve 36 , the element 22 c being farthest therefrom . as described above in connection with the massager 10 , appropriate wiring or other conductors ( not shown ) connect the battery pack 16 ′, the control module 18 ′, the sensor module 20 , and the vibrators 12 and 40 . the exemplary configuration of the dildo 30 of fig2 and 3 further includes a mode switch actuator 44 protruding the handle 32 for operation by a user and having a mode switch 46 that is mounted directly on the control circuit board 19 ′. a plurality of intensity indicators 48 also project through the handle , being supported by the control circuit board . the mode switch 46 sequentially selects a plurality of vibration modes , selectively modifying operation of the vibrators 12 and 40 in combination with response to the sensors 22 ′ as described above for the massaging device 10 . suitable materials for the housings 13 and 13 ′, and the handle 32 include abs . suitable materials for the battery packs 16 and 16 ′ include polypropylene ; and suitable materials for the sleeve 36 ( and the control button 15 of fig1 ) include elastic plastic materials such as tpe . a suitable battery complement is four type aaa alkaline batteries . with particular reference to fig6 and 7 , a control circuit 50 of the dildo 30 is formed by a combination of the control module 18 ′ and the sensor module 20 ′. as shown in fig6 , the control circuit 50 includes a body touch detector 52 that operates in combination with a signal detector 54 that signals a microprocessor 56 , the microprocessor controlling a main driver 58 for powering the main vibrator 12 , and a secondary driver 59 for powering the secondary vibrator 40 . the touch detector 52 includes the sensor elements 22 ′ a , 22 ′ b , and 22 ′ c , the elements 22 ′ each having a coupling capacitor 60 connected to a common pulse output 62 of the signal detector 54 , and a grounded blocking diode 63 connected for maintaining a positive potential at the sensor element 22 ′. that potential is fed through a signal filter that includes a charging resistor 64 , a filter capacitor 65 , and a discharge resistor 66 , the resulting filtered touch signal 67 being fed to a corresponding input of the detector 54 . the touch signals are individually designated 67 a , 67 b , and 67 c in fig7 , corresponding respectively to the sensor elements 22 ′ a , 22 ′ b , and 22 ′ c . the signal detector 54 monitors each of the touch signals 67 , periodically communicating status signals to the microprocessor 56 . when any of the sensor elements comes into close proximity to a user &# 39 ; s body part , capacitive coupling alters ( increases ) loading of the associated coupling capacitor , correspondingly changing ( decreasing ) the resulting touch signal sufficiently to change the relevant status signal . in addition to the above - described communication with the signal detector 54 , the microprocessor is responsive to the power switch 26 ′ and the mode switch 46 for signaling the main and secondary drivers 58 and 59 as further described below , the microprocessor having separate outputs for driving each of the indicators 48 . in an exemplary configuration of the dildo 30 , the control circuit 50 , upon activation by the power switch 26 ′, is responsive to the mode switch 46 for controlling the secondary vibrator 40 as described herein , the main vibrator 12 being responsive to proximity of the sensor elements 22 ′ as described above regarding the sensor elements 22 of the massaging device 10 . in this configuration , successive activations of the mode switch 46 produces eight intensity modes of operation of the secondary vibrator 40 as set forth below in table 1 . it will be understood that other modes of operation of the secondary vibrator 40 are within the scope of the present invention . corresponding variations in operation intensity levels of the main vibrator 12 are possible also , an exemplary schedule being indicated below in table 2 . in table 2 , “ sensor a ” excludes activation of the sensor elements 22 ′ b and 22 ′ c ; “ sensor b ” excludes activation of the sensor element 22 ′ c . in both tables the activation levels are relative and arbitrary as is consistent with effective levels known to those skilled in the art . the indicators 48 are driven by the control circuit 50 at low intensity in modes 1 and 2 , medium intensity in mode 3 , high intensity in mode 3 , variable intensity in mode 4 , and blinking in modes 5 - 8 synchronously with activation of the secondary vibrator 40 . it will be understood that other and various indications in the different modes are possible . with reference to fig8 , there are shown graphical illustrations of intensity represented by a waveform , wherein the shape of the waveform represents the level of intensity generated by the different modes of operation of the massaging device , such as those corresponding to the vibrator modes of tables 1 and 2 . a suitable device for the signal detector 54 is available as acm3890 from shizhenshi acme micro electronics of shenzhen , china . the device is operational with a crystal input at 16 mhz , generating the pulse output 62 at a rate of 500 hz . a suitable device for the microprocessor 56 is available as acm3831 - 3 , also from acme . a suitable 3 . 3 volt regulator 68 for providing vcc to the detector 54 is available as ht7133 from holtek semiconductor inc . of hsinshu , taiwan . the regulator 68 is fed by a power driver 69 in response to activation of the microprocessor 56 by the power switch 26 ′ as described above . the control circuit 50 includes additional conventional circuitry for powering the signal detector 54 as well as the microprocessor 56 in a suitable manner known to those skilled in the art . further regarding the massaging device 10 of fig1 , and with particular reference to fig2 and 3 , a simplified counterpart of control circuit , designated 50 ′ is formed by a combination of the control module 18 and the sensor module 20 . as shown in fig2 , the control circuit 50 ′ includes counterparts of the body touch detector 52 and the signal detector 54 for signaling a counterpart of the microprocessor , designated 56 ′, the microprocessor controlling a counterpart of the main driver 58 for powering the vibrator 12 . a suitable device for the microprocessor 56 ′ is available as acm3831 - 2 , also from acme . the power switch 26 directly powers the control circuit 50 ; accordingly , the power driver 69 is implemented as a constant conduit to the regulator 68 when the power switch 26 is activated . the touch detector 52 includes the sensor elements 22 a , 22 b , and 22 c , the elements 22 each having the coupling capacitor 60 connected to the common pulse output 62 of the signal detector 54 , with counterparts of the blocking diode 63 , the signal filter including the charging resistor 64 , the filter capacitor 65 , and the discharge resistor 66 , for generating the touch signal 67 for feeding the detector 54 as described above in connection with fig7 . the signal detector 54 monitors each of the touch signals 67 a , 67 b , and 67 c , periodically communicating status signals to the microprocessor 56 ′, also as described above . the control circuit 50 ′ also includes conventional circuitry for powering the signal detector 54 and the microprocessor 56 ′ in a suitable manner known to those skilled in the art . although the present invention has been described in considerable detail with reference to certain preferred versions thereof , other versions are possible . for example , the power switch and the mode switch can be combined , the control circuit cycling through a substantially unpowered state and the various modes in response to successive operations of the mode switch . therefore , the spirit and scope of the appended claims should not necessarily be limited to the description of the preferred versions contained herein .

a vibratory massaging device having a spaced plurality of proximity sensors distributed on a massaging surface of the device , and a control circuit operative for controlling vibratory intensities in response to activation of particular ones of the sensors being close to a user &# 39 ; s body parts being massaged . the device can be configured as a dildo , including both main and secondary vibrators , the secondary vibrator being within an arm portion that is configured for clitoral stimulation . at least one of the vibrators is automatically driven at increased intensity as penetration increases .

referring now to fig1 , the planar view of a probe array 11 is shown as a grid - like array with a plurality of chambers 13 arranged to have separators 15 within a frame 17 . the frame 17 may be a small injection - molded component made of a plastic , such as polystyrene , or a molded material , such as glass . the separators 15 may be molded integrally to the frame 17 or may be separate elements placed within it . the overall dimensions of the frame 17 may be small . typical dimensions are less than 1 mm by 1 mm . referring now to fig1 a , which is a cross - sectional view of the probe array 11 , the aforementioned separators 15 are effective to separate a fluorescent probe material 21 that may have different characteristics from an adjacent fluorescent probe material 23 . probe materials 21 and 23 are generally deposited in a thin layer on top of a substrate , in this case , the material of the frame 17 . alternatively , the frame 17 may be made of a foraminous material or a partly foraminous substance such as sol gel ( not shown ). the probe materials may be incorporated into the substrate , which may be a flat surface that allows ink printing processes to be used to deposit the probe array materials at high speeds and at low cost . probe materials generally are engineered molecular materials that are designed to have an affinity to one or more constituents that may be expected to be found in the tissue , fluid , or chemical mix to be analyzed . these probe materials may be made sensitive to specific genes or gene segments through complimentary genetic indicators that have been designed to fluoresce or change color , as observed by the naked eye or by spectrographic analysis methods , when they are linked to a molecule to which they have affinity . a large number of different types and combinations of optically readable probes are being manufactured today that have specific affinity to one or more genes , proteins , or other chemicals . in preferred embodiments , the present invention contemplates the use of two classes of probes : ( i ) protein sensitive probes , such as gfp ( green fluorescent probe ) from the jellyfish aequorea victoria ; and ( ii ) modified oligonucleotide probes that are fluorogenic , such as those manufactured by synthegen llc , houston , tex . 77042 . additional probes suited for use in the present invention are available from midland certified reagent company , midland , tex . 79701 , and transbio corp ., baltimore , md . 21220 . typically , these probes must be used in vitro due to either their lack of biocompatibility or because they must be used in conjunction with aggressive reagents that are toxic to cells . various methods and configurations may be used to deposit or arrange probe locations and positions in an array or singly . for instance , a sheet of plastic material 33 , as shown in fig1 b , may have lines 35 made of probe - filled ink printed in any arrangement that may be produced with printing methods . more than one type of probe - filled ink may be used to produce various patterns and arrangements , including overlapping patterns ( not shown ). the ink pattern lines 35 may be protected with a topcoat 37 that may be made of a dissolvable gel such as ordinary gelatin , or another material such as soluble or even a waterproof polymer that only dissolves and provides access to the probe material in the probe - filled ink in lines 35 after the application of a solvent . the arrangement of the sensitive areas by this process allows the probe materials to be applied to a variety of surfaces and substrates , including medical devices , such as needles , trocars , forceps , catheters , guidewires , implants , and prostheses , in an inexpensive and reliable manner . the following discussion and description of the present invention is directed to a readable polydeoxynucleotide array module ( rpam ). however , those skilled in the art will appreciate that the present invention and specific embodiments described below may be utilized with any number of probe arrays and the rpam described here is provided as only one non - limiting example . referring now to fig2 , which is a cross - sectional view of a readable polydeoxynucleotide array module ( rpam ) 41 , the probe array 11 may be positioned adjacent to a spectrometer module that is encapsulated in an at least partly transparent housing 45 . the probe array 11 may be cemented to the side , top , or other area within a spectrometer module 43 with an optical cement ( not shown ), or by a solvent bond line 47 that allows two plastics to be fused through partial melting . a spectrometer module suitable for use in this invention has been described in pending u . s . patent application ser . no . 08 / 898 , 604 , the entire disclosure of which is incorporated by reference herein . specifically , the spectrometer module used in the present invention includes a light source and a light detector for placement inside a body such that optical conduits are not necessary to deliver light signals to and from the rpam inside the body . the miniature spectrometer includes the light source and one or more light detectors . the light source illuminates a tissue region and the light detectors detect optical properties of the illuminated tissue by measuring modified light signals . the light detectors convert optical signals to electrical signals such that one or more electrical wires placed inside an interventional device can deliver the electrical signals from the rpam to a signal display or a microprocessor . the light source and the light detectors are energized by an external power supply through electrical wires . in another embodiment , an optically transparent tip encapsulates a spectrometer . the tip is shaped to optimize tissue contact and optical transmission . the tip encapsulating the spectrometer is disposed at a distal end of an interventional device . the tip may be coated with a material to improve light transmission . the tip may include at least one fluid channel , which is in communication with a lumen inside the interventional device , to deliver a fluid to a tissue region . the spectrometer may also include a light source and the light detectors formed on a single substrate . the light source may be a light - emitting diode and the light detectors may be a photodiode comprising multiple channels , where both devices are formed on a silicon substrate . the light detector can include multiple channels to detect light emission at multiple wavelengths . still referring to fig2 , probe array 11 may be integrally molded onto the surface of the spectrometer module 43 , creating a somewhat simplified one - piece unit that may provide processing advantages in high - speed production environments where parts counts are intentionally kept low to minimize stock and therefore reduce cost of fabrication and assembly . injection molding or casting of the components is effective to produce miniature components that correspond in size to conventional silicon - based integrated circuit scale . therefore , it should be appreciated that the rpam may be small , e . g ., about the size of a miniature electronic component such as a surface mount device . such devices include packaging , leads , and other components , and may be obtainable in size ranges of less than 1 mm in length . such devices may typically be configured in the range from about 0 . 5 mm to about 3 mm to produce small , useful devices for in vivo use . the rpam 41 may also have printable surfaces according to the construction of alternative probe array configurations as described in fig1 a and fig1 b , if desired . referring once again to fig2 , the internal components of the rpam consist of a substrate material 49 such as silicon upon which a light - emitting diode light source 51 is mounted with power lead 53 attached to one of terminals 55 . various colors and types of diode light sources may be used , including those now available that emit light in the infrared , the red , the yellow , the green , the blue , and the blue - violet regions . a working range of rpam excitation wavelengths is from about 1100 nanometers to about 250 nanometers and may comprise monochromatic , bichromatic , or broadband emissions . the exit aperture 57 is positioned to illuminate a movable mirror 59 that is bonded to piezoelectric stack actuator 61 . empowerment of the stack actuator 61 is effective to direct light emission from diode light source 51 to one or more chambers 13 . light emission from the probe materials 21 is picked up by one or more light detectors 63 through filters 65 . signals from the detectors 63 are brought out from the rpam through other terminals 55 . referring now to fig2 a , the operation of the rpam is depicted in block diagram form as follows : light is generated and directed from light source 51 and directed at one or more of chambers 13 by mirror 59 , which impinges upon at least one probe material 21 . fluorescence or other secondary light generated by the action of the light energy upon the probe material causes a second emission that may be detected by one or more light detectors 63 after passing through a bandpass filter 65 . the signal may be amplified and / or conditioned by one or more amplifier stages 64 . filters 65 allow the system to discriminate between various secondary light emission wavelengths , and signals from said light detectors 63 may be synchronized with the operation of light source 51 so that at any given time there is a known relationship between the particular probe that is illuminated and its response as detected by the light detectors . the timing and relationship of the light - generating , light - detecting event and the spatial position of the mirror 59 are controlled by cpu 71 and sent to the components via control lines 73 . the data obtained may be stored or presented in a display device or other therapeutic device that can be a graphical display , a television monitor , printout or drug delivery pump , interventional device , motor or actuator , etc . accordingly , this apparatus may effectively scan or read a plurality of probe materials in a repeatable , fast , and controllable manner ; and the information read may be stored , displayed , or used to initiate another action such as a therapeutic application of a drug , or control of a motor . the bandpass filter system of detecting one or more light wavelengths for this purpose is basic , and more complex schemes could be employed by those of ordinary skill in the art . such schemes may include , without limitation , light wavelength detection systems comprising gratings , graduated filters , heterodyne detection , acousto - optic tunable filtering , and other light detectors that effectively provide an amplitude and frequency responsive signal . a diffraction grating ( not shown ), for instance , may be attached to movable mirror 59 to provide spatial and chromatic control simultaneously . fig3 is the cross - sectional view of an interventional device incorporating the spectrometer and probe still referred to here as rpam 41 ; there is a body - insertable appliance 81 such as a catheter that may have a distal end and a proximal end and may consist of a plastic , rubber , or metal material that is generally elongated in shape , has a small cross section allowing it to pass easily through the body , and has one or more lumens or conduits that may extend through the length of the device . shown in fig3 is a device having three lumens , although a greater or lesser number of lumens may be used , depending upon the application for which the device is intended . the main lumen 83 is relatively large and is used to deliver a drug , a reagent , or a device to or beyond the distal tip 89 . suction lumen 85 is useful for drawing biological fluids , tissue , or other materials into proximity with the rpam 41 , where the material can be analyzed . signal wires 74 may extend to an external controller ( not shown ) or to a cpu , pump , motor , or other controller as shown in fig2 a , 75 . returning once again to fig3 , infusion lumen 87 may provide additional fluids , reagents , drugs , wires , or appliances that may be useful to the procedure . for example , the practitioner will appreciate that additional reagents can be introduced to facilitate analysis . such additional reagents can include : denaturants , such as guanidinium thiosulfate ; buffers , such as tris - cl ; detergents , such as sds ; chelators , such as edta ; enzymes , such as proteinases and / or dnaases ; and other reagents known to those of ordinary skill in the art that may be appropriate to the particular analysis to be carried out using the apparatus of the present invention . referring now to fig4 , a cross - sectional view of an interventional device , such as a body - insertable appliance 81 fitted with a lysing core 101 , is shown . the lysing core 101 utilizes mechanical motion to disrupt cells in order to make the cell contents available for analysis by the rpam ( not shown ). the use of a lysing device in conjunction with the rpam system eliminates the need for potentially toxic reagents that are commonly used to open cells in vitro . the lysing head 105 consists here of a more or less hemispherical component that may be comprised of a metal or plastic , which is mounted at the distal end of a driveshaft 103 . such driveshafts are well known for their ability to deliver torque and rotary motion from a proximal motor 107 or by hand control . as taught in this invention , motor 107 is one of a class of components shown in fig2 a as 75 which may be controlled by system cpu 71 , also shown in fig2 a . numerous other lysing devices are known that may abrade , disrupt , dissolve , pressurize , vacuum , cavitate , or otherwise apply mechanical forces to a cell or cells that are effective to disrupt the cell and make its contents available for analysis . it should be pointed out that such damage to cells is usually minimized to avoid permanent damage to the organ , vessel , duct , or tissue being tested . the lysing head 105 need not be relatively large and may be made small enough so that it may easily pass through the device from the proximal end so that another device or implant may be inserted , if needed , through the same large lumen 83 . such an implant may be a solid or porous , foraminous , or dissolvable seed , implant , stent , gel , or the like , which may carry therapeutic agents to a particular site in the body . this system provides the advantage that local conditions can be determined through use of the polydeoxynucleotide - readable array ( afforded by the construction of the rpam device as described herein ); and , therefore , better and more precise application of appropriate medicaments , drugs , therapeutic genetically based substances , etc ., is facilitated . further advantages are provided in that the information is obtained at or near real time , and that information is obtainable from the exact location of a proposed therapeutic intervention . such a device that may be used to place an implant is shown in fig5 , which is a side view of a secondary insertable device 111 comprising a rotary , multifilar , flexible driveshaft 112 having a therapeutic tip 113 terminating in an anchoring device 115 shown as a screw form capable of being screwed into tissue until separable joint 117 breaks , after which the remaining part of insertable device 111 may be withdrawn . driveshaft 112 may be hollow , to allow tether 119 to remain attached to therapeutic tip 113 . tether material may be constructed of a wire to allow the sending and receiving of an electrical signal , or may simply be used as a retrieval device to retrieve any portion of the therapeutic tip that may remain after the need for it is over . numerous carrying devices may be used to deliver the rpam . fig6 is a cross - sectional view of a hollow needle 121 carrying the rpam insertable appliance 81 . the advantage of a needle is that it allows the introduction of the rpam into portions of the body where there is no natural passageway . this method allows the user to position the distal tip of the lysing head 105 in various positions with respect to the sharp needle tip 106 . the needle may be of stainless steel and may be inserted into body tissue such as muscle , breast , prostate , or cardiac tissue . the needle may be left in place , and the rpam withdrawn temporarily to allow another appliance ( not shown ) to be introduced . other carrying devices may include guidewires , balloon catheters , ultrasound catheters with both imaging or non - imaging , and rotatable or array configurations , introducer sheaths , balloon angioplasty catheters for use in the blood vessels of the heart , the extremities , and the vascular system , atherectomy catheters , and many other types of interventional devices , as well as intraoperative devices . the device of the invention may be used anywhere there is the need for fast , precise localized detection and analysis of nucleotides , proteins , or the like , either for diagnostic purposes , or to guide therapy which itself may be made more localized , and therefore site - specific . such uses are economical and have less impact on surrounding tissue that is free of disease . the invention allows use of any agent that may change color as a result of the application of a local chemical to be read and includes , without limitation , such agents as litmus , photodynamic therapeutic agents , such as photofrin , fluorescent agents or dyes , staining dyes , luciferin , etc . the present invention permits analysis in a real time fashion without the need to remove and transport tissue specimens for later analysis . while illustrative embodiments have been illustrated and described , it will be appreciated that various changes can be made therein without departing from the spirit and scope of the invention .

a disposable high - density , optically readable polydeoxynucleotide array with integral fluorescence excitation and fluorescence emission channels is described . the compact array size allows integration into several types of interventional devices such as catheters , guidewires , needles , and trocars and may be used intraoperatively . highly sensitive monitoring of the metabolic and disease pathways of cells in vivo under varying chemical , genetic , and environmental conditions is afforded .

table 1 shows three different motor models and example cases a , b and c of how the achievable rotational speed n of the feed roll varies according to the rotational capacity vg of the two half - motors of the motor ( vg 1 and vg 2 ) and when the feed volume flow remains the same . furthermore , the feed force and speed of the feed roll depend on the pressure used and on the dimensions of the feed roll . the cou - pling 1 is a parallel coupling according to fig1 , and the coupling 2 is a series coupling of two half - motors as shown in fig2 . in the motor a , the ratio between the rotational capacities vgl and vg 2 is 1 : 2 , wherein the coupling of fig3 yields 67 % and 83 % of the rotational capacity vg of the coupling of fig1 and fig2 , respectively , and the coupling of fig4 yields the highest speed , wherein the rotational capacity vg is 50 % smaller than in the coupling 1 of fig1 . to achieve four different speeds , it is required that the rotational capacities vgl and vg 2 in the same motor differ from each other , wherein their ratio differs from the value 1 : 1 . with the ratio 1 : 2 , equal changes are achieved in the rota - tional capacity vg . even if the ratio of the rotational capacities vgl , vg 2 were 1 : 2 or variable , half - motors refer to all the different alterna - tives in this description . fig1 shows the coupling of the motors 1 and 2 in parallel , wherein the volume flow from the valve 6 is divided separately to the motors 1 and 2 ( the connections a 2 , b 2 and r 1 are coupled together and to the channel 4 ) and wherein it also returns separately from the motors 1 and 2 ( the connections al , b 1 and r 2 are coupled together and to the channel 5 ). the half - motors 1 a , 1 b , 2 a , 2 b of the same motor 1 , 2 are indicated with motor symbols drawn next to each other . at the same time , the common shaft is illustrated , as well as the fact that the half - motors always have a common rotational speed . alternatively , the half - motors are indicated with a symbol which comprises two motor sym - bols within each other . each half - motor comprises two basic connections which are for the supply and for the return of the volume flow . in the connections of fig1 to 4 , either the first or the second basic connections of two half - motors are permanently joined to a con - nection r 1 or r 2 , wherein the connection is preferably within the motor . in practice , the motors 1 and 2 are completely equal models . preferably , the motors 1 , 2 comprise three connections which are always in use . each motor 1 , 2 comprises one return connection r 1 , r 2 and two working connections a 1 , a 2 and b 1 , b 2 . one should bear in mind that a pressurized volume flow can also be conducted to the return connection , and the volume flow of the half - motors can also be returned via the working connection . at the same time , the direction of rotation of the motors is reversed , which is the normal way of use when , for example during delimbing , the tree is reversed for some length , stopped , and the feeding is continued again . with the coupling alternatives of the two different motors 1 , 2 , it is possible to achieve the desired speed alternatives , even though the capacities vgl , vg 2 of each motor 1 , 2 were constant . the different coupling alternatives , which are illustrated in fig1 to 4 , are implemented with different valve means , which are shown in fig5 to 9 . in connection with fig2 to 4 , reference numerals are used , which correspond to fig1 . in fig1 , the common rotational speed n of the motors 1 , 2 can be rep - resented by the formula n 1 = q / 2 ·( vg 1 + vg 2 ), which is simultane - ously the rotational speed of the wheel guiding the feed pulley or feed roll , when no gears are used . valve means 3 , for example a spool valve with 3 positions , are used to select the direction of rotation of the motors 1 , 2 , wherein the volume flow is fed either to the channel 4 ( in which case the return flow comes from the channel 5 ) or to the channel 5 ( in which case the return flow comes from the channel 4 ). in the mid - dle position of the valve 3 , the channels 4 , 5 are closed and the motors are stopped . the valve 3 may also have a position , in which the motors 1 , 2 are let on free circulation . the control circuit feeding the valve 3 is known as such , and it comprises at least a pressure connection p and a return connection t for the valve 3 . furthermore , the valve 3 com - prises a pressure connection p and a return connection t . preferably , the valve 3 is a pressure - controlled proportional directional valve as shown in fig7 , comprising connections for the channels 4 , 5 , p and t . the tree trunk is placed between the feed pulleys , wherein the direction of rotation of each feed pulley and the motor must be such that they always transfer the tree trunk in the same direction . consequently , the motor 1 revolves , for example , counter - clockwise , wherein the motor 2 always revolves clockwise , and vice versa . in fig2 , the rotational speed n of the motors 1 , 2 can be represented by the formula n 2 = q /( vgl + 2 · vg 2 ), ( n 2 & gt ; n 1 ), wherein the connec - tions r 1 , b 2 are coupled together ( and to the channel 4 ), and the con - nections b 1 , r 2 are coupled together ( and to the channel 5 ), and the half - motors 1 a , 2 a ( low capacities vgl ) are coupled in series ( the con - nections a 1 , a 2 being coupled together ). the aim of the coupling is to tie the rotational speeds of the motors 1 and 2 to be equal . the feed pulleys ( not shown in the figures ) are coupled in a way known as such on the shaft of the motors 1 , 2 , which is shown in fig7 . in fig3 , the rotational speed n of the motors 1 , 2 can be represented by the formula n 3 = q /( 2 · vg 1 + vg 2 ), ( n 3 & gt ; n 2 , when vg 1 & lt ; vg 2 , and n 3 = n 2 , when vgl = vg 2 ), wherein the connections r 1 , a 2 are cou - pled together ( and to the channel 4 ), and the connections a 1 , r 2 are coupled together ( and to the channel 5 ), and the half - motors 1 b , 2 b ( high capacities vg 2 ) are coupled in series ( the connections b 1 , b 2 being coupled together ). the coupling corresponds to the coupling of fig2 , if vg 1 = vg 2 . the aim of the coupling is again to tie the rota - tional speeds of the motors 1 and 2 to be equal . in fig4 , the rotational speed n of the motors 1 , 2 can be represented by the formula n 4 = q /( vg 1 + vg 2 ), ( n 4 & gt ; n 3 ), wherein both the half - motors 1 a , 2 a ( low capacities vg 1 ) and the half - motors 1 b , 2 b ( high capacities vg 2 ) are coupled in series . only the connection r 1 is cou - pled to the channel 4 , and only the connection r 2 is coupled to the channel 5 . we shall now look at fig5 to 9 to discuss the different valve means by which the couplings of fig1 to 4 can be achieved . in the fig5 to 9 , the different valve means are shown in the way in which they are coupled to the connections r 1 , r 2 , a 1 , a 2 , b 1 , b 2 of fig1 to 4 or to the channels 4 , 5 . fig5 shows a control circuit with 2 speeds ( the connections of fig1 and 2 ), which is implemented by means of a 2 - position 4 - way spool valve 6 with pressure control and spring return , whose inlet side is coupled separately to the connections a 1 and b 2 ( the connection b 2 communicating with the connections r 1 , 4 ), and whose outlet side is coupled separately to the connections a 2 and b 1 ( the connection b 1 communicating with the connections r 2 , 5 ). the valve 6 is controlled via a pressure channel 7 which , in turn , is controlled by a 2 - position 3 - way spool valve 8 with electrical control and spring return . by the positions of the valves 6 , 8 shown in fig5 , it is possible to achieve the speed n 1 . in connection with the valves , the inlet and outlet sides refer to the direction of the volume flow when the volume flow is supplied into the channel 4 , but when the direction of rotation is changed , the direction of the volume flow is changed as well . fig6 shows a 2 - speed ( couplings according to fig1 and 2 ) con - trol circuit , which is implemented by means of cartridge valves with pressure control and spring return , namely 9 a ( connection a 1 being coupled to the inlet side , which is so - called cartridge b - connection , and connection a 2 being coupled to the outlet side , which is so - called car - tridge a connection ), 9 b ( connection a 1 on the inlet side and connec - tion b 1 , r 2 and 5 on the outlet side ) and 9 c ( connection r 1 , 4 being coupled to the inlet side , which is an a - connection , and connection a 2 to the outlet side ). a pilot valve is a 2 - position 4 - way spool valve 10 with electrical control and spring return , to whose outlet side valve 9 a is coupled separately and valves 9 b , 9 c are coupled together . by the positions of the valves 9 a , 9 b , 9 c and 10 shown in fig6 , it is possible to achieve the speed n 1 . the valves of fig5 and 6 are placed in a separate frame which is connected for example to the motor , or they are integrated in a valve block which is placed in the harvester head and in which also the other valves controlling the harvester head are . fig7 shows a 2 - speed ( connections of fig1 and 2 ) control circuit which is implemented by means of two 2 - position 4 - way spool valves with pressure control and spring return , namely 11 a ( inlet side coupled to separate connections a 1 , b 1 and outlet side coupled independently to connection r 2 and simultaneously to channel 5 ) and 11 b ( outlet side coupled to separate connections a 2 , b 2 and inlet side coupled inde - pendently to connection r 1 and simultaneously to channel 4 ). the valves 11 a , 11 b are controlled via a pressure channel 12 which , in turn , is controlled by a 2 - position 3 - way spool valve 13 with electrical control and spring return . the outlet side of the valve 11 a and the inlet side of the valve 11 b are connected by an independent channel 11 c . the valves 11 a , 11 b are integrated in the motor , wherein the valves are implemented as stems or selectors which are placed in a drilling which , in turn , is provided in the motor . typically , the drilling comprises sepa - rate annular channels which are connected by channels provided in the stem in a desired way , when the stem is fitted in the drilling and it is moved into two different positions which correspond to the couplings of fig7 . the annular channels , in turn , communicate , for example in the motor 1 , with the channels a 1 , b 1 and r 1 as well as with the dis - placement volumes of the pistons . the drilling of the motor is known as such , and it can be fitted with a stem which , in turn , is designed in such a way that the couplings according to fig7 and the invention are possible . the final design and manufacture of the stem as such is easy for a man skilled in the art on the basis of this description , wherein a more detailed description of the stem will not be necessary . fig8 shows a 4 - speed ( couplings of fig1 to 4 ) control circuit which is implemented by means of two 2 - position 4 - way spool valves with pressure control and spring return , namely 14 a ( the inlet side cou - pled separately to the connections a 1 , r 1 and the outlet side sepa - rately to the connections a 2 , r 2 ) and 14 b ( the inlet side coupled sepa - rately to the connections b 1 , r 1 and the outlet side separately to the connections b 2 , r 2 ). each valve 14 a , 14 b is controlled via a pressure channel 16 a or 16 b , each closed by a 2 - position 3 - way spool valve 15 a or 15 b with electrical control and spring return . fig9 shows a 4 - speed ( couplings of fig1 to 4 ) control circuit , which is implemented by means of cartridge valves with pressure con - trol and spring return , namely 17 a ( connection a 1 on the inlet side and connection a 2 on the outlet side ), 17 b ( connection a 1 on the inlet side and connections r 2 , 5 on the outlet side ) and 17 c ( connection a 2 on the outlet side , connections r 1 , 4 on the inlet side ), as well as cartridge valves 18 a ( connection b 1 on the inlet side and connection b 2 on the outlet side ), 18 b ( connection b 1 on the inlet side and connections r 2 , 5 on the outlet side ) and 18 c ( connection b 2 on the outlet side and con - nections r 1 , 4 on the inlet side ). the pilot valve for each series 17 a - 17 c and 18 a - 18 c is a 2 - position 4 - way spool valve 19 a , 19 b with electrical control and spring return , their couplings corresponding to the couplings of fig6 . the cartridge valves are placed in a separate frame which is connected for example to the motor , or they are integrated in a valve block which is placed in the harvester head and which also accommodates the other valves controlling the harvester head . in fig5 to 9 , the connection r 1 is coupled to the channel 4 and the connection r 2 is coupled to the channel 5 , wherein the connections and valves coupled to the connections r 1 , r 2 simultaneously commu - nicate with the channels 4 , 5 and further with the valve 3 . the invention is not limited solely to the above - presented embodiments used as examples , but it can be modified within the scope of the appended claims .

a control coupling for a delimbing and cutting apparatus , provided for feeding means and for changing their feeding speed , and comprising at least two feed motors driven by a pressurized medium , each of the motors being intended to drive a feeding means which is intended to be placed against a tree trunk and to feed the tree trunk through said apparatus , a first channel , via which the pressurized medium can be supplied to the first feed motor and alternatively returned therefrom , and a second channel , via which the pressurized medium can be returned from the second feed motor and alternatively supplied to the same . said feed motors are multi - capacity motors , wherein each motor has at least a first rotational capacity and at least a second rotational capacity as well as a first and a second basic connection for each capacity . the first basic connections of each motor are coupled together as a first connection , and the second basic connections of each motor constitute a second connection and a third connection , which are separate . the control coupling further comprises first valve means for coupling at least two different feeding speeds in operation , wherein the valve means are arranged to couple desired connections and channellings together .

it is understood that use of the singular throughout this application including the claims includes the plural and vice versa unless expressly stated otherwise . that is , “ a ” and “ the ” are to be construed as referring to one or more of whatever the word modifies . non - limiting examples are : “ a therapeutic agent ,” which is understood to include one such agent , two such agents or , under the right circumstances , as determined by those skilled in the treatment of diseased tissues , even more such agents unless it is expressly stated or is unambiguously obvious from the context that such is not intended . likewise , “ a biodegradable polymer ” refers to a single polymer or a mixture of two or more polymers unless , again , it is expressly stated or absolutely obvious from the context that such is not intended . as used herein , unless specified otherwise , any words of approximation such as without limitation , “ about ,” “ essentially ,” “ substantially ” and the like mean that the element so modified need not be exactly what is described but can vary from exact compliance with the written description by as much as ± 15 % without exceeding the scope of this invention . thus , for example without limitation , to stop the flow of blood through an artery “ substantially completely ” means to cut off at least 85 % of the flow of blood . the target tissue of this invention is a malignant solid tumor . a solid tumor refers to an abnormal mass of tissue that usually does not contain cysts or liquid areas . a tumor that is not cancerous is described as “ benign ” while a cancerous tumor , the targets of this invention , are termed “ malignant .” different types of solid tumors are named for the particular cells that form them , for example , sarcomas formed from connective tissue cells ( bone cartilage , fat , etc . ), carcinomas formed from epithelial tissue cells ( breast , colon , pancreas , etc .) and lymphomas formed from lymphatic tissue cells ( lymph nodes , spleen , thymus , etc .). treatment of all types of solid tumors is within the scope of this invention . in particular the target tumor is an hcc . as used herein , “ identifying ” a malignant solid tumor simply refers to detecting its presence and its type by any means currently known in the art or as may become known in the future . as used herein , “ chemotherapeutic agent ” refers to any substance that , when administered in a therapeutically effective amount to a patient suffering from a solid tumor cancer , has a therapeutic beneficial effect on the health and well - being of the patient . a therapeutic beneficial effect on the health and well - being of a patient includes , but it not limited to : ( 1 ) curing the cancer ; ( 2 ) slowing the progress of the cancer ; ( 3 ) causing the tumor to retrogress ; or ( 4 ) alleviating one or more symptoms of the cancer . as used herein , a chemotherapeutic agent also includes any substance that , when administered in a prophylactic amount to a patient afflicted with a solid tumor cancer or who has been rendered substantially free of cancer as the result of one or more therapeutic treatment regimes , has a beneficial effect on the health and well - being of the patient . a prophylactic beneficial effect on the health and well - being of a patient includes , but is not limited to : ( 1 ) maintaining the cancer at a retrogressed level once such level has been achieved by a therapeutically effective amount of a substance , which may be the same as or different from the substance used in a prophylactic effective amount ; or , ( 2 ) preventing or delaying recurrence of the cancer after a course of treatment with a therapeutically effective amount of a substance , which may be the same as or different from the substance used in a prophylactic effective amount , has concluded . it is presently preferred that , when the solid tumor is an hcc , the chemotherapeutic agent comprises at least doxorubicin . any other chemotherapeutic that has a beneficial effect on the hcc may be combined with the doxorubicin but at present cisplatin and mitomycin c are preferred co - therapeutic agents to be administered with doxorubicin . a “ therapeutically effective amount ” refers to that amount of a chemotherapeutic agent that will have a beneficial effect , which may be curative or palliative , on the health and well - being of the patient so afflicted . a therapeutically effective amount may be administered as a single bolus , as intermittent bolus charges , as short , medium or long term sustained release formulations or as any combination of these . as used herein , short - term sustained release refers to the administration of a therapeutically effective amount of a therapeutic agent over a period of about an hour to about 3 days . medium - term sustained release refers to administration of a therapeutically effective amount of a therapeutic agent over a period of about 3 days to about 4 weeks and long - term refers to the delivery of a therapeutically effective amount over any period in excess of about 4 weeks . presently , it is preferred that a therapeutically effective amount of the chemotherapeutic agent be delivered over a period of at least 6 months . as used herein , the use of “ preferred ,” “ preferably ,” or “ more preferred ,” and the like refer to modify an aspect of the invention refers to preferences as they existed at the time of filing of the patent application . structural vehicles or “ particles ” that may be used with the method of this invention include , without limitation , liposomes , biodegradable polymersomes and biodegradable microparticles of a mean size such that at least 80 % of them will not be able to pass through the vasculature servicing the target tumor , in particular an hcc . for the purposes of this invention , two different mean particle sizes are employed . one plurality of particles will have a mean size of about 10 nanometers ( nm ) to about 300 micrometers ( μm ), these being the drug - delivery particles . the other plurality of particles will have a mean size of about 900 μm to about 1200 μm and will be used to embolize an artery in the vicinity of a tumor being treated . the two pluralities of particles may comprise the same structural vehicle or they may be fabricated of different such vehicles . for example without limitation , the drug - carrying plurality of particles may be liposomes while the embolizing plurality of particles may be polymersomes or solid microparticles . as used herein , “ embolization ,” embolizing ” and any other variations on the term refers to the procedure of introducing an artificial material at a site in a blood vessel such that the material lodges there and blocks the flow of blood . materials that can be used to embolize a vessel include , without limitation , coils or hydrocoils , particles , foams and plugs but for the purpose of this invention , the structural vehicles mentioned above are preferred . as used herein , a “ liposome ” refers to a core - shell structure in which the shell comprises phospholipids or sphingolipids that surround a usually liquid , and in most cases aqueous , core . phospholipids are molecules that have two primary regions , a hydrophilic head region comprised of a phosphate of an organic molecule and one or more hydrophobic fatty acid tails . in particular , naturally - occurring phospholipids have a hydrophilic region comprised of choline , glycerol and a phosphate and two hydrophobic regions comprised of fatty acid . when phospholipids are placed in an aqueous environment , the hydrophilic heads come together in a linear configuration with their hydrophobic tails aligned essentially parallel to one another . a second line of molecules then aligns tail - to - tail with the first line as the hydrophobic tails attempt to avoid the aqueous environment . to achieve maximum avoidance of contact with the aqueous environment , i . e ., at the edges of the bilayers , while at the same time minimizing the surface area to volume ratio and thereby achieve a minimal energy conformation , the two lines of phospholipids , know as a phospholipid bilayer or a lamella , converge into a sphere and in doing so entrap some of the aqueous medium , and whatever may be dissolved or suspended in it , in the core of the sphere . examples of phospholipids that may be used to create liposomes are , without limitation , 1 , 2 - dimyristroyl - sn - glycero - 3 - phosphocholine , 1 , 2 - dilauroyl - sn - glycero - 3 - phosphocholine , 1 , 2 - distearoyl - sn - glycero - 3 - phosphocholine , 1 , 2 - dimyristoyl - sn - glycero - 3 - phosphoethanolamine , 1 , 2 - dipalmitoyl - sn - glycero - 3 - phosphoethanolamine , 1 , 2 - dioleoyl - sn - glycero - 3 - phosphate monosodium salt , 1 , 2 - dipalmitoyl - sn - glycero - 3 -[ phosphor - rac -( 1 - glycerol )] sodium salt , 1 , 2 - dimyristoyl - sn - glycero - 3 -[ phospho - l - serine ] sodium salt , 1 , 2 - dioleoyl - sn - glycero - 3 - phosphoethanolamine - n - glutaryl sodium salt and 1 , 1 ′, 2 , 2 ′- tetramyristoyl cardiolipin ammonium salt . liposomes may be unilamellar , composed of a single bilayer , or they may be multilamellar , composed of two or more concentric bilayers . liposomes range from about 20 - 100 nm diameter for small unilamellar vesicles ( suvs ), about 100 - 5000 nm for large multilamellar vesicles and ultimately to about 100 microns for giant multilamellar vesicles ( gmvs ). lmvs form spontaneously upon hydration with agitation of dry lipid films / cakes which are generally formed by dissolving a lipid in an organic solvent , coating a vessel wall with the solution and evaporating the solvent . energy is then applied to convert the lmvs to suvs , luvs , etc . the energy can be in the form of , without limitation , sonication , high pressure , elevated temperatures and extrusion to provide smaller single and multi - lamellar vesicles . during this process some of the aqueous medium is entrapped in the vesicle . generally , however , the fraction of total solute and therefore the amount of therapeutic agent entrapped tends to be rather low , typically in the range of a few percent . recently , however , liposome preparation by emulsion templating ( pautot , et al ., langmuir , 2003 , 19 : 2870 ) has been shown to result in the entrapment of virtually 100 % of aqueous solute . emulsion templating comprises , in brief , the preparation of a water - in - oil emulsion stabilized by a lipid , layering of the emulsion onto an aqueous phase , centrifugation of the water / oil droplets into the water phase and removal of the oil phase to give a dispersion of unilamellar liposomes . this method can be used to make asymmetric liposomes in which the inner and outer monolayers of the single bilayer contain different lipids . any of the preceding techniques as well as any others known in the art or as may become known in the future may be used as compositions of therapeutic agents in or on a delivery interface of this invention . liposomes comprising phospho - and / or sphingolipids may be used to deliver hydrophilic ( water - soluble ) or precipitated therapeutic compounds encapsulated within the inner liposomal volume and / or to deliver hydrophobic therapeutic agents dispersed within the hydrophobic core of the bilayer membrane . as used herein , a “ microparticle ” refers to a solid having as its smallest cross - sectional , i . e ., through the solid as opposed to along its surface , dimension about one micron . presently preferred are microparticles having a mean size of about 10 nm to about 300 μm if intended as the drug - carrying particles or about 900 to about 1200 μm if intended to be the embolizing particles . the solid can have any desired shape such as without limitation spherical , ellipsoid , rod - like , entirely random shaped , etc ., although substantially spherical microparticles are well - known in the art , are readily prepared and are presently preferred . the microparticle may be constructed of one or more biocompatible substances and may be porous so as to permit elution of the therapeutic substance embedded in it or may be biodegradable such that as the particle degrades the therapeutic substance is released into the environment . particle size distributions may be represented in a number of ways , one of the most common of which is “ mean particle size .” a “ mean ” size may refer to a value based on particle length , width and / or diameter , on area or on volume . as used herein , “ mean size ” is determined by measuring the longest through - particle distance of each microparticle and then dividing by the total number of microparticles . of course , this requires sophisticated equipment when dealing with the large numbers of microparticles contemplated by this invention but such equipment is well - known and readily available to those skilled in the art and such determination of mean size is commonplace in the art . to assure efficient capture of the microparticles of this invention , not only should the microparticles have the stated mean size , the distribution of particle size should be a narrow as possible , that is as close to monodisperse as can be achieved . no specific size dispersion is presently preferred because the narrower the better and , while several techniques are discussed below for achieving relatively narrow size distributions , as the state of the art advances , equipment and procedures for reaching even narrower size distributions will surely become available and all such equipment , procedures and size distributions will clearly be within the scope of this invention . a particular method of determining mean particle size is dynamic light scattering (“ dls ”), which is also called photon correlation spectroscopy , and which determines the hydrodynamic or stokes diameter based on diffusion measurements . the hydrodynamic diameter includes solvent associated with the particle . this mean hydrodynamic diameter obtained from dls is close to the volume - average diameter . one method is outlined in the international standards organization (“ iso ”) 13321 . there are many other means of determining mean particle size known to those skilled in the art . also known to those skilled artisans is the fact that the various means tend to give different results but the correlation of the results of one method to each other method is also well known . thus , any method of particle size determination may be used but the result should be correlated with that obtained by dls to assure a mean particle size that will be entrapped at the correct point in the circulatory system , i . e ., the capillaries . with regard to mean size and size distribution , as noted above , it is presently preferred that at least 80 % of the particles , be they liposomes , polymersomes or solid microparticles , administered into an artery serving a particular tissue are entrapped at the selected location in the vasculature servicing the target tumor . more preferably , at least 90 % of the microparticles will be so entrapped and most preferably at present , at least 99 % of the microparticles will be entrapped . the plurality of particles herein can comprise several different designs . in the simplest , the therapeutic agent is simply encapsulated in the carrier at a single concentration so that all particles are substantially the same with regard to drug load . in another design , the therapeutic agent can be encapsulated in the carrier , or if desired in several different carriers , at different concentrations in separate preparations and the particles formed in those separate preparations can be combined for administration to a patient . in yet another design , different therapeutic agents can be separately encapsulated in a carrier , or , again , in different carriers , at various concentrations , the particles being combined for administration or , if desired , administered sequentially . two or more therapeutic agents can , of course , be encapsulated in the same particulate carrier such that the resulting particles each contain more than one therapeutic agent . those skilled in the art will , based on the disclosure herein , be able to devise additional combinations of carrier and therapeutic agent ( s ); all such combinations are within the scope of this invention . the selection of the presently preferred range of particle sizes is based on the average diameter of various portions of the vasculature . a basic premise of this invention is that microparticles containing an appropriate therapeutic agent or combination of agents can be administered into an artery that directly services a tissue of interest . by “ directly services ” is meant that blood flowing through the artery proceeds in one direction only through the labyrinthine maze comprising artery → arterioles → metarterioles → capillaries → postcapillary venules → venules — vein . it is noted that the kidneys have a rather unique circulatory system : arteries afferent arterioles glomerular capillaries efferent arterioles but the methods of this invention are eminently suitable for use with the kidneys as well as other organs . thus , particles injected into blood in the artery have nowhere to go but into the diseased tissue where , depending on their size , they lodge in whichever of the preceding substructures has a diameter that is smaller than the selected particle mean size . arterioles are generally regarded as having inside diameters in the range of about 10 to 50 microns , metarterioles about 10 to 20 microns and capillaries approximately 4 to 15 ( average about 8 ) microns in diameter . thus , microparticles having a mean size of about 10 μm , the smallest size for drug - carrying particles of this invention , should be efficiently trapped at the capillary level . for example , it has been reported that in one experiment 97 % of 15 micrometer radiolabeled microspheres injected in an artery servicing the eye were entrapped at the first pass . at the other end of the spectrum for drug - carrying particles , those with a mean size of about 300 μm , these will be entrapped in the main artery in the vicinity of where it necks down to arteriole size . entrapping the drug - carrying particles at the capillary level is presently preferred in that it offers the broadest specific application of chemotherapeutic agent to the target tumor assuming the tumor has developed a mature capillary system . this is due to the physiology of the capillary system . that is , the capillary system comprises a vast network of minute ( averaging approximately one millimeter in length and 8 - 10 microns in diameter ) vessels that permeates virtually every tissue in the mammalian body . as testament to the ubiquity of capillaries , it has been estimated that their number is approximately 19 , 000 , 000 , 000 and that most living tissue cells lie within 1 - 3 cell lengths of a capillary . thus , to achieve maximum dispersion of a therapeutic agent in a target tissue , it makes sense that the vehicle carrying the therapeutic agent be capable of maneuvering through the circulatory system to the capillary level . on the other hand , if the target tumor has not developed a sophisticated capillary system , it might be preferable to use larger size delivery vehicles / particles that will lodge in larger diameter vessels servicing the capillaries . such determination is left to the attending physician and should be based on whatever diagnostic evidence is evinced during the course of treatment of the patient . whatever the selected mean particle size of the drug delivery vehicles , the mean size of the embolizing particles must be larger so as to substantially or , if desired , completely cut off the flow of blood to the region where the drug - delivery vehicle has lodged . in this manner , drug can be released from the delivery vehicle and have time to enter into the surrounding tissue without the risk of being carried away by the blood . it may , on the other hand , be desirable to select the embolizing particle size based on the dimensions of the largest artery servicing the tumor that services only or predominantly the tumor . in this manner , stress can be placed on the entire tumor while at the same time embolization of healthy tissues is held to a minimum . in addition to solid microparticles and liposomes , a particle of this invention may be a polymersome , which is akin to a liposome wherein the shell is made up of synthetic amphiphilic polymers rather than phospholipids and sphigolipids . examples of polymers that can be used to prepare polymersomes include , without limitation , poly ( ethylene glycol )- b - poly ( ε - caprolactone ), poly ( ethylene glycol )- b - polyesters , poly ( ethylene glycol )- b - poly ( l - aminoacids ), poly ( n - vinylpyrrolidone )- bl - poly ( orthoesters ), poly ( n - vinylpyrrolidone )- b - polyanhydrides and poly ( n - vinylpyrrolidone )- b - poly ( alkyl acrylates ). depending on the length and chemical nature of the polymers in the diblock copolymer , polymersomes can be substantially more robust that liposomes . in addition , the ability to control completely the chemical nature of each block of the diblock copolymer permits tuning of the polymersome &# 39 ; s composition to fit the desired application . for example , membrane thickness can be controlled by varying the degree of polymerization of the individual blocks . adjusting the glass transition temperatures of the blocks will affect the fluidity and therefore the permeability of the membrane . even the mechanism of release can be modified by altering the nature of the polymers . polymersomes can be prepared in the same manner as liposomes . that is , a film of the diblock copolymer can be formed by dissolving the copolymer in an organic solvent , applying a film of the copolymer - containing solvent to a vessel surface , removing the solvent to leave a film of the copolymer and then hydrating the film . polymersomes can also be prepared by dissolving the diblock copolymer in a solvent and then adding a poor solvent for one of the blocks , which will result in the spontaneous formation of polymersomes . as with liposomes , polymersomes can be used to encapsulate therapeutic agents by including the therapeutic agent in the water used to rehydrate the copolymer film . polymersomes can also be force - loaded by osmotically driving the therapeutic agent into the core of the vesicle . also as with liposomes , the loading efficiency is generally low . recently , however , a technique has been reported that provides polymersomes of relative monodispersity and high loading efficiency ; generation of polymersomes from double emulsions . lorenceau , et al ., langmuir , 2005 , 21 : 9183 - 86 . the technique involves the use of microfluidic technology to generate double emulsions consisting of water droplets surrounded by a layer of organic solvent . these droplet - in - a - drop structures are then dispersed in a continuous water phase . the diblock copolymer is dissolved in the organic solvent and self - assembles into proto - polymersomes on the concentric interfaces of the double emulsion . the actual polymersomes are formed by completely evaporating the organic solvent from the shell . by this procedure the size of the polymersomes can be finely controlled and , in addition , the ability to maintain complete separation of the internal fluids from the external fluid throughout the process allows extremely efficient encapsulation . this technique along with any other technique know in the art or as may become known in the future can be used to prepare a composition of therapeutic agents for use in or on a delivery interface of this invention . as used herein , “ delivering ” microparticles “ at or near ” a tumor refers to deposition of the particles in an artery sufficiently close to the target tumor to assure to the extent possible that the first instance of encountering a vessel of sufficiently small internal diameter to prevent passage of the particles will be the capillary system of the tumor itself . such delivery can be accomplished by a number of means including , without limitation , the use of catheters and direct injection . both of these methods of delivering microparticles to a specific locale in a patient &# 39 ; s body are well - known to those skilled in the art and require no further explication here . as use herein , “ proximal to the location of the first plurality of microparticles ” refers to a point in the target artery that is between where the first plurality of microparticles has lodges and the heart so as to substantially cut off the flow of blood past the region with the first plurality of microparticles has lodged . as mentioned previously , presently preferred delivery vehicles of this invention are microparticles , liposomes and polymersomes having a mean particle size such that the majority of the particles are entrapped in the vascular system at the chosen locale upon the first pass of the plurality of particles through the patient &# 39 ; s circulatory system . as used herein , “ first pass ” refers to the first time a particle encounters a vessel of the correct inside diameter be it a capillary , an arteriole , etc . with regard , without limitation , to a capillary target , first pass refers to the first time the drug delivery vehicle encounters the capillary bed at the terminus of a selected artery serving a tumor . microparticles that , for one reason or another , pass through the bed and find their way to venules and thence to veins will continue to circulate in the circulatory system until they once again encounter a capillary bed ( although it may not be the capillary bed of the target tissue , which is why it is preferred that as high a percentage as possible are entrapped in the capillary bed of the target diseased tissue after having been administered into an artery serving that tissue ). again , for the purpose of this invention , it is preferred that at least 80 % of the microparticles are entrapped at the first pass , more preferably 90 % and presently most preferably , 99 %. with regard to embolizing particles , they will clearly be trapped on the first pass since their size renders them incapable of passing through the capillary system to the veins . the critical aspect of these particles is that they interrupt blood flow upstream from where the drug - carrying particles are trapped . as mentioned above , in order to achieve the preceding degrees of entrapment it is necessary to produce microparticles having a size distribution a narrow as possible around the target mean size wherein the target mean size is determined by the vessel size in the tissue being treated . that is , again with reference to capillary bed entrapment , the mean particle size must be small enough to pass through an arteriole ( afferent arteriole in the case of the kidneys ) but large enough to be trapped by a capillary . while there may be other means to accomplish this and any such means is within the scope of this invention , presently preferred means include emulsification followed by supercritical fluid solvent extraction , ultrasonic atomization or droplet formation , electrohydrodynamic atomization and membrane emulsification . emulsification followed by supercritical fluid solvent extraction to form microparticles having a very narrow size range is a well - known technique in the art and therefore need not be extensively discussed herein , in brief , the technique involves the formation of an emulsion by dissolving a polymer and a therapeutic agent in a solvent for both , adding the solution under high shear to water containing emulsifying agent , sonicating to achieve a narrow droplet size range , passing the droplets through a porous membrane of well - defined pore size and then extracting the solvent from the microparticles using a supercritical fluid to give a hardened particle . a supercritical fluid , that is a fluid above its critical temperature and pressure , is used because of the physical properties of such fluids , which are intermediate between those of a gas those of a liquid . for example , supercritical carbon dioxide has a viscosity in the range of about 0 . 02 to about 0 . 1 centipoise ( cp ) whereas liquids have viscosities 0 . 5 - 1 . 0 cp and gasses have viscosities around 0 . 01 cp . further , the diffusivities of solutes in supercritical carbon dioxide are up to a factor of 10 higher than in liquid solvents . this and the tunability of the solvating properties of supercritical fluids , which are a complex ( but relatively well - understood ) function of pressure and temperature , permit extremely selective extraction of one material , the solvent herein for instance , from others it may be combined with . in any event , the hardened microparticles obtained after supercritical fluid solvent extraction may then be passed through yet another filter with well - defined pore size to still further control particle size distribution . atomization of a solution using an ultrasonic transducer can produce relatively monodisperse droplets . when captured in a appropriate bath and hardened , this can result in a narrow distribution of microspheres . the ultrasonic energy may be applied using a “ horn ” with the solution either flowing through it or being applied to its surface . the ultrasonic horn oscillates at a fixed frequency supplied by an ultrasonic transducer . ultrasonic spray nozzles of this sort are readily available from sono - tek corp , milton , n . y . another technique that produces relatively monodisperse particles involves the use of acoustic excitation of a liquid stream to break the stream up into monodisperse particles ( berkland , et al ., j . control . rel ., 2001 , 73 : 59 - 74 ). the liquid stream is composed of a polymer and a therapeutic agent dissolved in one or more solvents . the droplets are carried by a carrier stream to a hardening bath where the solvent is removed . the frequencies needed to excite the liquid stream sufficiently to break it up into droplets are in the ultrasonic region of the spectrum . electrohydrodynamic atomization ( edha ) is another , relatively new but nevertheless well - characterized technique in the art for producing narrow size distribution , i . e . essentially monodisperse , microparticles . again , without going into unnecessary detail since those skilled in the art will be very familiar with the technique , electrohydrodynamic atomization involves pumping a solution through a nozzle wherein a high voltage potential has been established between the tip of the nozzle and a counter - electrode . the high potential causes a build - up of electric charge in droplets at the nozzle tip and when the coulombic forces exceed the surface tension of the droplets , they separate , essentially explode , into smaller droplets . if parameters are optimized to achieve a stable spray , monodispersed droplets are obtained . removal of solvent from the droplets yields monodisperse solid microparticles . parameters that may be varied to achieve a particular average size droplet / particle include , without limitation , the applied voltage , the flow rate , density , conductivity and surface tension . normal emulsification techniques generally afford droplets of relative polydispersity , at least with regard to the narrow size distribution desired for use in the current invention . thus , the requirement of one and perhaps two filtrations as set forth above with regard to emulsification / supercritical fluid solvent extraction . this is due primarily to the myriad parameters that come into play when preparing an emulsion such as , without limitation , the concentration of the agents , the nature of the drug / polymer / surfactant / solvent interaction , polymer molecular weight , sonication power , stir speed , fluid dynamics of the system and temperature . these shortcomings , at least with regard to the present invention , can be overcome by using the technique known as membrane emulsification . membrane emulsification is another relatively new technique for producing essentially monodisperse microparticles . as with standard emulsification followed by multiple filtrations and electrohydrodynamic atomization , membrane emulsification , while a relatively recent development , is well - known to those skilled in the art and need not be detailed herein . in brief , membrane emulsification involves the injection of an intended discontinuous phase through a porous membrane in which pore size is very carefully controlled into the intended continuous phase , which is moving past the porous membrane on the side opposite that from which the discontinuous phase is being injected . droplets are sheared off the membrane by the moving continuous phase . control of droplet size is quite exquisite compared to normal emulsification techniques because size is determined predominantly by easily varied parameters including the speed of the continuous phase , viscosity of the continuous phase , interfacial tension between the phases , the chemistry of the system — surfactant type and physical properties of all the constituents — and , of course , pore size . newer techniques for creating porous membranes with a very precise pore size such as laser drilling and lithographic procedures have made membrane emulsification even more attractive as a technique for control of particle size distribution . any selected particle size can be prepared with relatively narrow mean size distribution using the above techniques , as well as others known in the art , by incorporating well - known mechanical and procedural changes in the methods described . polymeric microparticies presently preferred drug delivery vehicles of this invention . the polymer ( s ) must be biocompatible and can be either biostable or biodegradable . as used herein , biodegradable includes all means by which a polymer can be disposed of in a patient &# 39 ; s body , which includes bioabsorption , resorption , etc . biostable simply means that the polymer does not biodegrade or bioabsorb under physiological conditions over a relatively long period of time that may reach years . as used herein , “ biocompatible ” refers to a polymer that both in its intact , that is , as synthesized , state and in its decomposed state , i . e ., its degradation products , is not , or at least is minimally , toxic to living tissue ; does not , or at least minimally and reparably , injure ( s ) living tissue ; and / or does not , or at least minimally and / or controllably , cause ( s ) an immunological reaction in living tissue . as used herein , “ biodegradable ” refers to any natural means by which a polymer can be disposed of in a patient &# 39 ; s body . this includes such phenomena as , without limitation , biological decomposition , bioerosion , absorption , resorption , etc . biodegradation of a polymer in vivo results from the action of one or more endogenous biological agents and / or conditions such as , without limitation , enzymes , microbes , cellular components , physiological ph and temperature and the like . bioabsorbable or bioresorbable on the other hand generally refers to the situation wherein the polymer itself or its degradation products are removed from the body by cellular activity such as , without limitation , phagocytosis . bioerodible refers to both physical processes such as , without limitation , dissolution and chemical processes such as , without limitation , backbone cleavage by hydrolysis of the bonds linking constitutional units of a polymer together . as used herein , biodegradable includes bioerodible , bioresobable and bioabsorbable . the biodegradability of a polymer can be characterized by its “ mass loss ” in vivo over a period of time . by “ mass loss ” is meant loss in actual weight of a particle fabricated from the polymer a contrasted with “ molecular weight loss ,” which refers to the break - down of individual polymer chains to smaller fragments , a process that generally precedes mass loss when the smaller fragments break off of the polymeric particle . physiological conditions merely refers to the physical , chemical and biochemical milieu that constitutes the mammalian body and includes , without limitation , ph , temperature , enzymes and the presence of destructive cells such as phagocytes . among biocompatible , relatively biostable polymers useful as carriers for the preparation of microparticles of this invention are , without limitation , polyacrylates , polymethacryates , polyureas , polyurethanes , polyolefins , polyvinylhalides , polyvinylidenehalides , polyvinylethers , polyvinylaromatics , polyvinylesters , polyacrylonitriles , alkyd resins , polysiloxanes and epoxy resins . biocompatible , biodegradable polymers that can be used for the carrier / particle - forming of this invention include , again without limitation , naturally - occurring polymers such as , without limitation , collagen , chitosan , alginate , fibrin , fibrinogen , cellulosics , starches , dextran , dextrin , hyaluronic acid , heparin , glycosaminoglycans , polysaccharides and elastin . synthetic or semi - synthetic biocompatible , biodegradable polymers may also be used as carriers for the purpose of this invention . as used herein , a synthetic polymer refers to one that is created wholly in the laboratory while a semi - synthetic polymer refers to a naturally - occurring polymer than has been chemically modified in the laboratory . examples of synthetic polymers include , without limitation , polyphosphazines , polyphosphoesters , polyphosphoester urethane , polyester urethanes , polyester urethane ureas , polyhydroxyacids , polyhydroxyalkanoates , polyanhydrides , polyesters , polyorthoesters , polyamino acids , polyoxymethylenes , poly ( ester amides ) and polyimides . further non - limiting examples of biocompatible biodegradable polymers that may be suitable as carriers herein include , without limitation , polycaprolactone , poly ( l - lactide ), poly ( d , l - lactide ), poly ( d , l - lactide - co - peg ) block copolymers , poly ( d , l - lactide - co - trimethylene carbonate ), polyglycolide , poly ( lactide - co - glycolide ), polydioxanone ( pds ), polyorthoester , polyanhydride , poly ( glycolic acid - co - trimethylene carbonate ), polyphosphoester , polyphosphoester urethane , poly ( amino acids ), polycyanoacrylates , poly ( trimethylene carbonate ), poly ( iminocarbonate ), polycarbonates , polyurethanes , copoly ( ether - esters ) ( e . g . peo / pla ), polyalkylene oxalates , polyphosphazenes , pha - peg , and combinations thereof . the pha may include poly ( α - hydroxyacids ), poly ( β - hydroxyacid ) such as poly ( 3 - hydroxybutyrate ) ( phb ), poly ( 3 - hydroxybutyrate - co - valerate ) ( phbv ), poly ( 3 - hydroxyproprionate ) ( php ), poly ( 3 - hydroxyhexanoate ) ( phh ), or poly ( 4 - hydroxyacid ) such as poly poly ( 4 - hydroxybutyrate ), poly ( 4 - hydroxyvalerate ), poly ( 4 - hydroxyhexanoate ), poly ( hydroxyvalerate ), poly ( tyrosine carbonates ), poly ( tyrosine arylates ), poly ( ester amide ), polyhydroxyalkanoates ( pha ), poly ( 3 - hydroxyalkanoates ) such as poly ( 3 - hydroxypropanoate ), poly ( 3 - hydroxybutyrate ), poly ( 3 - hydroxyvalerate ), poly ( 3 - hydroxyhexanoate ), poly ( 3 - hydroxyheptanoate ) and poly ( 3 - hydroxyoctanoate ), poly ( 4 - hydroxyalkanaote ) such as poly ( 4 - hydroxybutyrate ), poly ( 4 - hydroxyvalerate ), poly ( 4 - hydroxyhexanote ), poly ( 4 - hydroxyheptanoate ), poly ( 4 - hydroxyoctanoate ) and copolymers including any of the 3 - hydroxyalkanoate or 4 - hydroxyalkanoate monomers described herein or blends thereof , polyglycolide , poly ( d , l - lactide - co - glycolide ), poly ( l - lactide - co - glycolide ), polycaprolactone , poly ( lactide - co - caprolactone ), poly ( glycolide - co - caprolactone ), poly ( dioxanone ), poly ( ortho esters ), poly ( anhydrides ), poly ( tyrosine carbonates ) and derivatives thereof , poly ( tyrosine ester ) and derivatives thereof , poly ( imino carbonates ), poly ( glycolic acid - co - trimethylene carbonate ), polyphosphoester , polyphosphoester urethane , poly ( amino acids ), polycyanoacrylates , poly ( trimethylene carbonate ), poly ( iminocarbonate ), polyphosphazenes , silicones , polyesters , polyolefins , polyisobutylene and ethylene - alphaolefin copolymers , acrylic polymers and copolymers , vinyl halide polymers and copolymers , such as polyvinyl chloride , polyvinyl ethers , such as polyvinyl methyl ether , polyvinylidene halides , such as polyvinylidene chloride , polyacrylonitrile , polyvinyl ketones , polyvinyl aromatics , such as polystyrene , polyvinyl esters , such as polyvinyl acetate , copolymers of vinyl monomers with each other and olefins , such as ethylene - methyl methacrylate copolymers , acrylonitrile - styrene copolymers , abs resins , and ethylene - vinyl acetate copolymers , polyamides , such as nylon 66 and polycaprolactam , alkyd resins , polycarbonates , polyoxymethylenes , polyimides , polyethers , poly ( glyceryl sebacate ), poly ( propylene fumarate ), poly ( n - butyl methacrylate ), poly ( sec - butyl methacrylate ), poly ( isobutyl methacrylate ), poly ( tert - butyl methacrylate ), poly ( n - propyl methacrylate ), poly ( isopropyl methacrylate ), poly ( ethyl methacrylate ), poly ( methyl methacrylate ), epoxy resins , polyurethanes , rayon , rayon - triacetate , cellulose acetate , cellulose butyrate , cellulose acetate butyrate , cellophane , cellulose nitrate , cellulose propionate , cellulose ethers , carboxymethyl cellulose , polyethers such as poly ( ethylene glycol ) ( peg ), copoly ( ether - esters ) ( e . g . poly ( ethylene oxide - co - lactic acid ) ( peo / pla )), polyalkylene oxides such as poly ( ethylene oxide ), poly ( propylene oxide ), poly ( ether ester ), polyalkylene oxalates , phosphoryl choline containing polymer , choline , poly ( aspirin ), polymers and co - polymers of hydroxyl bearing monomers such as 2 - hydroxyethyl methacrylate ( hema ), hydroxypropyl methacrylate ( hpma ), hydroxypropylmethacrylamide , peg acrylate ( pega ), peg methacrylate , methacrylate polymers containing 2 - methacryloyloxyethyl - phosphorylcholine ( mpc ) and n - vinyl pyrrolidone ( vp ), carboxylic acid bearing monomers such as methacrylic acid ( ma ), acrylic acid ( aa ), alkoxymethacrylate , alkoxyacrylate , and 3 - trimethylsilylpropyl methacrylate ( tmspma ), poly ( styrene - isoprene - styrene )- peg ( sis - peg ), polystyrene - peg , polyisobutylene - peg , polycaprolactone - peg ( pcl - peg ), pla - peg , poly ( methyl methacrylate )- peg ( pmma - peg ), polydimethylsiloxane - co - peg ( pdms - peg ), poly ( vinylidene fluoride )- peg ( pvdf - peg ), pluronic ™ surfactants ( polypropylene oxide - co - polyethylene glycol ), poly ( tetramethylene glycol ), hydroxy functional poly ( vinyl pyrrolidone ), biomolecules such as collagen , chitosan , alginate , fibrin , fibrinogen , cellulose , starch , dextran , dextrin , hyaluronic acid , fragments and derivatives of hyaluronic acid , heparin , fragments and derivatives of heparin , glycosamino glycan ( gag ), gag derivatives , polysaccharide , elastin , elastin protein mimetics , or combinations thereof . blends and copolymers of the above polymers may also be used and are within the scope of this invention . based on the disclosures herein , those skilled in the art will recognize those implantable medical devices and those materials from which they may be fabricated that will be useful with the coatings of this invention . any reference to the molecular weight of a polymer of this invention is reported as the number average molecule weight , the nature and determination of which is well - known in the art and need not be explicated further here . as used herein , the “ weight ratio ” of a chemotherapeutic drug to a polymer refers to quantity of the drug relative to the quantity of polymer that constitutes the microparticle carrying the drug in like units , e . g . without limitation , mg : mg so that , for instance , a drug to polymer weight ratio of 1 : 5 would mean that the amount of drug in or on a microparticle in which the polymer component weights 5 mg would be 1 mg . as noted previously , a chemotherapeutic agent may be administered to a patient using the method of this invention in a bolus or sustained release format . the manner of fabrication of the carrier microparticle including the material of which it is made will determine how the chemotherapeutic agent is released after the particles have been delivered at or near the target tumor . such fabrication techniques are well - documented in the patent and technical literature and need not be replicated here . suffice it to say that any fabrication materials and procedures resulting in a desired release format are all within the scope of this invention . as used herein , loading a chemotherapeutic drug “ into or onto ” a microparticle refers to ( 1 ) “ into ”— drug - carrying particles where the drug is encapsulated in the matrix of the particle , if it is solid , or at the core of the particle if it constitutes a core - shell structure — liposomes and polymersomes herein or ( 2 ) “ onto ”— drug - carrying particle where the drug is attached to the outer surface of the particle , which can be accomplished by any number of means well - known in the art . the method of this invention can be used to treat any solid tumor cancer to which blood is supplied by a dedicated , relatively reachable artery such as the renal , hepatic , pulmonary and cardiac arteries . in particular at present it can be used to treat hcc tumors . as such , the chemotherapeutic agent ( s ) which may be used in the instant method include virtually all known chemotherapeutics as well as those that become available in the future . as used herein , a “ patient ” refers to any species that might benefit from treatment using the method herein but at present is preferably a mammal and most preferably a human being .

this invention is directed to methods of treating solid tumor cancers , particularly refractory cancers by administration of two pluralities of microparticles , one comprising drug - carrying microparticles sized to lodge at the tumor preferably in the capillary bed of the tumor and the other comprising non - drug - carrying microparticles sized to lodge in the arterial system servicing the tumor so as to embolize the tumor .

referring to fig1 to 7 , what is shown is a method for the treatment of glaucoma by trabecular bypass surgery . in particular , a seton implant is used to bypass diseased trabecular meshwork at the level of trabecular meshwork to use or restore existing outflow pathways and methods thereof . for background illustration purposes , fig1 shows a sectional view of an eye 10 , while fig2 shows a close - up view , showing the relative anatomical locations of the trabecular meshwork , the anterior chamber , and schlemm &# 39 ; s canal . thick collagenous tissue known as sclera 11 covers the entire eye 10 except that portion covered by the cornea 12 . the cornea 12 is a thin transparent tissue that focuses and transmits light into the eye and the pupil 14 which is the circular hole in the center of the iris 13 ( colored portion of the eye ). the cornea 12 merges into the sclera 11 at a juncture referred to as the limbus 15 . the ciliary body 16 begins internally in the eye and extends along the interior of the sclera 11 and becomes the choroid 17 . the choroid 17 is a vascular layer of the eye underlying retina 18 . the optic nerve 19 transmits visual information to the brain and is sequentially destroyed by glaucoma . the anterior chamber 20 of the eye 10 , which is bound anteriorly by the cornea 12 and posteriorly by the iris 13 and lens 26 , is filled with aqueous . aqueous is produced primarily by the ciliary body 16 and reaches the anterior chamber angle 25 formed between the iris 13 and the cornea 12 through the pupil 14 . in a normal eye , the aqueous is removed through the trabecular meshwork 21 . aqueous passes through trabecular meshwork 21 into schlemm &# 39 ; s canal 22 and through the aqueous veins 23 which merge with blood - carrying veins and into venous circulation . intraocular pressure of the eye 10 is maintained by the intricate balance of secretion and outflow of the aqueous in the manner described above . glaucoma is characterized by the excessive buildup of aqueous fluid in the anterior chamber 20 which produces an increase in intraocular pressure ( fluids are relatively incompressible and pressure is directed equally to all areas of the eye ). as shown in fig2 the trabecular meshwork 21 constitutes a small portion of the sclera 11 . it is understandable that creating a hole or opening for implanting a device through the tissues of the conjunctiva 24 and sclera 11 is relatively a major surgery as compared to a surgery for implanting a device through the trabecular meshwork 21 only . a seton implant 31 of the present invention for either using or restoring existing outflow pathways positioned through the trabecular meshwork 21 is illustrated in fig5 . in a first embodiment , a method for increasing aqueous humor outflow in an eye of a patient to reduce the intraocular pressure therein . the method comprises bypassing diseased trabecular meshwork at the level of the trabecular meshwork and thereby restoring existing outflow pathways . alternately , a method for increasing aqueous humor outflow in an eye of a patient to reduce an intraocular pressure therein is disclosed . the method comprises bypassing diseased trabecular meshwork at a level of said trabecular meshwork with a seton implant and using existing outflow pathways . the seton implant 31 may be an elongated seton or other appropriate shape , size or configuration . in one embodiment of an elongated seton implant , the seton has an inlet end , an outlet end and a lumen therebetween , wherein the inlet end is positioned at an anterior chamber of the eye and the outlet end is positioned at about an exterior surface of said diseased trabecular meshwork . furthermore , the outlet end may be positioned into fluid collection channels of the existing outflow pathways . optionally , the existing outflow pathways may comprise schlemm &# 39 ; s canal 22 . the outlet end may be further positioned into fluid collection channels up to the level of the aqueous veins with the seton inserted either in a retrograde or antegrade fashion with respect to the existing outflow pathways . in a further alternate embodiment , a method is disclosed for increasing aqueous humor outflow in an eye of a patient to reduce an intraocular pressure therein . the method comprises ( a ) creating an opening in trabecular meshwork , wherein the trabecular meshwork comprises an interior side and exterior side ; ( b ) inserting a seton implant into the opening ; and ( c ) transporting the aqueous humor by said seton implant to bypass the trabecular meshwork at the level of said trabecular meshwork from the interior side to the exterior side of the trabecular meshwork . [ 0048 ] fig3 shows an embodiment of the seton implant 31 constructed according to the principles of the invention . the seton implant may comprise a biocompatible material , such as a medical grade silicone , for example , the material sold under the trademark silastic ™, which is available from dow corning corporation of midland , mich ., or polyurethane , which is sold under the trademark pellethane ™ which is also available from dow corning corporation . in an alternate embodiment , other biocompatible materials ( biomaterials ) may be used , such as polyvinyl alcohol , polyvinyl pyrolidone , collagen , heparinized collagen , tetrafluoroethylene , fluorinated polymer , fluorinated elastomer , flexible fused silica , polyolefin , polyester , polysilison , mixture of biocompatible materials , and the like . in a further alternate embodiment , a composite biocompatible material by surface coating the above - mentioned biomaterial may be used , wherein the coating material may be selected from the group consisting of polytetrafluoroethlyene ( ptfe ), polyimide , hydrogel , heparin , therapeutic drugs , and the like . the main purpose of the seton implant is to assist in facilitating the outflow of aqueous in an outward direction 40 into the schlemm &# 39 ; s canal and subsequently into the aqueous collectors and the aqueous veins so that the intraocular pressure is balanced . in one embodiment , the seton implant 31 comprises an elongated tubular element having a distal section 32 and an inlet section 44 . a rigid or flexible distal section 32 is positioned inside one of the existing outflow pathways . the distal section may have either a tapered outlet end 33 or have at least one ridge 37 or other retention device protruding radially outwardly for stabilizing the seton implant inside said existing outflow pathways after implantation . for stabilization purposes , the outer surface of the distal section 32 may comprise a stubbed surface , a ribbed surface , a surface with pillars , a textured surface , or the like . the outer surface 36 , including the outer region 35 and inner region 34 at the outlet end 33 , of the seton implant is biocompatible and tissue compatible so that the interaction / irritation between the outer surface and the surrounding tissue is minimized . the seton implant may comprise at least one opening at a location proximal the distal section 32 , away from the outlet end 33 , to allow flow of aqueous in more than one direction . the at least one opening may be located on the distal section 32 at about opposite of the outlet end 33 . in another exemplary embodiment , the seton implant 31 may have a one - way flow controlling means 39 for allowing one - way aqueous flow 40 . the one - way flow controlling means 39 may be selected from the group consisting of a check valve , a slit valve , a micropump , a semi - permeable membrane , or the like . to enhance the outflow efficiency , at least one optional opening 41 in the proximal portion of the distal section 32 , at a location away from the outlet end 33 , and in an exemplary embodiment at the opposite end of the outlet end 33 , is provided . [ 0051 ] fig4 shows a top cross - sectional view of fig3 . the shape of the opening of the outlet end 33 and the remaining body of the distal section 32 may be oval , round or some other shape adapted to conform to the shape of the existing outflow pathways . this configuration will match the contour of schlemm &# 39 ; s canal to stabilize the inlet section with respect to the iris and cornea by preventing rotation . as shown in fig3 the seton implant of the present invention may have a length between about 0 . 5 mm to over a meter , depending on the body cavity the seton implant applies to . the outside diameter of the seton implant may range from about 30 μm to about 500 μm . the lumen diameter is preferably in the range between about 20 μm to about 150 μm . the seton implant may have a plurality of lumens to facilitate multiple flow transportation . the distal section may be curved at an angle between about 30 degrees to about 150 degrees , in an exemplary embodiment at around 70 - 110 degrees , with reference to the inlet section 44 . [ 0053 ] fig5 shows another embodiment of the seton implant 45 constructed in accordance with the principles of the invention . in an exemplary embodiment , the seton implant 45 may comprise at least two sections : an inlet section 47 and an outlet section 46 . the outlet section has an outlet opening 48 that is at the outlet end of the seton implant 45 . the shape of the outlet opening 48 is preferably an oval shape to conform to the contour of the existing outflow pathways . a portion of the inlet section 47 adjacent the joint region to the outlet section 46 will be positioned essentially through the diseased trabecular meshwork while the remainder of the inlet section 47 and the outlet section 46 are outside the trabecular meshwork . as shown in fig5 the long axis of the oval shape opening 48 lies in a first plane formed by an x - axis and a y - axis . to better conform to the anatomical contour of the anterior chamber 20 , the trabecular meshwork 21 and the existing outflow pathways , the inlet section 47 may preferably lie at an elevated second plane , at an angle θ , from the first plane formed by an imaginary inlet section 47 a and the outlet section 46 . the angle θ may be between about 30 degrees and about 150 degrees . [ 0054 ] fig6 shows a perspective view illustrating the seton implant 31 , 45 of the present invention positioned within the tissue of an eye 10 . a hole / opening is created through the diseased trabecular meshwork 21 . the distal section 32 of the seton implant 31 is inserted into the hole , wherein the inlet end 38 is exposed to the anterior chamber 20 while the outlet end 33 is positioned at about an exterior surface 43 of said diseased trabecular meshwork 21 . in a further embodiment , the outlet end 33 may further enter into fluid collection channels of the existing outflow pathways . in one embodiment , the means for forming a hole / opening in the trabecular mesh 21 may comprise an incision with a microknife , an incision by a pointed guidewire , a sharpened applicator , a screw shaped applicator , an irrigating applicator , or a barbed applicator . alternatively , the trabecular meshwork may be dissected off with an instrument similar to a retinal pick or microcurrette . the opening may alternately be created by retrogade fiberoptic laser ablation . [ 0056 ] fig7 shows an illustrative method for placing a seton implant at the implant site . an irrigating knife or applicator 51 comprises a syringe portion 54 and a cannula portion 55 . the distal section of the cannula portion 55 has at least one irrigating hole 53 and a distal space 56 for holding a seton implant 31 . the proximal end 57 of the lumen of the distal space 56 is sealed from the remaining lumen of the cannula portion 55 . for positioning the seton 31 in the hole or opening through the trabecular meshwork , the seton may be advanced over the guidewire or a fiberoptic ( retrograde ). in another embodiment , the seton is directly placed on the delivery applicator and advanced to the implant site , wherein the delivery applicator holds the seton securely during the delivery stage and releases it during the deployment stage . in an exemplary embodiment of the trabecular meshwork surgery , the patient is placed in the supine position , prepped , draped and anesthesia obtained . in one embodiment , a small ( less than 1 mm ) self sealing incision is made . through the cornea opposite the seton placement site , an incision is made in trabecular meshwork with an irrigating knife . the seton 31 is then advanced through the cornea incision 52 across the anterior chamber 20 held in an irrigating applicator 51 under gonioscopic ( lens ) or endoscopic guidance . the applicator is withdrawn and the surgery concluded . the irrigating knife may be within a size range of 20 to 40 gauges , preferably about 30 gauge . from the foregoing description , it should now be appreciated that a novel approach for the surgical treatment of glaucoma has been disclosed for releasing excessive intraocular pressure . while the invention has been described with reference to a specific embodiment , the description is illustrative of the invention and is not to be construed as limiting the invention . various modifications and applications may occur to those who are skilled in the art , without departing from the true spirit and scope of the invention , as described by the appended claims .

surgical methods and related medical devices for treating glaucoma are disclosed . the method comprises trabecular bypass surgery , which involve bypassing diseased trabecular meshwork with the use of a seton implant . the seton implant is used to prevent a healing process known as filling in , which has a tendency to close surgically created openings in the trabecular meshwork . the surgical method and novel implant are addressed to the trabecular meshwork , which is a major site of resistance to outflow in glaucoma . in addition to bypassing the diseased trabecular meshwork at the level of the trabecular meshwork , existing outflow pathways are also used or restored . the seton implant is positioned through the trabecular meshwork so that an inlet end of the seton implant is exposed to the anterior chamber of the eye and an outlet end is positioned into fluid collection channels at about an exterior surface of the trabecular meshwork or up to the level of aqueous veins .

referring now in more detail and by reference characters to the drawings which illustrate preferred embodiments of the present invention , a designates a game apparatus which includes a peripherally extending frame 10 having opposed end rails 12 and longitudinally extending goal rails 14 . each of the longitudinally extending rails 14 merge into diagonally located , outwardly struck arms 16 , which , in turn , are connected by longitudinally extending legs or side rails 18 , to thereby provide a pair of opposed transversely outset areas 20 within the frame 10 . each of the interior surfaces of the rails 12 and 14 and the arms 16 and legs 18 serve as rebound surfaces . moreover , bumper pads 22 are located in the area of each of the diagonally located outwardly struck arms 16 , and these rebound pads 22 extend into the interior of the frame 10 and provide rebound surfaces 24 generally facing toward one player end and the rebound surfaces 26 generally facing toward one player end and the rebound surfaces 26 generally facing toward the other player end . a playing board 28 extends between each of opposed player ends designated by reference numerals 30 and 32 . the playing board 28 has a generally solid upper playing surface 34 defined by a transversely extending , centrally located high point or ridge 36 , the playing surface 34 extending generally downwardly toward each of the player ends 30 and 32 . the playing board 28 is generally carried between each of the player ends such that the surface is defined by a generally continuous arc . fig3 illustrates a modified form of game playing board which may also be used in the present invention and which is designated by reference numeral 28 &# 39 ;. in this case , the game playing board 28 &# 39 ; is comprised of a pair of relatively flat inclined planar board sections 38 and 39 connected by an arcuate section 40 . the game board 28 &# 39 ; has a generally solid upper playing surface 34 &# 39 ; defined by a transversely extending , centrally located high point or ridge 36 &# 39 ; located at the apex of the arcuate section 40 . in this case , it can be observed that the playing board 28 &# 39 ; is essentially similar in operation to the playing board 28 . however , it should be understood that the angle defined by the inclined board sections 38 and 39 should be sufficiently large so that the playing piece does not lift off of the game board at the high point due to the change of angle of the playing surface . the arcuate section 40 also serves to alleviate this condition . in each of these embodiments the playing piece , in the form of a ball , designated by reference numeral p , will always roll downwardly toward one player end 30 or the other player end 32 , depending upon its location relative to the high point 36 . in each of the aforementioned embodiments of the game apparatus , it is not necessary to employ the bumper pads 24 . however , these bumper pads do serve to increase the number of possible rebound trajectories of the playing piece and therefore increase the player participation and the required skill of the players . moreover , it is not necessary to employ the offset areas 20 , such that the game board could be of generally rectangular shape . however , it has been found that the use of a rectangularly shaped game board without the employment of the offset areas 20 tends to increase the speed of operation of the game significantly and materially increase the difficulty of playing the game . each of the player ends 30 and 32 are provided with transversely extending goal areas 42 located adjacent to each of the player ends 30 and 32 . a pair of transversely extending rectangularly shaped recesses 44 are formed in the game board 28 and are located slightly inwardly of the respective goal areas 44 and which extend between the two longitudinal walls 14 for reasons which will presently more fully appear . in this case , each of the transversely extending recesses 44 are connected to the associated goal areas 42 through a horizontal shoulder surface 50 where the transverse ends of the playing board 28 merge into the recesses 44 . however , each of the shoulder surfaces 50 are located in a plane somewhat below the upper surface of the playing surface . moreover , each of the goal areas 42 are provided with goal pockets , or so - called &# 34 ; goal recesses ,&# 34 ; 52 , which are defined by a transversely extending , vertically disposed goal wall 54 connected to the shoulder surface 50 and merging into a bottom wall 56 . the functions of each of the goal pockets 52 and their positional relationship are defined in more detail hereinafter . located within each of the recesses 44 are transversely shiftable player arms or support means 58 , in the manner as illustrated in fig2 and 3 . the player arms 58 , which are also referred to as an &# 34 ; actuating arm &# 34 ; or &# 34 ; support member &# 34 ; extend transversely through apertures formed within the vertical walls 14 , in the manner as illustrated in fig1 and 6 of the drawings . in this case , it can be observed that an individual player arm 58 is located at each player end 30 and 32 . the player arms 58 have upper surfaces 60 which are substantially contiguous with the playing surface 34 of the game board 28 and above the shoulder surfaces 50 . in this way , when the playing piece p is rolled across the game board 28 , it will move across the upper surface 60 of each of the player arms 58 and across the relatively short shoulder surfaces 50 in the same manner as though the upper surfaces 60 constituted part of the playing surface 34 . moreover , each of the upper surfaces 60 on the player arms 58 connects to the shoulder surfaces 50 which terminate toward a player end at each of the goal pockets 52 , such that the playing piece p which moves over the playing surface 34 and the upper surface 60 of the player arm 58 may be deposited in any one of the goal pockets 52 at either of the player ends . while the upper surfaces 60 and shoulder surfaces 50 are relatively flat , they are relatively thin in the transverse dimension so that they do not impair the movement of a playing piece p into the goal cups 52 . however , it should be recognized that the upper surfaces 60 could be arcuately shaped with a radius conforming to the player surface 34 so as to be arcuately contiguous therewith . in addition , the recesses 44 could actually form part of the goal areas if desired , thereby eliminating the shoulder surfaces 50 . in this case , a playing piece passing over the upper surfaces 60 of the arms 58 would be introduced directly into one of the goal cups 52 . each of the actuating arms 58 carry a pair of movable striker elements in the form of rotatable flippers 62 and 64 which are rotatably movable from a rearward , or unactuated , position , as illustrated by the phantom lines in fig6 to a forward , or actuated , position , illustrated by the solid lines in fig6 . the exact angle of movement from the rearward to the forward position of each of the flippers 62 and 64 is dependent upon their overall length and the overall length of the player arms 58 . however , typically , the flippers 62 and 64 will flip through about a 60 ° to about a 90 ° arc . each of the flippers 62 and 64 may be actuated by manually operable push - button actuators 66 and 68 , respectively , on each of the transverse ends of the player arms or support members 58 . thus , when the push - button actuator 66 or the actuator 68 is pushed inwardly with respect to the support rod 58 , the associated flipper 62 or 64 will shift from the unactuated to the actuated position by means of an actuating mechanism hereinafter described in more detail . in accordance with the present construction , each of the flippers 62 and 64 are independently operable , although they could be constructed to be operable simultaneously , if desired , by pushing one of the push - button actuators 66 or 68 . in accordance with the rules of play of the game apparatus , when the playing piece p is projected toward one player end , the player will shift the player rod 58 from side to side and will also actuate the push - button actuators 66 or 68 associated therewith . when pushing the push - button actuator 66 , the flipper 62 will be propelled forwardly and when actuating the push - button actuator 68 , the flipper 64 will be pushed forwardly to the actuated position . the player will attempt to align the particular flipper with respect to the playing piece p in order to propel this playing piece toward the opponent player &# 39 ; s goal area . fig4 illustrates one form of playing piece p in the form of a round ball which may be either a hollow ball or a solid ball , or any form of spherical object . in this respect , it should be observed that the particular playing piece could adopt the form associated with a particular playing sport . however , a round ball is preferred on a relatively solid playing surface due to the lower frictional effects and due to the fact that a round ball can roll across the playing surface as opposed to sliding across the playing surface . the actuating mechanism which permits actuation of the flippers 62 and 64 is more fully illustrated in fig5 of the drawings . only one such actuating mechanism is illustrated in connection with the flipper 62 , although each of the other such actuating mechanism operate in like manner . the flipper 62 is located on the upper surface 60 of the support member 58 , and is pivotally retained thereon by means of a pivot pin 70 . the support member 58 is hollow providing a central interior chamber 72 and located within the chamber 72 is a link 74 which is also mounted on the pivot pin 70 and pivotal with the flipper 62 . the link 74 is connected through a relatively rigid rod or guy wire 76 to a connecting rod 78 which is attached to the push - button actuator 66 . in this case , it can be observed that the rod 78 extends into the central chamber 72 of the arm 58 and is biased outwardly by means of a compression spring 80 which bears against the inner surface of a limit plate 81 on the actuator 66 and also against a retaining plate 82 extending across the chamber 72 of the arm 58 . it can be observed that when the push - button actuator 66 is in its outermost position , or unactuated position , the flipper 62 will assume its unactuated position , as illustrated in the dotted lines of fig7 and the solid lines of fig6 . however , when the push - button actuator 66 is urged inwardly , the link 74 will shift in a clockwise direction and urge the pivot pin 70 , and the flipper 62 carried therewith , to the actuated position as illustrated in the solid lines of fig6 and the dotted lines of fig7 . in addition , it can also be observed that when manual pressure on the push - button actuator 66 is released , the compression spring 80 which has now been compressed will bias the pushbutton actuator 66 outwardly and will also return the link 74 to its position as illustrated in the solid lines of fig5 and will also return the flipper 66 to its unactuated position , as also illustrated in the solid lines of fig7 . referring now to fig6 - 8 , it can be understood how the arm 58 and the flippers thereon are shiftable in relationship to the playing board 34 . by further reference to fig6 it can be observed that when the arm 58 is in its normal position , that is the position when each of the outwardly extending ends are approximately the same distance from the longitudinal walls 14 , that a first playing piece passageway s 1 is created between each of the two flippers 62 and 64 on the arm 58 . moreover , it can be observed that the rebound pads 22 extend inwardly sufficiently to create a second playing piece passageway s 2 between the flipper 62 and the pad 22 . finally , a third playing piece passageway s 3 is created between the opposed flipper 64 and the upper pad 22 . in this case , it can be observed that when the flipper arms are flipped from the unactuated position to the actuated position , or otherwise remain in the unactuated position , the passageway s 1 is sufficient to permit the playing piece p to pass therethrough into any one of the goal cups 52 . in addition , the playing piece p can also pass through the passageways s 2 or s 3 . in order to more the support arms 58 , the players will grasp or engage the two transverse outer ends of the arms , one end with each hand , and in this way the shiftable arms 58 are moved generally with both hands of the players . the transverse movement will normally occur in an attempt to align one of the flippers with the trajectory of an approaching playing piece . each player will also generally contemporaneously actuate the actuator button 16 on one or both of the outer transverse ends of his support arm 58 to actuate the associated flipper . referring to fig7 it can be observed that when the arm 58 is shifted toward one position where the flippers 62 are located nearest one of the end walls 14 , the passageway s 2 has been eliminated for passage of the playing piece p . however , the passageway s 3 is substantially wider and , in addition , the passage s 1 still exists . by examining fig7 it can be observed that when the arm 58 is shifted in the opposite direction so that the flipper 64 is located nearest one of the longitudinal walls 14 , the passage s 3 is eliminated . however , the passageway s 2 is substantially wide and , here again , the passageway s 1 exists . in order to play the game of the present invention , the playing piece is first deposited on the playing surface 34 . one of the players at one of the playing ends 30 or 32 will attempt to shift the arm 58 in order to locate a flipper 62 or 64 in alignment with the playing piece p . when so aligned , the player will actuate the push - button actuator 66 or 68 in order to propel the playing piece p to the opposite player end . the player at the opposite player end will thereupon shift the arm 58 to the proper position so that one of the flippers 62 or 64 is located in alignment with the trajectory of the playing piece p . this latter player will also actuate one of the push - button actuators 66 or 68 in order to operate the associated flipper 62 or 64 , and thereby propel the playing piece back to the first player &# 39 ; s goal area . in accordance with the present invention , it can be observed that due to the inclined nature of the playing surface 34 toward each of the goal areas , that the playing piece will always move toward one or the other of the goal areas . consequently , it is encumbent upon the player to shift the arm 58 and actuate the flipper 62 or 64 in order to repel the playing piece p , or otherwise the playing piece p would likely fall within one of the goal cups 52 . it can be observed , in this respect , that the game of the present invention can be operated in a relatively quick manner and not only requires skill , but requires quick and keen action on the part of each of the players . moreover , the players must carefully locate the particular arm 58 and properly actuate the flippers 62 or 64 in a time - related manner to the movement of the playing piece p in order to repel this playing piece so that it is moved in through one of the passageways s 1 or s 2 or s 3 into the goal cups 52 . if one of the players propels the playing piece p in a trajectory which does not align with the opposing game area , it may carrom , i . e . abut against the opposite rebound surface 24 and be propelled back into the player &# 39 ; s own goal area . consequently , each player must operate the player arm 58 and the flippers 62 and 64 in such manner so that the playing piece p does not engage the bumper pads 22 for rebound toward its own goal area . in order to control the transverse shiftable movement of the player arms 58 , enlarged abutment flanges 84 are located on the arms 58 outwardly of each of the longitudinal walls . if desired , these abutment flanges 84 , which serve as stops shiftable on the arm 58 to serve as an adjustable control . in addition , it should be understood that the flippers 62 and 64 could be located with their pivot points close to the bumper pads 22 so as to eliminate a passageway therebetween . in this latter construction , the flipper arms 58 would probably have a longer length . moreover , it should also be observed that the flippers 62 and 64 could be substituted by other forms of striker elements , as for example , longitudinally movable paddles or the like , and which striker elements would also be actuated by the actuators 66 or 68 . in the case of the present invention , each of the goal cups 52 may be assigned a particular value , depending upon the degree of skill required to deposit the playing piece p into that particular goal cup . in the particular embodiment , as illustrated , the opposite end goal cups achieve the highest number of scored points when the playing piece is deposited in such goal cups . the next two outermost goal cups receive the next highest number of paints , and the center goal receives the lowest number of points . it can be observed that greater skill , and hence greater difficulty , is inherent in achieving a goal in the outermost goal cups , and the easiest score is obtained in shifting the playing piece into the center goal cup . nevertheless , it should be understood that the game could be designed with respect to the relationship of the flippers on the support arms so that the goal cups could be assigned different score values . thus , there has been illustrated and described a unique and novel playing game which fulfills all of the objects and advantages sought therefor . it should be understood that many changes and modifications and other uses and applications will become apparent to those skilled in the art after considering this specification and the accompanying drawings . therefore , any and all such changes , modifications and other uses and applications which do not depart from the spirit and scope of the invention are deemed to be covered by the invention which is limited only by the following claims .

a competitive action game apparatus including a game board having a playing surface thereon . the playing surface has a high section intermediate each of a pair of opposed player ends and extends downwardly toward each of such player ends . a goal area is located at each of the opposed player ends . a rebound frame surrounds the playing surface except at the goal areas to retain a playing piece in the form of a ball on the surface . the playing surface is generally solid and continuous and uninterrupted between each of the goal areas . manually shiftable support members are located in front of each of the goal areas and are capable of being shifted transversely in a direction substantially perpendicular to a line extending between the opposed playing ends . a pair of actuable striker elements , which may adopt the form of flippers , are disposed on each of the support members , and are manually actuated by means on the support members . each player can shift his support member from side to side and can also actuate his flippers to strike the playing piece so as to protect his own goal while attempting to propel the ball into his opponent &# 39 ; s goal . the double incline of the playing surface insures that the ball will not stall at an intermediate portion of the playing surface , but will always move down one or the other of the inclines toward a player area where it can be engaged by a striker element . this arrangement permits the use of striker elements which have limited movement such that portions of the playing surface are not within the reach of any of the striker elements .

in each of fig8 to 10 , those portions of the enclosure which lie behind the plane of the section have been omitted for clarity . as shown in fig1 a chest enclosure according to the first aspect of the invention includes a base member in the form of a base plate 10 which is generally rectangular in shape and approximately one third of the way along its length has a transverse row of eight threaded through holes 12 arranged in two groups of four , each group lying adjacent to and extending in from one long edge of the plate 10 . a pair of support members in the form of columns 14 are screwed into respective ones of the holes 12 by means of threaded studs 16 ( fig2 ). each column is circular in cross - section and comprises a first lower plain portion 18 carrying the stud 16 and an upper toothed portion 20 comprising about fifteen frustoconical regions 22 each having an upwardly facing sloping face 24 and a downwardly facing annular face 26 lying parallel to the base plate 10 . the columns are preferably made of a tough fairly stiff but resilient plastics material . the shell 40 shown in fig3 may be generally conventional except for the provision of a pair of outwardly facing mounting brackets 28 positioned one on each side of the shell toward the top of the shell . alternatively , the shell can be provided with suitable sealing members such that it is in accordance with the second and third aspects of the invention . as shown in fig4 and 5 , each mounting bracket defines a vertically extending u - shaped channel 30 having a wedge - shaped dog 32 extending out from the base of the channel and providing a horizontal upper semi - circular surface 34 and a downwardly facing sloping rectangular face 36 . below the level of the dog 32 , the shape of channel 30 changes to being rectangular rather than u - shaped . the manner of use of the enclosure described is as follows . with a patient fitted with the shell and lying on a bed , one of the two columns 14 is unscrewed from the base plate 10 and the base plate is pushed underneath the patient so that the other column 14 lies by the patient &# 39 ; s side . the first column 14 is then refitted to the base plate on the other side of the patient . the spacing of the columns 14 is selected such that they press against the mounting brackets 28 and the dog of each mounting bracket locates under one of the annular faces 26 of the frustoconical regions 22 on each column . when vacuum is applied to the air passageways of the shell , external air pressure will tend to push the top of the shell down on to the patient &# 39 ; s chest with consequent bowing out of the side of the shell . this will be prevented by the engagement of the mounting brackets 28 with the columns 14 . an alternative manner of use is to first fit the shell 10 pushing the mounting brackets down ratchet - wise between the columns 14 until the patient is lying on the base plate 10 . the columns of the base plate are easily removed if it is necessary to move the patient . alternatively , the mounting brackets can be released simply by pulling apart the tops of the columns 14 . if desired , the mounting brackets and the formations on the columns 14 may be made such that it is necessary to press the mounting brackets down slightly before they can be released from the columns 14 . for instance , an upstanding lug may be formed on the upper surface 34 of the dog 32 and a downwardly facing co - operating lug may be formed on each annular face 26 of the column 14 . the shell illustrated in fig3 to 7 constitutes a chest enclosure according to the second , third and fourth aspects of the invention . shell 40 is of springy plastics material having a front edge 42 a side edge 44 and rear edge 46 . it comprises a pair of air passageways 48 for connection to a suitable air oscillator , one passageway being provided on each side of the mid line of the shell . with reference also to parts of fig8 - 10 there is a thick sealing bead 50 of closed cell resilient foam which extends around the internal face of the shell around the front , side and rear edges in a continuous strip . the sealing bead 50 is of generally rectangular cross - section having a rounded nose portion 52 . in accordance with the second aspect of the invention , a sealing flap 54 of closed cell foam similar to that used for the sealing bead 50 extends from the sealing bead 50 . flap 54 is of 5 mm thick foam strip about 2 cm wide . more generally , such a flap is suitably from 3 to 10 mm in thickness , and from 1 . 5 to 4 cm in width , larger figures within these ranges being more appropriate for larger shells . it is attached by one edge face to the outer root portion of the face of the nose portion 52 of the bead 50 , e . g . by adhesive , although of course it could be made integral with the bead 50 . the flap 54 extends generally at an angle with respect to a perpendicular to the edge of the shell of from about 0 ° to 10 ° outwards in the vicinity of the side of the shell to about 0 ° to 20 ° inwards in the region of the front of the shell and about 0 ° to 10 ° outwards in the region of the rear of the shell . however , when the shell is placed over a patient , the free edge of the flap can be teased outwards to lie on the body of the patient outside of the shell or at least directed towards the outside of the shell so that atmospheric pressure tends to press the flap more tightly against the patient &# 39 ; s body . in accordance with the third aspect of the invention , a second sealing flap 56 extends inwardly from the bead 50 . this is attached to the bead 50 along the nose portion thereof spaced inwardly from the flap 54 by approximately 15 mm . its dimensions are similar to those of the flap 54 but it is directed toward the interior of the shell so that in use it lies on the body of a patient within the shell and is pressed more tightly against the patient &# 39 ; s body in response to super atmospheric pressure in the shell . it extends from the bead 50 at an angle to the adjacent part of the shell of about 5 ° to 20 ° in the region of the sides ( fig8 ) and front ( fig9 ) of the shell and about 20 ° to 60 ° in the region of the back ( fig1 ) of the shell . the angle included between the two sealing flaps is about 45 ° at the back of the shell about 70 ° to 90 ° along the sides of the shell and about 60 ° along the front of the shell . the entire sealing structure of bead 50 and flaps 54 and 56 can be made as an integrated whole or assembled from separate constituents . in use , the enclosure may be fitted to a patient by springing apart the sides of the shell and passing the sides of the enclosure over the patient &# 39 ; s chest and releasing them so that the sealing flaps 54 and 56 seal on the patient &# 39 ; s body . in the region of the sides of the shell , the flaps , particularly the flap 50 , seals against the patient &# 39 ; s back so that movement of the patient &# 39 ; s ribs is not restricted . the shell may be fitted with mounting brackets so as to bring the enclosure within the first aspect of the invention . such mounting brackets may be as illustrated or may for instance take the form of collars with an adjustment screw passing through the wall of each collar . such collars can be fitted over support columns and held in position by tightening of the screws . the shell may be fitted with straps to enable it to be strapped on to a patient . it may be necessary to employ such straps if the patient has a chest region of abnormal shape or if the patient is to be moved wearing the enclosure but the seal provided by the sealing flaps 54 and 56 should under normal circumstances be sufficient to enable the enclosure to be used even before such straps are fitted . in accordance with the first and fourth aspects of the invention , a backing means in the form of a pad 58 is provided which is a generally rectangular shaped envelope comprising an upper layer 60 and a lower layer 62 . the layer 60 and layer 62 are attached around their edges so as form the envelope with interior space 64 . the space 64 contains sand . the pad 58 corresponds generally in shape to a rectangle of a size which is defined by the sides 44 , the front 42 and rear 46 edges of the shell 40 . side portions 66 of the pad 58 are turned upwards so that portions of the upper layer 60 can be brought into contact with the outside lower edges of the shell 40 . the side portions 66 of pad 58 are attached to the shell 40 by hook and loop fabric strips 68 . the pad 58 has an access tube 70 which connects the space 64 with the surrounding atmosphere . the tube 70 includes a two - way valve 72 . a layer of foam rubber 74 is attached to upper layer 62 of the pad 58 in order to insulate and provide the patient with a degree of comfort . in use the pad 58 is spread out flat on a surface . the patient is laid face up on the pad 58 and the shell 40 is placed over the patient &# 39 ; s chest . the weight of the patient deforms the pad 58 so that it forms an impression of the contours of the patient &# 39 ; s back . the shell 40 is then attached to the upturned portions 66 of the pad 58 by way of the strips 68 . a vacuum pump ( not shown ) is connected to pipe 70 and switched on . tap 72 is opened in order to allow air to be drawn out of the space 64 . as the air is drawn out the pad 58 the particles are compressed together so that the pad &# 34 ; hardens &# 34 ; and fixes the impression of the patient &# 39 ; s back therein . what results is a hard lower surface 62 and a softer upper surface 60 . the shell 40 and the pad 58 both seal against the patient &# 39 ; s body in a substantially air - tight manner so as to completely encase the patient &# 39 ; s chest and associated back region . the stiffening of the pad 58 causes the upturned side portion connected to the shell 40 to act as support members against any movement of sides of the shell caused by pressure changes inside the shell . the hardened pad 58 therefore provides a relatively rigid support for the shell 40 and assists in the sealing of the shell 40 to the patient whilst maintaining a degree of comfort to the patient . the pad 58 is made from rubber or a flexible plastics material . the space 64 inside the pad 58 can be filled with sand or small particles or beads of plastics material , glass or metal . many modifications and variations of the embodiments of the invention described above are possible within the scope of the invention .

a chest covering shell of springy material for fitting over a patient &# 39 ; s chest is coupled to an air oscillator . changes in air pressure in the shell cause ventilation of the patient . a back plate can be used which has vertically extending supports for engagement with the sides of the shell so as to support them and prevent their flexing during use . the edge of the shell has a seal . the seal can include an inwardly directed flap in order to provide an effective seal when positive pressures are applied under the shell . a backing pad comprising an evacuatable envelope containing solid particles can be used which is able to support the shell and seal against the patient . the pad can be deformed by the weight of the patient and can be evacuated via air outlet to stiffen the envelope by compression of the particle .

[ 0024 ] fig1 shows an orthopedic brace for supporting a joint having a plurality of complaint support components . the knee brace 100 of the present invention includes a hinged shell 105 and a plurality of adjustable support straps 110 engaging the brace at two points on opposite sides of the hinge to stabilize the weakened joint throughout its range of motion . the shell 105 has an upper portion 115 conformable to the thigh and a lower portion 120 conformable to the lower leg . each of the shell portions 115 , 120 is preferably formed from a single continuous shaped piece of a stiff material such as certain plastics , fiberglass , composites , certain metals , and the like , as are known to those of skill in the art . the upper portion 115 includes a cuff 125 , having a lateral arm 130 and a medial arm 135 . the cuff 125 has a preformed arcuate shape sized to snugly conformingly engage the anterior portion of the thigh . the lower portion 120 includes a cuff 140 , having a lateral arm 145 and a medial arm 150 extending therefrom . the lower portion 120 has substantially the same structure as the upper portion , but is sized to conform to the lower leg of the user . the lower cuff 140 has substantially the same configuration as the upper cuff 125 , but the preformed arcuate shape thereof is sized somewhat smaller to snugly conformingly engage the calf of the lower leg . the upper and lower portions 115 , 120 are connected across rotatable hinges 155 , 160 . more specifically , lateral upper arm 130 is pivotally connected to lateral lower arm 145 and medial upper arm 135 is pivotally connected to medial lower arm 150 across lateral hinge 155 and medial hinge 160 , respectively . a resilient pad 180 may also be provided to cushion the knee joint from the rigid hinges 155 , 160 . ( for simplicity , a pad is only shown on the hinge 155 .) medial hinge 160 also preferably includes a hinge deflector 165 for preventing interference between medial hinges when a user is wearing a knee brace on each leg . the hinge deflector 165 acts as a shield to the internal components of the medial hinge 160 and deflects the opposite medial hinge , preventing the hinges from locking together . the support straps 110 are preferably adjustable in length , enabling the user to modify the support strap tension , and consequently the degree of support the brace provides to the joint . support straps 110 are preferably formed from a wear - resistant supple material such as pliant leather , or natural or synthetic cloth , such as nylon and the like . the material should be compliant , but substantially unstretchable . support straps 110 enable closure of brace 100 around the limb on which the brace is mounted . as seen in fig1 each of the cuffs 125 , 140 is held in place by straps , and a strap connector . a separate strap is provided at the upper arms , surrounding the upper leg . a separate strap is provided at the lower arms , surrounding the lower leg . each strap is integrally provided with a tab and cap fastener assembly 175 at the ends thereof to fix the strap and enable adjustment to the length of the straps 110 for close conformance of the shell 105 to the limb on which the brace is mounted . referring to fig2 and 3 , an exploded medial hinge assembly 160 and hinge deflector 165 are shown . lateral hinge assembly 155 is also shown . it will be apparent to one of skill in the art that the hinge assembly 160 and an associated hinge deflector 165 can be incorporated into many other types of conventional hinged orthopedic braces without substantial modification . it is also appreciated that lateral hinge assembly 155 has the same features as medial hinge assembly 160 . although hinge deflector 165 is intended for use with medial hinge assembly 160 , it is appreciated that hinge deflector 165 may also be used with lateral hinge assembly 155 . the hinge assembly 155 , 160 comprises a hinge cover 205 , parallel plates 210 , 215 , an upper rotary connector 220 and a lower rotary connector 225 . washers 230 may also be provided between parallel plates 210 , 215 and connectors 220 , 225 . the cover 205 and plates 210 , 215 are formed from one or more high - strength , rigid materials , such as metals or plastics . upper and lower rotary connectors 220 , 225 are respectively formed integrally with the upper and lower cuff arms 130 , 135 and 145 , 150 . the connectors 220 , 225 have semi - circular ends that are pivotally anchored by rivets 235 and are provided with interlocking teeth 240 . this construction of the hinge assembly 155 , 160 enables rotatable engagement of the upper and lower rotary connectors 220 , 225 and correspondingly enables rotation of the upper and lower portions 115 , 120 relative to each other . the hinge deflector 165 is secured to the parallel plates 210 , 215 , and connectors 220 , 225 by rivets 235 , or other suitable fasteners , passing through apertures 245 . hinge cover 205 is secured to the parallel plates 210 , 215 and connectors 220 , 225 by screws 250 , or other suitable fasteners , passing through apertures 255 . a hinge extension stop 260 is preferably provided to interface with rotary connectors 220 , 225 at interlocking teeth 240 . extension stop 260 limits the range of motion of the rotary connectors 220 , 225 and , consequently , brace 100 . the hinge deflector 165 shown in detail in fig4 - 9 comprises a thin walled shell 400 which is configured to encase the hinge assembly . the shell 400 has a generally elliptical shape as viewed in fig4 and 5 . the shell has an outer or hinge side 415 which faces the hinge , encasing the hinge assembly , and facing away from the knee . the shell also has an inner side 420 which faces the knee , and thus may be referred to as the knee side . as seen in fig2 and 3 , the shell is actually positioned between the knee and the brace hinge , although shell portions extend to the outer side of the hinge . the shell outer side 415 includes an outer perimeter surface 422 surrounding a central recess 425 having a generally elliptical shape also . the plate 215 and washer 230 of the hinge assembly fit within the recess 425 . the bottom wall of the recess includes a plurality of apertures 430 for attaching the hinge assembly to the knee brace . two apertures 430 are shown , lying approximately on a longitudinal axis of the recess for attaching the hinge deflector to the knee brace with the fasteners or rivets 235 which pass through the components of the hinge assembly and the knee brace . two apertures 435 are also shown , lying on an axis generally perpendicular to the longitudinal axis , for securing the stops 260 to the plates 210 and 215 with the screws or fasteners 250 . the outer side 415 includes a projection 405 which extends along a majority of the length of one side of the elliptically - shaped shell 400 . this can be referred to as the forward side or edge in that it is the side closest to the forward portion of a person &# 39 ; s knee when the brace is in use . the projection includes a straight inner wall 405 a which protrudes from the recess 415 and the surrounding surface 422 , with a portion of that wall being flush with one side of the wall of the recess . the projection includes an outer surface 405 b which slopes toward a peripheral skirt 442 , and an outer edge 441 of the shell 400 , as seen in fig7 and 8 . while the central portion of the projection curves basically toward the edge 441 , as seen in fig7 the projection ends taper or curve to the surface 422 , as seen in fig4 and 6 . the outer side 415 also includes a projection 440 extending from surface 422 on the edge of the shell opposite from the projection 405 . that edge of the shell can be referred to as the rear edge since it is closest to the back of the knee when the brace is in use . as seen , the projection 440 is only in the central portion of that edge in that space is needed for the rotational movement of the hinge . the projection 440 limits this movement . the projection 440 also has a straight inner wall 440 a and an outer curved surface 410 , for deflecting external objects . the curve surfaces 405 and 410 curve inward toward the knee brace and hinge assembly when assembled , for deflecting an interfering external object . the curved surfaces 405 and 410 have approximately the same slope ; however , different slopes may be employed and the curved surface 405 preferably extends further than the curved surface 410 . the outer skirt 442 of the outer side 415 is also slightly tapered , so that there are no edges for interfering with the hinge . as seen , both projections extend above the surface 422 about the same amount to perform their deflector function . the shell inner side 420 preferably includes a plurality of ribs 445 for providing additional strength to the hinge deflector . in a preferred embodiment , hinge deflector 165 is a molded plastic material . however , any material having sufficient rigidity to withstand impact forces encountered during impact of hinge assemblies during physical activities are contemplated herein . resilient pad similar to the pad 180 shown on hinge 155 in fig1 is preferably releasably fastened to the shell inner side 420 by conventional releasable fastening means such as a hook and hoop fastener coupling , commonly referred to as velcro , wherein one element of the coupling is substantially permanently affixed to the inner side 420 and the other element of the coupling is substantially permanently affixed to resilient pad 180 . the resilient pad may be any knee brace pad , as known to those of skill in the art . referring to fig2 and 3 as well as the description of the deflector shell , it may be seen that the deflector is positioned on the knee or inner side of the knee brace hinge . the plate 210 and washer 230 fit into the recess in the hinge side of the shell . the hinge side is next placed against the rotary hinge connectors 220 and 225 , with the connectors fitting between the projections 405 and 440 . a washer 230 and the plate 215 covered by the hinge cover 205 are next positioned adjacent the connectors and between the projections 405 and 440 . the upper edges of the projections are about flush with the outer surface of the hinge cover 205 so that interference of that cover with adjacent objects is deflected by the curved surfaces 405 b and 410 . thus , it can be seen that an entire hinge assembly is substantially encased by the deflector shell . the hinge deflector prevents locking and / or interference of a medial hinge with a medial hinge of another knee brace or , alternatively , prevents locking with other external devices , such as components of a motocross bike . the hinge deflector 165 encases the hinge and deflects the external object with curved surfaces 405 , 410 . the curved surfaces 405 , 410 of the hinge deflector 165 prevent the locking because the external object slides along and off the curved surfaces 405 , 410 . the protruding curved surfaces 405 , 410 extend out and over knee brace and hinge assembly to deflect any surfaces or objects that may interfere with knee brace function . although the present invention has been described in terms of certain preferred embodiments , other embodiments of the invention including variations in dimensions , configuration and materials will be apparent to those of skill in the art in view of the disclosure herein . in addition , all features discussed in connection with any one embodiment herein can be readily adapted for use in other embodiments herein . the use of different terms or reference numerals for similar features in different embodiments does not imply differences other than those which may be expressly set forth . accordingly , the present invention is intended to be described solely by reference to the appended claims , and not limited to the preferred embodiments disclosed herein .

a knee brace hinge deflector is provided for preventing interference and / or locking of the medial hinges of bilateral knee braces . the hinge deflector includes a shell having rounded surfaces for encasing a first medial hinge assembly and deflecting a second medial hinge assembly of bilaterally worn knee braces .

the present invention relates to a novel plant based ayurveda formulation and the process thereof for the prevention and management of coronary heart disease ( chd ) particularly atherosclerosis . the preparation of present invention may be advantageous if used for the prevention and management of chd risk factors like dyslipidemia , hypertension ( atherosclerosis ), obesity , hyper - homocysteinemia , diabetes mellitus etc . among the adult people . the beneficial effect of test formulation in diagnosed cases of chd can be assessed on different fractions of lipids particularly oxidized ldl - c , hdl - c including triglycerides , inflammatory markers il - 6 , tnf - α , resistin and crp , adipokine , leptin and adiponectin , elevated homocysteine and also on some of the electrophysiological and psychological assessments . the hydro - methanolic extract of four ayurveda plants i . e . withania somnifera , costus speciosus , terminalia arjuna and hippophae rhamnoides by using 30 : 70 ratio of water and methanol respectively is utilized for the development of present novel formulation by conducting various experimental and clinical studies . the water utilized for extraction was decontaminated for any type of bacterial or abnormal growth by using reverse osmosis plant . after extraction the presence of active molecules in various plant extracts were identified by hplc , hptlc and nmr procedures . the biological activity was studied on the basis of mode of action of single plant selected for preparation of combined formulation as well as combined formulation by assessing their role on various targets involved with chd risk factors as well as already manifested chd . the bio - molecular reaction following the interaction between the chemical and biological markers like abnormal lipids i . e . ldl - c , hdl - c , lipoprotein ( a ) and apolipo ( b ), triglycerides , homocysteine , adiponectin , leptin , inflammatory cytokines including resistin and also the neuropsychological assessments were evaluated . the pre - clinical toxicological studies of single as well as combined formulation were carried out to determine safety profile of present novel test formulation . the efficacy profile of test formulation were done in pre - clinical animal model of high cholesterol diet induced dyslipidemia , cafeteria diet induced obesity , altered inflammatory markers particularly crp and resistin etc . the mode of action of single plant candidate and combined formulation was determined in animal studies . the beneficial role of present test formulation on abnormal lipids including lipoprotein ( a ) and apolipo ( b ), inflammatory biomarkers , adipocytes and plasma homocysteine concentrations were determined in various animal models before utilizing the drug for human use . the dried root of withania somnifera , rhizome of costus speciosus , bark of terminalia arjuna and fruits of hippophae rhamnoides , were utilized for extraction . the hydro - methanolic extract of the plants were utilized for the identification of active compound present in the plants . after extraction , the extracted parts were taken for chromatographic hplc , and hptlc . after identification and separation of active compound , the molecular separation by using tlc , characterization was carried out by using ir and nmr . the extraction was done at the temperature of 60 - 80 ° c . the ph of the solution was maintained between 7 - 10 . the steps carried out to isolate the active compound to assess the activity of test formulation are shown in fig1 . according to this invention , there is provided an ayurveda formulation for the prevention and management of coronary heart disease by modifying the chd risk factors . the present test formulation comprising of the following ingredients : name of the plants parts used 1 . withania somnifera ( ashwagandha ) root 2 . costus speciosus ( kebuk ) rhizome 3 . terminalia arjuna ( arjuna ) bark 4 . hippophae rhamnoides ( amlavetas ) fruits the formulation also comprise known additive such as minerals , vitamins , salts filler ( for capsulation or to prepare syrup ) and binders , if required to present in trace amount . thus any known additive or supplement is added to prepare the final formulation as required and present in trace amount . reference is made here in capsule form ( 500 mg each ). however , it would be apparent that the preparation may also be prepared in the form of syrup / tablet . preferably but without implying any limitation the preparation comprises — name of the plant dose 1 . withania somnifera 250 mg / day 2 . costus speciosus 200 mg / day 3 . terminalia arjuna 275 mg / day 4 . hippophae rhamnoides 225 mg / day the present plant based ayurveda formulation is prepared out of four plant extract namely withania somnifera , costus speciosus , terminalia arjuna and hippophae rhamnoides . this formulation has been proven for its hypo - lipidemia , anti - atherosclerotic , anti - inflammatory , adiponectin enhancing homocysteine reducing and anti - anxiety activity among patients of chd as well as individuals with positive evidence of chd risk factors responsible for future development of chd . since coronary heart disease has a multi - factorial etiology it requires various drugs to manage the complex nature of disease . therefore it was thought to validate a poly herbal formulation containing active compounds that acted on multi - targets involved in chd . the association between cardiovascular disease , lipid metabolism , obesity and adipokine signaling is of complex nature . a number of reference are available showing role of adipose tissue of an endocrine organ and secretion of adipokines i . e . leptin , adiponectin , resistin , ghrelin , visfatin that act on non - adipose tissues such as heart , diverse cellular and whole body function . these effects are mediated an increase in adiponectin and reduction in resistin level as low adiponectin and high resistin is associated with an increase in the risk of mortality due to chd , and increase in adiponectin has been suggested to produce its protective effect via activation of cyclo - oxygenase - 2 ( cox - 2 ) in cardiac myocytes , as inhibition of these enzyme resulted in the cardioprotective effects . adiponectin also exerts anti - ischemic effects by increasing endothelial nitric oxide . further , reduction in leptin reduces blood pressure through interaction with nitric oxide pathway . it is hypothesized that present novel test formulation acts through stimulation of endothelial nitric oxide by amp activated protein kinase ( ampk ) dependent mechanism as these have a favourable impact on micro - vascular functions . the therapeutic intervention targets steps of atherosclerotic inflammation . therapies include cytokine inhibitors , blockade of platelet derived growth factor ( pdgf ), cholesterol acetyl - transferase inhibition , anti - oxidant , anti - inflammatory agents and lipid lowering drugs . cytokine inhibitors are anti - tnf - α antibodies . inhibition of cytokine - stimulated pdgf , prevents accumulation of smooth muscle cells in atherosclerotic lesions and protection from plaque growth . the ingredients combined in the test formulation have shown great potential in inhibiting platelet aggregation . it is proposed on the basis of results that perhaps the test drug reduced the formation of thromboxane , inhibited the phospholipase activity and lipoxygenase products formed in platelet . elevated levels of endothelin ( et ) have been detected in patients with myocardial infarction . the test drug has shown blood pressure lowering effects due to decrease in peripheral vascular resistance . test formulation modulates the production and function of both endothelium derived relaxation and constricting factors which causes protection against vasoconstriction . thus , the test drug has vasodilatory activity as it inhibited endothelin to a great extent . hypercholesterolemia promotes endothelial dysfunction in the absence of atherosclerotic lesions . endothelial dysfunction results in a decrease in nitric oxide bioavailability . endothelial dysfunction can also direct formation of atherosclerotic lesions . the effect of present test formulation has been attributed to its capacity to reduce lipid content in arterial wall . the possible mechanism of test drug is that it causes direct anti - atherogenic and anti - atherosclerotic effects at the level of arterial wall . it depressed the hepatic activity of lipogenic and cholestrogenic enzyme like malic enzyme , fatty acid synthase and 3 - hydroxy - 3 methyl - glutaryl - coa reductase . keeping the above facts in view and beneficial role of plants included in the present test formulation that acted on multiple targets involved in coronary heart disease and various chd risk factors , determined in various pre - clinical models , it was thought to propose a safer remedial measure for the prevention and management of coronary risk factors involved with the onset of chd so that morbidity and mortality due to chd can be prevented / minimized . withania somnifera : the plant belongs to family solanaceae , and is one of the ingredients of present test formulation . it has shown anti - stress , adoptogenic and hypotensive properties and is beneficial in the regulation of altered neurotransmitters through its active compound with anoloids , somniferine and withanine . one of the recent studies has indicated that withania somnifera reconstruct the neuritic damage and also improves synaptic plasticity in the brain . costus speciosus : it belongs to family costaceae ( zingiberaceae ). it is also known as keu , kusth . it is a succulent perennial herb growing up to 2 . 7 m . high . it is found through out the county in moist tropical forest . the rhizome contains tigogenin and diosgenin ( 2 . 6 % diosgenin ), α - amyrin , stearate , β - amyrin and lupeol palmitates from leaves have been isolated . diosgenin and the mixture of five saponins obtained from the rhizome showed estrogenic effects in rats . the saponin mixture showed anti - inflammatory and anti - arthritic effects . the mixture of four alkaloids isolated from rhizome exhibited cardiotonic , diuretic and cns depresent activities . the costus speciosus root extract possess anti - hyperlipidemic , anti - hyperglycemic and anti - oxidative effects . terminalia arjuna : it belongs to combretaceae family & amp ; commonly known as arjuna . it is a deciduous tree found through out india , growing to height of 60 - 90 feet . the active constituents of terminalia arjuna include tannins , triterpenoid saponins : arjunic acid , arjunolic acid , oleanolic acid , arjungenin , arjunin , flavonoids : arjunolone , arjunone , leuteolin , steroids : b - sitosterol and inorganic compounds . in ayurveda terminalia arujna has been prescribed as cardio protective drug indicating its anti - atherosclerotic property . several experimental and clinical evidence have proven the anti - atherosclerotic property of terminalia arjuna . it is beneficial in the treatment of coronary artery disease , hypercholesterolemia dyslipidaemia including hypertriglyceridemia and anti - coagulant activity . hippophae rhamnoides : this is high altitude plant belongs to family elaeagnaceae . fruits and leaves have shown medicinal property . hippophae rhamnoides is a rich source of flavonoids , vitamins , proteins , amino acids , folic acid , phytosterol , alpha - tocopherol and phenolic compounds . it has shown anti - oxidant , immuno - modulatory , anti - inflammatory and homocysteine lowering effects and uplifts the mental function . in experimental animal studies when the hydro - methanolic extract of terminalia arjuna in the dose of 100 mg / kg / day and costus speciosus in the dose of 75 mg / kg / day was administered to high cholesterol diet induced hypercholesterolemic rats for one month a significant reduction in total cholesterol , ldl - c with a moderate increase in hdl - c level was noticed which indicates anti - atherosclerotic and hypolipidemic potential of test drug . a decrease in tnf - α , il - 6 and crp indicated the anti - inflammatory activity of the drug . when the hydro - methanolic extract of withania somnifera in the dose of 80 mg / kg / day and hippophae rhamnoides in the dose of 75 mg / kg / day and terminalia arjuna in the dose of 75 mg / kg / day was mixed and given to obese rats a significant decrease in blood glucose level and triglycerides were measured following 30 days treatment . in clinical studies when the hydro - methanolic extract of terminalia arjuna in the dose of 350 mg / day and costus speciosus in the dose of 250 mg / day given to human subjects showing evidence of dyslipidemia , a decrease in total cholesterol , ldl - c and triglycerides were noticed . hdl - c level increased moderately in those cases indicating the hypo - lipidemic and cardio - protective activity of test drug . when the hydro - methanolic extract of costus speciosus in the dose of 275 mg / day and terminalia arjuna in the dose of 350 mg / day was orally given to cases showing triglycerides 200 mg / dl and above , a marked decrease in the level was noticed , hs crp level also decreased to a significant level in this group of study . when the hydro - methanolic extract of withania somnifera in the dose of 325 mg / day , hippophae rhamnoides in the dose of 300 mg / day and costus speciosus in the dose of 250 mg / day mixed and given to cases showing high blood pressure a decreased in both systolic and diastolic blood pressure indicated the anti - hypertensive and anti - atherogenic effects of the drug . further , the leptin level also decreased following treatment , which also supported the regulation of blood pressure . when the hydro - methanolic extract of hippophae rhamnoides in the dose of 250 mg / day , costus speciosus in the dose of 325 mg / day and terminalia arjuna in the dose of 225 mg / day mixed and given to chd cases showing high level of inflammatory cytokines il - 6 and tnf - α a decrease in the level suggested the anti - inflammatory activity of the drug . further , retard in hs crp and resistin also confirmed the improved endothelial inflammation in those subjects . when the hydro - methanolic extract of costus speciosus in the dose of 325 mg / day and withania somnifera in the dose of 350 mg / day mixed and given to chd cases showing , low adiponectin and high leptin an increase in adiponectin and decrease in leptin level indicated the anti - atherogenic activity of test formulation . body mass index also reduced following treatment with test formulation . when the hydro - methanolic extract of hippophae rhamnoides in the dose of 325 mg / day and withania somnifera in the dose of 325 mg / day was mixed and orally administered to cases suffering from chd and showing elevated level of homocysteine , decrease in the homocysteine level indicated the anti - atherosclerotic effects resulting in reduced risk of onset of chd as well as precipitation of chd complications . when the hydro - methanolic extract of withania somnifera in the dose of 375 mg / day and hippophae rhamnoides in the dose of 275 mg / day mixed and given to cases suffering from chd and showing high anxiety level with high muscle action potential , the test drug exerted significant reduction in anxiety and stress with improvement in sleep pattern in those patients . a better and promising results were obtained when the hydro - methanolic extract of withania somnifera in the dose of 250 mg / day , costus speciosus in the dose of 200 mg / day , terminalia arjuna in the dose of 275 mg / day and hippophae rhamnoides in the dose of 225 mg / day mixed and given to diagnosed chd patients or subjects showing presence of chd risk factors , modification in abnormal lipids including lipoprotein ( a ) and apolipo ( b ), reduction in triglycerides , reduction in inflammatory cytokines and adipokines and reduced homocysteine with improvement in endothelial dysfunction were noticed . as synergistic effects this combination exerted anti - stress , anti - anxiety and anti - oxidant activity . a general feeling of well being was reported by most of the cases . the non - clinical and clinical safety profile assessment indicated that the drug is safe and can be given for longer time without any adverse reaction . 3rd day — cheese 40 gm + boiled potato 50 gm ( repeated successively up to 30 days and given to 6 rats of group - ii & amp ; iii ) test formulation was suspended in distilled water and administered orally in a dose of 300 mg ./ kg p . o . twice in a day at a constant volume of 0 . 5 ml / 100 gm . wt . for 30 days table 1 effect of test formulation on total cholesterol among chd cases total cholesterol ( mg / dl ) after 3 after 6 comp . initial vs treatment no . of months months after 6 months groups cases initial therapy therapy therapy treated 47 285 . 71 ± 53 . 80 200 . 90 ± 40 . 35 214 . 73 ± 39 . 65 t = 7 . 28 with statin p & lt ; 0 . 001 treated 52 296 . 93 ± 64 . 71 255 . 98 ± 51 . 69 231 . 82 ± 38 . 44 t = 6 . 24 with test p & lt ; 0 . 001 formulation normal range : & lt ; 200 mg / dl results of the effect of test formulation on total cholesterol among chd cases are shown in fig2 . table 3 effect of test formulation on hdl - c content among chd cases hdl - c ( mg / dl ) after 3 after 6 comp . initial vs treatment no . of months months after 6 months groups cases initial therapy therapy therapy treated 47 37 . 81 ± 3 . 19 40 . 34 ± 3 . 87 44 . 73 ± 2 . 84 t = 11 . 34 with statin p & lt ; 0 . 001 treated 52 36 . 14 ± 2 . 75 38 . 44 ± 3 . 01 40 . 98 ± 3 . 13 t = 8 . 49 with test p & lt ; 0 . 001 formulation normal range : ≧ 45 mg / dl results of the effect of test formulation on hdl - c content among chd cases are shown in fig4 . table 5 decrease in apolipo ( b ) following ayurveda test formulation in chd cases apolipo ( b ) ( mg / dl ) after 3 after 6 comp . initial vs treatment no . of months months after 6 months groups cases initial therapy therapy therapy treated 47 184 . 73 ± 42 . 33 162 . 98 ± 38 . 56 143 . 75 ± 35 . 28 t = 5 . 10 with statin p & lt ; 0 . 001 treated 52 198 . 75 ± 38 . 43 182 . 54 ± 34 . 36 158 . 85 ± 31 . 16 t = 5 . 81 with test p & lt ; 0 . 001 formulation normal range : 55 - 159 mg / dl results of the effect of decrease in apolipo ( b ) following ayurveda test formulation in chd cases are shown in fig6 . table 7 effect of test formulation on endothelin among chd cases endothelin ( pg / ml ) after 3 after 6 comp . initial vs treatment no . of months months after 6 months groups cases initial therapy therapy therapy treated 47 1223 . 75 ± 209 . 00 1125 . 54 ± 176 . 27 1012 . 98 ± 163 . 84 t = 5 . 44 with statin p & lt ; 0 . 001 treated 52 1498 . 35 ± 196 . 285 1208 . 48 ± 201 . 22 1182 . 77 ± 158 . 87 t = 9 . 01 with test p & lt ; 0 . 001 formulation normal range : 0 . 32 - 1000 pg / ml results of the effect of test formulation on endothelin among chd cases are shown in fig8 . table 9 reduction in tnf - α inflammatory marker following test drug treatment among chd cases tnf - α ( pg / ml ) after 3 after 6 comp . initial vs treatment no . of months months after 6 months groups cases initial therapy therapy therapy treated 47 632 . 11 ± 68 . 91 585 . 32 ± 80 . 32 439 . 78 ± 76 . 02 t = 12 . 85 with statin p & lt ; 0 . 001 treated 52 673 . 12 ± 78 . 61 634 . 35 ± 69 . 05 568 . 75 ± 51 . 02 t = 8 . 03 with test p & lt ; 0 . 001 formulation normal range : 25 - 800 pg / ml results of the reduction in tnf - α inflammatory marker following test drug treatment among chd cases are shown in fig1 . table 11 decrease in plasma homocysteine level following ayurvedic test formulation among chd cases . homocysteine ( mmol / l ) after 3 after 6 comp . initial vs treatment no . of months months after 6 months groups cases initial therapy therapy therapy treated 47 29 . 72 ± 6 . 22 26 . 32 ± 5 . 10 22 . 62 ± 5 . 12 t = 6 . 06 with statin p & lt ; 0 . 001 treated 52 30 . 71 ± 7 . 91 26 . 62 ± 5 . 32 18 . 02 ± 6 . 92 t = 8 . 75 with test p & lt ; 0 . 001 formulation normal range : 5 - 15 μmol / l results of the decrease in plasma homocysteine level following ayurvedic test formulation among chd cases are shown in fig1 .

according to this invention there a novel herbal formulation for the prevention and management of coronary heart disease and associated chd risk factors , comprising , preparing a hydromethanolic extract of at least two plants selected from of withania somnifera , costus speciosus , hippophae rhamnoides and terminalia arjuna at 60 - 80 ° c ., maintaining the ph of the solution between 7 - 10 , separating the active compounds chromatographically , subjecting the active compounds to the step of molecular characterization .

a preferred embodiment of the present invention will now be described with reference to the drawings . while one particular structural arrangement of the electrode in accordance with the present invention is shown in the drawing and described with reference thereto , it will be understood by those skilled in the art from the detailed description set forth below that various modifications may be made in the design of that electrode without departing from the spirit and scope of the present invention . with particular reference to fig1 ( a ) and ( b ), there is illustrated a human body 10 , the right subclavian vein 12 , the cephalic vein 14 and the superior vena cava 16 . the drawing of fig1 is fanciful in nature , it being understood that the drawing is not to scale , but serves only to illustrate the functional relationships of the heart and associated circulatory system . element 18 refers to the heart , which includes the right atrium 20 , the right ventricle 24 , and the inferior vena cava 22 . the wall between the right atrium 20 and the right ventricle 24 is cut away in the area where the tricuspid valve would normally be located for purposes of permitting illustration of the right ventricle . as is known , blood from the arms , head , and body flow into the right atrium 20 via the superior vena cava 16 from , among others , the subclavian and cephalic veins 12 and 14 . blood from the trunk and legs enters the right atrium 20 via the inferior vena cava 22 . as is also known , there is a portion of the right atrium known as the right atrial appendage , identified as element 26 in fig1 a . the right atrial appendage 26 is a small ear - like appendage forming a pocket located anteriorly and superiorly on the right atrial wall , the inner surface of which is particularly susceptible to pacing . noting fig1 ( b ), it is seen that the curvature of the subclavian vein to the connection with the superior vana cava 16 is not flat , as it appears in fig1 ( a ), but rather is curved toward the rear of the patient &# 39 ; s body , i . e . in the direction toward the spinal column , coming from the forward surface of the body 10 . reference is now made to fig2 ( a ), ( b ) and ( c ), which disclose a temporary pacemaker electrode in accordance with the present invention . the electrode , referred to generally by the reference numeral 30 , includes a flexible , electrically insulated sheath 32 with a pair of concentric conductors 34 , 36 surrounding a central lumen 38 which may , though not necessarily , extend through the electrode 30 to the distal end 39 . each of the conductors 34 , 36 are insulated by a layer of insulating material ( not numbered -- see fig2 ( c )). each of the conductors 34 , 36 are exposed at the surface of the outer insulating sheath 32 , in order to permit electrical contact in the heart when the electrode 30 is in place . by way of example , conductor 34 may have a surface terminal 42 and inner concentric conductor 36 may have a surface terminal 48 at the distal extremity 39 . typically , the outer conductor 34 will serve to shield the inner conductor 36 , and the inner conductor will therefore be relied upon to provide pacing signals at the distal extremity 39 of the electrode 30 . in accordance with a preferred embodiment of the present invention , the terminal 48 consists of a spherical conductor connected electrically with the inner conductor 36 . referring again to fig2 ( a ), the proximal extremity of the electrode 30 includes a hub 52 having an opening 54 which communicates with the central lumen 38 . each of the concentric conductors 34 , 36 include external portions which likewise exit the electrode 30 at the proximal end 50 , typically in the manner shown in fig2 ( a ). as is well known , the proximal extremities of each conductor 34 , 36 may be connected to a temporary pacemaker ( not shown ). as is shown on the right - hand side of fig2 ( a ), the electrode 30 is provided with a somewhat gentle curve 44 between the terminal 42 and the distal extremity 39 which permits the conductor terminal 48 at the distal extremity 39 to be pointed in a direction approximately 180 ° + from the direction of the electrode 30 , and in a plane substantially parallel with the plane of the electrode ; that is to say , when the main body of the electrode 30 is lying on a flat surface , the curved portion 44 and the distal extremity 39 are likewise lying in the plane of the same flat surface . the insulative sheath 32 , including the insulative materials between the conductive electrodes 34 , 36 are of a material which has an elastic memory so that when the curved portion of the distal extremity 39 of the electrode 30 is straightened in the manner hereinafter described , the curved portion at the distal extremity 39 will thereafter resume its curved configuration . a number of conventional silastic and other non - toxic plastic materials are suitable for this purpose . straightening of the curve 44 of the electrode 30 may be accomplished by simple manipulation with the hands , or with a stylet having an outer diameter sufficiently small to permit it to pass through the opening 54 , down the central lumen 38 to straighten the curved end and hold the entire electrode , including the distal extremity straight . the stylet must be sufficiently flexible to permit the electrode to pass through the subclavian vein 12 , the superior vena cava 16 and into the right atrium 20 . in accordance with the present invention , the electrode 30 is provided with means for indicating the relative position of the curved distal extremity 39 with respect to the axial direction of the electrode 30 and the plane in which the electrode and the curved extremity lies . in the embodiment shown in fig2 ( a ), the indicating means in this regard comprises a pair of flat , relatively flexible plastic wings 59 , 60 which extend laterally from the outer insulated sheath 32 , joined by a sleeve 61 . as is shown in fig2 ( a ), the indicating wings 59 and 60 extend generally perpendicular to the plane of the curve 44 , the distal extremity 39 and the main body of the electrode 30 . as shown in fig2 ( a ) and ( b ), the wings 59 , 60 are curved slightly downward and include the notation &# 34 ; up &# 34 ; on the upper side intended to be away from the patient &# 39 ; s body , as described further below . the electrode 30 further includes means for indicating the distance along the insulating sheath 32 from the curve in the distal extremity 39 . in the embodiment of fig2 ( a ), this distance indicating means comprises a series of gradations along the insulating sheath 32 forward of the indicating wings 59 , 60 in the direction of the curve of the extremity 39 . typically , the gradations may include wide gradations 62 and thin gradations 64 , each wide gradation indicating a 10 cm . segment and each thin gradation indicating a 5 cm . segment ; thus , an individual marking of two wide gradations and one thin gradation would indicate a 25 cm . distance from the curved end . the manner in which the electrode of the present invention is employed for insertion through the right subclavian vein and into the right atrium without the use of fluoroscopy will now be described with reference to fig3 . before beginning the technique of inserting the electrode 30 in the manner hereinafter described , the patient is properly prepared and normal sterilization techniques are observed . initially , a puncture is made through the patient &# 39 ; s skin in the area adjacent the clavicle so as to pass a small , thin - walled 18 gauge needle into the right subclavian vein 12 , to thereafter permit the introduction of a removable introducer in the manner which is clearly described in my u . s . pat . no . 4 , 166 , 469 . because the technique for inserting a removable introducer sleeve into the right subclavian vein is clearly described in the specification of that patent , it is incorporated here by reference . once that sleeve is properly inserted , the curve 44 of the electrode 30 is straightened . the electrode 30 is then inserted down a removable introducer sleeve ( not shown in fig3 but see sleeve 56 in fig1 of my aforementioned u . s . pat . no . 4 , 166 , 469 ). once the straightened distal extremity 39 of the electrode is inserted down the introducer sleeve into the subclavian vein 12 , it is then manipulated through the superior vena cava 16 and into the right atrium 20 . the removable introducer sleeve is then removed by peeling it away , allowing the wings 59 , 60 to be positioned close to the entrance site into the subclavian vein 12 . at this point in the technique , the electrode 30 has been inserted as desired so that the straightened distal extremity 39 is positioned in the right atrium 20 . it will be understood that the insertion technique thus far described leaves the indicating wings 59 and 60 exteriorly of the patient &# 39 ; s skin . as a next step , the attending physician ensures that the indicating wings 59 and 60 are lying substantially parallel to the plane of the patient &# 39 ; s skin , and with the words &# 34 ; up &# 34 ; facing the physician . if a stylet is being used , the stylet is removed . in either event , the curve 44 resumes its normal , curved configuration , as is shown by dotted lines on the right side of fig3 . if the physician has inserted the electrode a sufficient distance into the subclavian vein 12 ( and down the superior vena cava 16 and into the right atrium 20 ), as is determined by reference to the indicating marks 62 , 64 along the outer sheath 32 , and if the indicating wings 59 and 60 are positioned in the manner described above , then the curved distal extremity 39 will assume a direction in which the terminal electrode 48 is pointed directly upward toward the right atrial appendage 26 . this is because of the unique relationship of the curvature from the right subclavian vein 12 , running down the superior vena cava 16 and into the right atrium 20 , as is clearly shown in fig1 ( b ). as was noted previously , the subclavian vein 12 actually curves slightly backward toward the spinal column as it communicates with the superior vena cava 16 , the superior vena cava communicating with the right atrium 20 at the rear of the heart 18 . thus , the indicating wings 59 and 60 and the curvature of the curve 44 are oriented such that when the indicating wings 59 and 60 are positioned substantially parallel to the patient &# 39 ; s skin and with the &# 34 ; up &# 34 ; side facing the physician , then the curve 44 at the distal extremity 39 is formed so that the conductive terminal 48 is pointed in the desired manner in the pocket under the right atrial appendage 26 . next , the attending physician then pulls the electrode 30 slightly outward away from the puncture wound in the skin and away from the subclavian vein 12 , as is shown by the arrows 68 in fig3 . the electrode 30 may be withdrawn in this manner a distance of between 1 to 7 centimeters , as determined by reference to the gradations 62 , 64 so as to ensure that the conductive terminal 48 engages the surface underneath the right atrial appendage 26 . because of the spherical configuration of the terminal 48 , that terminal makes a broad electrical contact with the wall of the right atrium 20 in the pocket of the appendage 26 , but without damage to the wall . the terminal 48 stays in the desired location because of the tension at the curve 44 , despite continual movement of the atrial wall . it will be appreciated that the manipulative steps described above can take place without the benefit of fluoroscopy , thus permitting a temporary electrode to be placed easily and quickly into the right atrium 20 for purposes of obtaining the benefits of physiological atrial pacing under emergency or temporary conditions .

a pacing electrode for rapid endocardial insertion for pacing from the right atrium of a patient and for interconnection with a pacemaker includes a flexible conductor having an outer , electrically insulating sheath about the conductor with a flexible curve at one end of the conductor and an exposed terminal along the flexible curved end . the terminal is adapted for making electrical contact with an inner heart surface , preferably within the right atrium . the curved end of the electrode is straightened during insertion through the circulatory system , and thereafter permitted to resume its curved configuration after entering the heart . a wing extends laterally from the sheath at a position outside the patient &# 39 ; s body after the curved end has been inserted into the heart . an established relationship between the lateral direction of the wing and the curved end allows the physician to control the orientation of the curved end after insertion to permit the positioning of the electrode in a stable manner within the right atrium , whereby physiological atrial pacing may be achieved .

reference will now be made in detail to the example embodiments of this disclosure , which are illustrated in the accompanying drawings . wherever possible , the same reference numbers will be used throughout the drawings to refer to the same or like parts . certain regulatory requirements regarding cleaning and disinfection efficacy in a clinical setting are becoming more stringent . moreover , in cases of high levels of contamination , the analyte measurement itself taken by an analyte meter may be adversely affected because the electrical connection between the analyte ( e . g ., an analyte sensor strip ) and one or more electrodes of the electrical connector may be contaminated or adversely affected in some way . in view of this concern , embodiments of the invention may provide an entirely hermetically sealed analyte meter that may be washable and , in some embodiments , may even be immersed in a liquid without damage . accordingly , the sealed analyte meter may be washed in a washing fluid , such as a disinfecting liquid , or the like . in one or more embodiments , the one or more electrical connections of the analyte meter may be sealed . some may be washable , such as , e . g ., the analyte sensor port . other electrical connections may be sealed and / or washable and / or removable such as a communication connector ( e . g ., a universal serial bus ( usb ) port ) and / or a battery connection . in some embodiments , the analyte meter itself is entirely washable and all connections thereof may be sealed and washable , including the sensor port , enabling electrical connection with an analyte sensor . the analyte meter , in accordance with one or more embodiments , may be used to measure any number of analytes , such as glucose , fructose , lactate , keytone , microalbumin , bilirubin , total cholesterol , uric acid , lipids , triglyceride , high density lipoprotein ( hdl ), low density lipoprotein ( ldl ), hemoglobin alc , and the like . these analytes may be detected in , for example , whole blood , blood serum , blood plasma , interstitial fluid , urine , etc . other types of analytes may be measured provided a suitable reagent exists . these and other embodiments of washable analyte meters , washable analyte sensor electrical connectors , and methods of using and manufacturing and using the analyte meter are described below with reference to fig1 a - 21 . fig1 a - 1d illustrates various views of a first example of an analyte meter 100 that is washable according to one or more embodiments . the analyte meter 100 may include a meter housing 102 that may be made of two parts , such as first part 104 and second part 106 that engage each other to form an internal chamber 108 ( fig1 b ). the internal chamber 108 may be configured to contain various internal components of the analyte meter 100 , such as a printed circuit board 110 ( shown dotted in fig1 a ), which may contain all or part of an internal electronic circuit . internal chamber 108 may be entirely sealed and liquid impermeable such that the analyte meter 100 is washable and immersable . the first part 104 and second part 106 may be sealed to each other at their contact surfaces in order to form the internal chamber 108 as a sealed chamber that is sealed from the outside environment . internal chamber 108 may be hermetically sealed . the first part 104 and second part 106 of the meter housing 102 may be formed of an insulating material such as plastic injection - molded pieces , for example . sealing may be provided by ultrasonic welding of the first part 104 and second part 106 , or by providing a sealant ( e . g ., a curable sealant ), o - ring , gasket , or the like between the first part 104 and the second part 106 . other suitable sealing methods may be used . connection of the first part 104 to the second part 106 may be made by screws , rivets , snap fit connectors molded on the first part 104 and second part 106 , or the like when using a sealant , o - ring , gasket , or the like . the printed circuit board 110 may reside within the confines of the internal chamber 108 . the printed circuit board 110 may include conventional electronic components such as a power supply , processor , memory , and the like that are conventional for carrying out analyte measurements and display thereof . the printed circuit board 110 may be retained in a defined position within the internal chamber 108 by projections and / or recesses formed in one or both of the first part 104 and second part 106 . other suitable positioning features may be used . the meter housing 102 may have a first end 112 and a second end 113 opposite the first end 112 . the first end 112 may include an analyte sensor electrical connector 115 that is fully washable having a sensor port 116 configured to receive an analyte sensor 105 in a port entryway 119 thereof . the analyte sensor electrical connector 115 may also have a one or a plurality of wash ports 118 coupled to sensor port 116 that are separate from port entryway 119 . wash ports 118 may be configured to receive a cleaning fluid there through . the analyte sensor electrical connector 115 may include a connector body 117 that may be received in a recessed pocket 114 of the first part 104 and / or the second part 106 . in some embodiments , the connector body 117 of the analyte sensor electrical connector 115 may include a first wall receiving two or more electrodes 121 , and a second wall opposite the first wall and including one or more wash ports 118 . two or more electrical connectors 122 may be coupled to two or more electrodes 121 at the first wall . in some embodiments , the two or more electrical connectors 122 may be electrical connector pins . a sealing layer 123 may be provided in some embodiments between a surface of the analyte sensor electrical connector 115 and the first part 104 and / or second part 106 , such as in the recessed pocket 114 . in some embodiments , the wash ports 118 may cooperate with the port entryway 119 to form a fluid flow channel enabling flushing of the sensor port 116 . the wash ports 118 may be formed through a first wall of the analyte sensor electrical connector 115 . as shown best in fig1 c , the wash ports 118 may be configured as elongated slots . the wash ports 118 may be one or more in number . the analyte meter 100 may further include a display screen 120 that may be sealed to the first part 104 and / or second part 106 such that fluids are prevented from entering the internal chamber 108 from between the display screen 120 and the first part 104 and / or second part 106 . similar sealing methods as described above may be used . for example , a sealing material layer 124 may be provided around the periphery of the display screen 120 . the analyte meter 100 may still further include a keypad 125 that may be sealed to the first part 104 and / or second part 106 such that fluids are prevented from entering the internal chamber 108 from between the keypad 125 and the first part 104 and / or second part 106 . the seal between the keypad 125 and the first part 104 and / or second part 106 may be provided by employing a thin layer 126 covering over the keys of the keypad 125 . the thin layer 126 may be sealed to the first part 104 and / or second part 106 and may be adhered thereto . the thin layer may be a plastic sheet in some embodiments and may include indicia printed or otherwise marked thereon . other means for sealing the keypad 125 or individual keys may be used . in some embodiments , the analyte meter 100 may include a battery connector 127 that is sealed to the first part 104 and / or second part 106 such that fluids are prevented from entering the internal chamber 108 from between the battery connector 127 and the first part 104 and / or second part 106 . the battery connector 127 allows the use of a removable battery pack 128 , as will be described herein . the analyte meter 100 may also include a universal serial bus ( usb ) port sealed to the first part 104 and / or second part 106 on a side , for example , such that fluids are prevented from entering the internal chamber 108 from between the usb port and the first part 104 and / or second part 106 . sealed connection for the universal serial bus ( usb ) port may be the same as for the battery connector 127 . a connection seal 127 s , such as an elastomer seal , may be provided on the connector or on the first part 104 and / or second part 106 to seal the connection interface . as further shown in fig1 e - 1h and as otherwise described herein , the analyte meter 100 may eliminate any opening allowing liquid ingress into to the internal chamber 108 , and may be configured to drain and dry the analyte sensor electrical connector 115 upon washing or cleaning thereof with a cleaning fluid or other liquid . in some embodiments , the analyte sensor electrical connector 115 may be seated within the recessed pocket 114 in the first part 104 of the analyte meter 100 . in some embodiments , the electrical connectors may project through one or more apertures in the first part 104 and may be configured to be connected to ( e . g ., plugged into or otherwise contact ) conducting receptacle features on the printed circuit board 110 . other suitable electrical connectors may be used such as bendable leaf spring contacts that contact conducting pads on the printed circuit board 110 . in some embodiments , the electrical connectors may be insert - molded in the analyte sensor electrical connector 115 forming a seal between plastic ( e . g ., the first part 104 ) and metal . in some embodiments , a sealing layer 123 such as a gasket - type sealing arrangement or other sealing arrangement ( sealing compound ) may be used between the analyte sensor electrical connector 115 and the surface ( s ) of the first part 104 and / or second part 106 . in some embodiments , the surfaces within the analyte sensor electrical connector 115 may be sloped and / or ventilated as needed to facilitate fluid egress after washing . fig2 is a flowchart illustrating a method 200 of cleaning an analyte meter in accordance with one or more embodiments . at process block 202 , method 200 may include providing an analyte meter ( e . g ., analyte meter 100 ) having a sensor port ( e . g ., sensor port 116 ) configured to receive an analyte sensor ( e . g ., analyte sensor 105 ), the sensor port having a port entryway ( e . g ., port entryway 119 ) and a wash port ( e . g ., wash port 118 ). at process block 204 , method 200 may include flowing a cleaning fluid through the wash port to clean the sensor port . the method 200 of cleaning may be accomplished without adversely affecting the analyte meter . fig3 is a flowchart illustrating a method 300 of manufacturing an analyte meter in accordance with one or more embodiments . at process block 302 , method 300 may include providing an meter housing ( e . g ., meter housing 102 ) having an internal chamber ( e . g ., internal chamber 108 ). at process block 304 , method 300 may include providing an analyte sensor electrical connector ( e . g ., analyte sensor electrical connector 115 ). the analyte sensor electrical connector may include at least two electrodes ( e . g ., electrodes 121 ). analyte sensor electrical connector 115 may be attachable to the meter housing 102 . at process block 306 , method 300 may include providing an analyte meter battery connector ( e . g ., battery connector 127 ). at process block 308 , method 300 may include forming a sealed connection between the analyte sensor electrical connector and the internal chamber . and at process block 310 , method 300 may include forming a sealed connection between the analyte meter battery connector and the internal chamber . any suitable means for accomplishing the sealed connection may be used . the above process blocks of method 300 may be executed or performed in an order or sequence not limited to the order and sequence shown and described . for example , in some embodiments , process block 304 may be performed after or in parallel with process block 306 . similarly , process block 308 may be performed after or in parallel with process block 310 . fig4 - 6 illustrate an embodiment of a removable or replaceable battery cartridge 428 of an analyte meter 400 that includes a sealed battery connector 429 that may protect against liquid ingress into the internal chamber 108 . the sealed battery connector 429 may be provided via the use of a sealed or potted interface in accordance with one or more embodiments . in some embodiments , the replaceable battery cartridge 428 may be configured to attach to an meter housing 402 via slideable insertion . as shown in fig5 and 6 , some embodiments may include retention features , such as a pair of t - shaped retention rails 430 on opposite sides of a surface of an meter housing 402 ( fig5 ) and a corresponding pair of retention slots 432 in the battery cartridge housing 428 h configured to receive the t - shaped rails . fig7 - 11 illustrate a battery cartridge housing 728 h ( fig7 ) configured to receive battery cartridge inserts of different battery chemistries in accordance with one or more embodiments . fig8 and 9 illustrate a battery insert assembly 832 including coin cell batteries and fig1 and 11 illustrate a battery insert assembly 1032 including a prismatic battery cell , each configured to be inserted in battery cartridge housing 728 h . fig1 illustrates a printed circuit board ( pcb ) 1200 that may be affixed to the inserts at locations 825 and 1025 ( of fig8 and 10 , respectively ) in accordance with one or more embodiments . in some embodiments , potting compound may be used to encapsulate the electronics creating a fluid - tight seal ( e . g ., a water - tight seal ). a gasket or potting compound may additionally be used in some embodiments to seal the prismatic battery . battery electrical connector 1227 extending from the printed circuit board ( pcb ) 1200 may couple to and provide a sealed connection ( e . g ., with connection seal 127 s ) with the meter housing of the analyte meter , for example . optionally , sealed electrical connectors may be the same as for the analyte sensor electrical connector 115 . thus , power may be readily provided to the analyte meter and the internal chamber 108 may remain entirely hermetically sealed . as shown in fig1 - 17 , battery insert assemblies 832 , 1032 may be slid into the battery cartridge housing 728 h first at an angle such that the interface battery connector slides through an access hole 1335 ( see fig1 ) and then the battery insert assemblies 832 , 1032 may be snapped down into the battery cartridge housing 728 h . in addition , in some embodiments , the battery insert assembly 832 , 1032 may be secured in the battery cartridge housing 728 h with potting or an adhesive . in the case of the battery insert assembly 1032 this may also protect the prismatic battery and the battery compartment against liquid ingress . embodiments of the battery cartridge housing 728 h may allow multiple battery chemistries to be used while maintaining an identical mechanical envelope for an analyte meter ( or other suitable battery - powered device ). in some embodiments , the electronics in the battery cartridge may be protected against liquid ingress such that the ip22 standard is met . the ip22 standard is part of the ingress ( or international ) protection rating code published by the international electrotechnical commission ( iec ). embodiments of the replaceable battery cartridge may also allow an analyte meter ( or other suitable battery - powered device ) to meet the ip22 standard for liquid ingress . embodiments of the replaceable battery cartridges may be user replaceable , thus reducing the cost of replacing a replaceable battery cartridge when the battery / batteries expire ( s ). in some embodiments , the coin cell batteries of the battery insert assembly 832 of the replaceable battery cartridge may be user replaceable . fig1 - 21 illustrate the electrical interface between a replaceable battery cartridge and an analyte meter ( or other suitable battery - powered device ). fig1 and 19 illustrate less complex circuit topologies of electrical interfaces wherein power management circuitry common to all battery chemistries may be contained in an analyte meter ( or other suitable battery - powered device ), while the power management circuitry unique to a battery chemistry may be contained in the battery cartridge . fig2 and 21 illustrate full cartridge electrical interface topologies wherein all power management circuitry may be contained in the battery cartridge . accordingly , battery cartridges of different battery chemistries may be mechanically and electrically interchangeable , allowing an analyte meter ( or other suitable battery - powered device ) to be powered from different battery chemistries . the foregoing description discloses only example embodiments of analyte meters , sensor connectors , battery cartridges , and methods of manufacturing and using the analyte meters . modifications of the above - disclosed analyte meters , sensor connectors , and methods , which fall within the scope of the invention , will be readily apparent to those of ordinary skill in the art . accordingly , while the invention has been disclosed in connection with example embodiments thereof , it should be understood that other embodiments may fall within the scope of the invention , as defined by the following claims .

an analyte meter to detect an analyte concentration level in a bio - fluid sample may be cleaned and disinfected with a cleaning liquid without harming electrical and internal meter components . in some embodiments , the analyte meter is washable and immersable and may include a sealed sensor connector , sealed battery connector , and possibly a sealed usb connector that may be subjected to a cleaning liquid without the liquid entering an internal chamber of the analyte meter and contacting internal electronic components . in some embodiments , a sealed display screen and sealed keypad are provided such that liquids are prevented from entering the internal chamber . manufacturing methods and systems utilizing the analyte sensors are provided , as are numerous other aspects .

while the present invention is susceptible of embodiment in various forms , there is shown in the drawings and will hereinafter be described a presently preferred , albeit not limiting , embodiment with the understanding that the present disclosure is to be considered an exemplification of the present invention and is not intended to limit the invention to the specific embodiments illustrated . the present invention is directed towards a decorative and safety assembly for dressing a trampoline , referred to generally as a trampoline dressing or assembly 10 . referring to fig1 , a standard mini - trampoline 12 is illustrated . the mini - trampoline 12 embodiment is used for illustrative purposes , and any trampoline known to one of skill in the art may be used with the trampoline dressing 10 . the trampoline 12 contains a horizontal frame 14 having a generally circular configuration . while such configuration may be preferred , the circular configuration is for illustrative purposes and not intended to be limiting as the horizontal frame 14 can assume , for example , a square shape , a hexagonal shape , or a rectangular shape . a plurality of vertical support frames or legs 16 provide elevated support for the horizontal frame 14 . the plurality of vertical support frames or legs 16 allow the horizontal frame 14 to be positioned above the floor or ground . coupled to the horizontal frame 14 via a plurality of resilient members , illustrated herein as coil springs 18 , is a rebounding surface or trampoline mat 20 . the plurality of resilient members is designed to provide elasticity or bounce to the rebounding surface or trampoline mat 20 . one end of the coil spring 18 contains a hook - like structure 21 which connects to a metal ring 22 coupled to a band 23 secured to the rebounding surface or trampoline mat 20 and positioned at or near the inner edge margin 24 of the rebounding surface 20 , see fig1 and 2a . at the opposite end of the coil spring 18 is a second hook - like structure 25 which connects to an opening 26 positioned within the horizontal frame 14 . such arrangement provides for a highly resilient surface when in use , i . e . a user jumps up and down on the rebounding surface 20 . alternative mechanisms for and providing elasticity or bounce and for attaching the rebounding surface 20 to the horizontal frame 14 known in the art can be used as well . fig2 b illustrates a partial view of the trampoline 12 illustrating one such mechanism through the use of a foam strap for attaching the rebounding surface 20 to the horizontal frame 14 . as shown , the horizontal frame 14 contains a foam cover 29 . alternatively , the rebounding surface 20 can attach to the horizontal frame 14 using a bungee cord . attached to the trampoline 12 is a handrail 28 . the handrail 28 could be constructed as a single unit and coupled to , for example , the vertical support frames or legs 16 . alternatively , the handrail 28 may be made of individual parts which can be fit and secured together , using , for example , male / female connecting means , to provide for ease of shipping and / or assembly . referring to fig3 - 9 , an illustrative example of the trampoline dressing 10 secured to a trampoline 12 resting on a floor surface 31 is shown . the trampoline dressing 10 comprises a first component 30 constructed to couple or secure to at least one portion of the trampoline 12 and a second component 32 constructed to couple to or secure to at least one portion of the trampoline 12 . when both the first component 30 and the second component 32 are secured or coupled to the trampoline 12 , the trampoline 12 is preferably transformed to contain safety features as well as a theme - based motif . as shown in fig4 - 9 , the trampoline 12 is fitted with a trampoline assembly or dressing 10 so as to transform the trampoline 12 to appear as a bug when viewed in different views . in addition to animals , the theme - based motif may include but is not limited to machines such as cars , trucks , boats , or airplanes , sports related such as a general sport i . e . football , baseball , or basketball , or team specific such as a national football league ( nfl ) team , or character related such as disney characters , comic book characters , or superheroes such as spiderman . referring back to fig3 , the first component 30 is designed to cover multiple portions of the trampoline 12 to provide for the theme - based motif appearance . the upper portion of the first component 30 is designed to secure or couple to at least one portion of the horizontal frame 14 of the trampoline 12 in order to cover at least a portion of the horizontal frame 14 and the spring coils 18 . accordingly , the first component 30 comprises a pad assembly 34 formed of cover material 36 and a cushioning material 38 , such as , for example , a foam strip , see fig1 . as illustrated in fig1 , the cover material 36 contains an upper portion 40 which when secured to the trampoline 12 is visualized by the user , forming the upper surface 41 of the trampoline dressing 10 , a lower portion 42 which contacts and covers the spring coils 18 and forms the lower surface 44 of the trampoline dressing 10 . the cushioning material 38 is inserted between the upper portion 40 and the lower portion 42 , see fig1 . alternatively , the cushioning material 38 may be secured directly to either the upper portion 40 or the lower portion 42 via stitching . both the upper portion 40 and the lower portion 42 contain expandable edges 46 a and 46 b respectively . the expandable edges 46 a and 46 b are formed by using a stretchable and resilient material or band secured thereto , through for example being sewn within , to allow the edges to expand in size and be secured to a portion of the horizontal frame 14 . in use , the lower portion 42 can be secured to a portion of the horizontal frame 14 , see fig1 , by stretching the expandable edge 46 b on and over the outer edge 48 of the horizontal frame 14 . as the band retracts back , it secures the lower portion 42 thereto . once secured in position , the cushioning material 38 is inserted and rests on top of the lower portion 42 . the upper portion 40 is then folded over the cushioning material at a fold line 50 , and using expandable edge 46 a is secured to the outer edge 48 of the horizontal frame 14 . the fold line 50 is positioned at or extends past an outer edge 52 of the horizontal frame 14 and may include a stretchable and resilient band . the fold line 50 defines the inner edge 54 of the trampoline dressing 10 , and the upper portion 40 and the lower portion 42 when folded over define the outer edge 56 ( see fig3 ). in this construction , the first component 30 can be easily removed and secured to the trampoline . such feature aids the user by providing ease of assembly , ease of removal , and ease of replacing the cushioning pad when need . such construction further allows the first component 30 to be removed from the trampoline 12 and cleaned without the risk of damaging the cushioning material 38 . the pad assembly 34 may alternatively be constructed as an enclosed unit similar to a pillow , see fig1 . the cushioning material 38 , therefore , is secured between the upper portion 40 and lower portion 42 through stitching lines 58 . alternatively , the stitching may be replaced by other sealing mechanisms , such as but not limited to , a zipper , buttons , snaps , or hook and loops fastener such as velcro . referring back to fig3 , the first component 30 further includes a skirt 58 integrally formed or attached thereto to provide a side wall which covers at least a portion of the space 60 , preferably the entire space , between the rebounding surface 20 or the horizontal frame 14 and the floor surface 31 supporting a trampoline . the skirt 58 further provides for the transformation of the trampoline 12 to a theme - based appearance . the skirt 58 is positioned along the outer edge perimeter of the pad assembly 34 , but does not extend completely around the perimeter and is aligned in a generally perpendicular manner with respect to the pad assembly 34 . as such , a portion of the pad assembly 34 extends out past a skirt first end 62 and the opposing skirt second end 64 . both the skirt first end 62 and the opposing skirt second end 64 are adapted to be securable to the second component 32 . accordingly , each end 62 and 64 contains a first member of a first component to second component securing assembly 65 , illustrated herein as either the hook or loop portions of a hook and loop fastener such as velcro . positioned at various locations along the body of the skirt are fastening members 66 illustrated herein as string ties . the fastening members 66 are designed to provide for securing the skirt 58 to a plurality of positions on the trampoline , such as the vertical support members 16 . while the illustrated embodiment is shown as string ties , other mechanisms may be used including buttons , snaps , velcro , or the other means known to one of skill in the art . additionally , the trampoline dressing 10 may include a foam insert 59 , see fig9 . referring to fig1 - 16 , an illustrative example of the second component 32 is illustrated . the second component 32 includes a first surface 68 secured to a second surface 70 thereby forming an enclosed area . the enclosed area is filled with cushioning material to form a front pad . at each end 72 and 74 is an extension or flap 76 which contains a second member 78 of the first component to second component securing assembly , illustrated herein as either the hook or loop portions of a hook and loop fastener such as velcro . the second component 32 is designed to couple to the first component 30 within the area defined by the portion of the pad assembly perimeter which does not include the skirt 58 . the second component provides for an additional , independent padded area that protects the front portion of the trampoline 12 below the padded assembly 34 . positioned on the back surface 70 is a recessed area 80 having a looped securing member 82 for receiving and securing thereto a vertical or leg support 16 . a plurality of fastening members 84 , illustrated herein as string ties , may be used as well for securing to other parts of the trampoline 12 or trampoline dressing 10 . a plurality of handrail guards 86 , such as foam bodies , are secured to one or more portions of a handrail 28 if a handrail is used , and prevents or minimizes injury if a user contacts the handrail 28 . as described previously , the trampoline dressing 10 is designed to provide both safety and decorative features . as such , the trampoline dressing 10 can be applied to any trampoline , thereby allowing the trampoline to assume a decorative or theme - based appearance . as illustrated in fig4 - 8 , the trampoline dressing 10 is designed to provide for the appearance of a bug . as such , one or more components of the trampoline dressing 10 may contain one or more colors , and indicia such as words , letterings , symbols . for example , the trampoline dressing 10 illustrated in fig4 and 5 have eyes 88 , a mouth 90 , and dots 92 . in addition , external features may be coupled to one or more portions of the trampoline dressing 10 , such as bug antenna 94 . referring to fig1 - 19 , additional theme - based appearances are shown . fig1 represents a race car having head lights 96 , attached wheels 98 , and a colored yellow racing strip 100 against a red back drop 102 . fig1 represents a lady bug having a red body with spots 104 , eyes 106 , mouth 108 , and antenna 110 . fig1 represents a turtle having eyes 112 , mouth 114 , and external features attached such as legs 116 . fig2 illustrates additional features associated with the trampoline dressing 10 . in addition to all the featured as described previously , the trampoline dressing 10 is designed to provide visual and / or audio features . as such , the trampoline dressing 10 may include the necessary electronics to provide such features and may include a circuit board or microprocessor 118 electronically coupled , via wiring or wirelessly , to a light source 122 such as led lights , white or colored , a speaker 124 for producing sound , and a sensor 126 , see fig2 , which may induce the circuit board or microprocessor to produce sound or light based on a user jumping on the trampoline surface . a control unit 128 may be used to turn the lights or sound on and off , or to provide control of the volume of sound or type of lights produced , i . e . constant on or flashing . in the embodiment illustrated in fig2 , the control unit 128 and wires 120 secure to portions of the handrail 28 . a pressure sensor 126 within the rebounding surface or trampoline mat 20 may be used to send a signal to the microprocessor ( not shown ) each time a person jumps on the mat 20 . led lights 122 placed in the headlights 96 may be turned on and off as a result of the jumping . speaker 124 may be imbedded within the trampoline dressing 10 , such as within the skirt , to provide a sound , such as a car roar , screech or honk . fig2 and 23 illustrate an embodiment of the trampoline dressing 10 having a sports - based theme . fig2 is shown having a football based theme . the first component 30 contains features that indicate a football , including images that depict football white lacing 126 . in addition to or alternatively , the first component 30 may contain images that represent a specific professional or college football team , such as team colors , mascots , name / nick - names , or other symbols that represent the specific team . in addition to the features described throughout the specification , the trampoline dressing includes an additional feature in which the rebounding surface 20 forms part of the decorative image . as illustrated , the rebounding surface 20 includes printed images or overlays of a football field , illustrating the various components of a football field including hash marks 128 , yard lines 130 , and numerals 132 that indicate numerical values for the yard lines . fig2 illustrates a trampoline dressing 10 depicting a basketball theme . the first component 30 may contain images that represent the sport in a general manner or represent specific professional or college basketball teams , such as team colors , mascots , name / nick - names , or other symbols that represent the specific team . as shown , first component 30 is designed to depict a basketball net 134 . the rebounding surface 20 includes printed images or overlays of a basketball 136 and components of the basketball court , including the free throw circles 138 , half - court line 140 , three point lines 142 , and free - throw lines 144 . all patents and publications mentioned in this specification are indicative of the levels of those skilled in the art to which the invention pertains . all patents and publications are herein incorporated by reference to the same extent as if each individual publication was specifically and individually indicated to be incorporated by reference . it is to be understood that while a certain form of the invention is illustrated , it is not to be limited to the specific form or arrangement herein described and shown . it will be apparent to those skilled in the art that various changes may be made without departing from the scope of the invention , and the invention is not to be considered limited to what is shown and described in the specification and any drawings / figures included herein . one skilled in the art will readily appreciate that the present invention is well adapted to carry out the objectives and obtain the ends and advantages mentioned , as well as those inherent therein . the embodiments , methods , procedures and techniques described herein are presently representative of the preferred embodiments , are intended to be exemplary and are not intended as limitations on the scope . changes therein and other uses will occur to those skilled in the art which are encompassed within the spirit of the invention and are defined by the scope of the appended claims . although the invention has been described in connection with specific preferred embodiments , it should be understood that the invention as claimed should not be unduly limited to such specific embodiments . indeed , various modifications of the described modes for carrying out the invention which are obvious to those skilled in the art are intended to be within the scope of the following claims .

a decorative and safety assembly for dressing a trampoline which can be easily secured to and removed from a trampoline is described . the trampoline assembly is designed to enhance the safety features associated with a trampoline , as well as enhance a user &# 39 ; s experience . the trampoline assembly may include a first component coupleable to a horizontal frame of a trampoline , and a second component independently coupleable to the horizontal frame of a trampoline and covering the space between a rebounding surface and a surface supporting a trampoline . the first component , the second component , or combinations thereof may contain one or more features that can be used to enhance an individual &# 39 ; s experience when using the device and may include indicia , such as colors , wordings , symbols , lighting , audio devices , or combinations thereof .

the device 1 comprises a base body 2 of but five housing parts 3 to 7 of which in the readiness or operative condition merely three parts 3 , 4 , 6 firmly connected in common with a crib unit 8 form the completely outer surface area of the device 1 . the part 5 is arranged totally countersunk firmly seated in the part 3 and directly located axially by the part 4 . the unit 8 comprises at least four and not more than eight reservoir locations 9 for the medium arranged evenly distributed and directly juxtaposed in a circle about an axis 10 . the axis 10 is located parallel to the main axis 11 in which the location 9 operative in each case is located to be discharged directly from this position for discharge through an outlet 12 . the axis 13 of the latter is oriented at an obtuse angle of minimally 110 ° and maximally 160 °, more particularly 135 °, to the axis 10 or 11 . as viewed parallel to the axis 10 , 11 the outlet 12 is located totally within the outer circumference of the base body 2 . provided totally within the base body 2 is a fluid guide 14 or passageway connecting the latter at both ends , between which a reservoir outlet 15 is located for discharging the medium . the outlet 15 has a substantially smaller spacing away from the upstream end of the guide 14 than from its outlet end 12 . the outlet 15 is formed by one end of an elongated , separate reservoir body 16 having an elongated reservoir space 17 which in the emptying position is coaxial to the axis 11 . the dimensionally rigid body 16 is formed by a two - part capsule of rigid gelatine or the like , the two shell - shaped parts of which are axially combined in a tight fit and the ends of which face away from each other are hemispherical so that the medium contained in the space 17 is sealingly packaged prior to opening of the device 18 , filling the space 17 totally or merely partly as a single - shot dose . the body 16 or the space 17 which permits opening only by destruction forms in operation a section of the guide 14 extending over its full length , the openings of which located at the two ends are substantially more constricted in a throttle like action than the full - length constant passage cross - section of the portion of the space 17 located between the ends . the exposed outer shell 19 formed merely by the parts 3 , 4 , 6 , 8 of the device 1 can be clasped almost completely by a single hand . within this shell 19 the guide 14 forms a zone 20 for swirling , size - reduction and atomized dispersion of the medium already entrained upstream by the air flow . in the middle between the ends of the guide 14 or device 1 , in the operative position below the outlet 15 a dished or troughed initial hold 21 open only to the top is provided , the bottom 24 of which is spaced away from the outlet 15 by a spacing which is smaller than the length of the space 17 . the concave curved bottom 24 adjoins a longer flank 22 and a shorter flank 23 which diverse upwards at an acute angle . the common axial plane of the surface areas 22 to 24 or bowl 21 located between the axes 10 , 11 but nearer to the axis 10 is offset to one side of the axis 11 of the outlet 15 so that the outlet 15 is located vertically above the middle of the bottom 24 when the device 1 is slightly tilted rearwards in the operative position , the axis 13 thus being less inclined than in the vertical orientation of the axes 10 , 11 . the flank 22 sealingly adjoins the outlet 15 and the flank 23 extends only to a constricted transition point 25 between the bowl 21 and the part of the guide 14 located downstream thereof . the flank 23 extends to a rounded , lengthwise lip 26 which is located opposite a concave surface area 27 above the latter , this surface area 27 like the bowl 21 being curved about an axis located transversely at right angles to the axes 10 , 11 , but which has a radius of curvature larger than that of the bottom 24 by at least four or five times . the surface area 27 extends in and opposite to the direction of flow beyond the transition point 25 defining the lip 26 , namely up to the outlet 15 and as a circumferential definition up to a straight passage section 28 adjoining upstream the transition point 25 and the lip 26 . the end of the section 28 located downstream adjoins an end passage 29 in an obtuse angled curvature , the end of the end passage forming the outlet 12 . the axis 30 of the section 28 is located parallel to the axis 10 , 11 and on the side of the axis 10 facing away from the axis 11 . the two passage sections 28 , 29 are straight and have a constant flow cross - section throughout which is greater than that of the transition point 25 . the section 29 is formed by a freely protruding , tubular port 31 of constant outer cross - sections which as the mouthpiece is to be introduced over the majority of its length into the mouth of the patient , whose lips sealing surround it . in this arrangement the section 29 may be slightly longer than the section 28 up to the lip 26 . bowl 21 and port 31 are located on the same side of the section 28 . the bowl 21 including the surface areas 22 to 24 , 26 and a first longitudinal section of the passage part 28 is defined exclusively by part 5 which is inserted totally countersunk as far as it will go in part 3 opposite the direction of flow and is axially located by the part 4 likewise inserted in this direction . this part 4 forms a longitudinal section of the passage part 28 adjoining the part 3 therewithin as well as the section 29 , the port 21 and the outlet 12 . the part 4 does not protrude beyond the outer circumference of part 3 , it sealing contacting the lower annular face surface area of the latter by a ring shoulder . the surface area 27 extending over an angle of an arc of less than 90 ° and more than 45 ° is formed only by the part 3 as well as being smoothly continued at both ends so that it forms an intermediate section of a semi - circular or hemi - spherical or u - shaped impact surface area of the part 3 , the part 5 sealingly contacting the continuations of the latter adjoining the surface area 27 by convex surface areas and subsequently thereto the part 4 by its circumferential surface area . the flank 22 extends up to these curved surface areas and the flank 27 is passed through in the region of the outlet 15 as well as subsequent to the flank 22 by a transition opening 46 for the medium and the air flow . the passage cross - section of this transition opening 46 located in the axis 11 corresponds to the largest passage cross - section of the space 17 , but the clearance of the transition opening 46 is larger than the largest clearance of the space 17 . the bowl 21 is located between the axes 11 , 30 and the largest clearance of the bowl 21 level with edge 26 is larger than the associated depth of this bowl 21 . the definitions of the passage sections 21 , 25 , 28 location parallel to the plane of the drawing may be more or less flat as well as parallel to each other so that as viewed axially the device is web - shaped in the associated region . like the cited surface areas this region may be rotationally curved about the axis 11 , however . spaced away above the arrangements 12 , 29 , 31 part 4 of the body 2 forms a barrel - shaped handle 32 which adjoins the rear end of the outer circumference of the mouthpiece 31 in an inwardly directed acute angle at right angles transverse to the axis 11 and ascends to the region remote therefrom up to the outer circumference of the shell 19 . the other handle 33 is formed by the rear end of the body 2 , namely the outer side of the face end wall of the part 6 so that the two handles form a grip 32 , 33 in which the thumb rests on the handle 32 and further fingers of the same hand clasp the handle 33 facing away from the latter , whilst the mouthpiece 31 is introduced between the lips of the patient and the finger supported by the convex handle 32 may be in contact with the upper lip of the patient as well as by its side facing away therefrom with the outer circumference of the mouthpiece 31 . throughout the complete operation and discharge of the device the handles 32 , 33 are located rigidly positioned to each other . the unit 8 comprises a crib body 34 movable about the axis 10 which is defined axially between the parts 3 , 6 and carries replacably on its side facing the part 6 a crib insert 35 having the cited number of reservoir bodies 16 . the body 34 comprises for each location 9 a sleeve - shaped mount 36 freely protruding in the direction of flow , this mount surrounding the one lower end of the body 16 in a tight seal and forming by a constriction a stop for the lower curved end surface area of the body 16 . a mount 37 correspondingly protruding only in the direction of flow , but substantially smaller also comprises the insert 35 for each location 9 . the crib body 34 and crib insert 35 provide a dosage carrier , and the mounting structures 36 , 37 provide receptacles for receiving doses of the medium encapsulated within reservoir spaces 17 . the mount 37 which protrudes only beyond the lower face side of the otherwise circular or disk - shaped flat insert 35 engages by a conical outer circumference a conical inner surface area at the rear end of the mount 36 so that it adjoins the outer circumference of the narrower part of the body 16 in a radially constricted seal , whereby the flared cap part of the body may adjoin by its face surface area the upper face surface area of the insert disk 35 . as a result of this , this rear end or the cap part protrudes opposite to the direction of flow non - contactingly into the internal space of the part 6 whilst the lower longitudinal section is located totally in the mounts 36 , 37 and passes through the bodies 34 , 35 . the body 34 which like each of the parts 3 to 7 , 35 is configured integrally comprises at its outermost circumference a shell 38 at the inner circumference of which spaced away between its ends a face end wall 39 adjoins , beyond the undersides of which the mounts 36 protrude and adjoin the insert 35 at their upper face surface area . the outer circumference of the shell 38 forms a handle 40 and is located in an angle of an arc of minimally 90 ° or 160 ° and maximally 220 °, more particularly only 180 ° about the axis 10 freely accessible at the outer circumference of the bodies 3 , 6 for actuation . in the operative position the constricted end of the mount 36 surrounding the outlet 15 is located directly adjacent the transition opening 46 in the surface area 27 or adjacent to the outer side of the curved wall 47 which forms the surface area 27 . the body 34 located totally at this outer side is rotatably mounted directly on part 3 by two concentric bearings and is axially fixed in position in the opposite direction . the bearing parts configured integrally with the part 3 are formed by two nested bearing bodies such as sleeves freely protruding contrary to the direction of flow which slide on the underside of the wall 39 by their end surface areas . the outer sleeve of the bearing 41 slides by its outer circumference on the inner circumference of the shell 38 and by its inner circumference on the outer circumferences of the mounts 36 . the inner sleeve of the bearing 42 slides by its outer circumference likewise on the outer circumferences of the mounts 36 which for this purpose form in common an inner circumference . located between the two sleeves is the transition opening adjoining the outlet 15 , the two sleeves translating integrally into the curved wall of the surface area 27 . since the sleeve of the bearing 41 is provided eccentrically to the axis 11 of the housing parts 3 , 4 of the body 2 adjoining underneath , the sleeve protrudes beyond the parts 3 , 4 at the side face away from the handle 32 . for axial location a snap - action connector may be provided on one of the sleeves , more particularly between the outer circumference of the inner sleeve and the body 34 so that following completely removal of the part 6 the insert 35 including the emptied body 16 can be pulled out contrary to the direction of flow without releasing the body 34 from the bearings 41 , 42 . a further radial and axial bearing is provided on the upper side of the bodies 35 , 39 for which the shell 43 of the part 6 slides on this side at the inner circumference of the shell 38 and on the upper face surface area of the body 35 , as a result of which the body 36 is held in close contact with the upper side of the wall 39 . the shell 43 also forms only over part of the circumference the outer shell of the part 6 since the shell is located eccentrically relatively to this outer shell . outside of the bearing member 43 this outer shell engages the interior of the shell of part 3 firmly seated , the outer shell being locked in place by a springy snap - action connector preventing removal except when a suitably high removal force is applied for removal contrary to the direction of flow . after this removal the body 35 is located with the bodies 16 freely accessible for replacement . the device 18 comprises two opposing opening members 44 , 45 in the axis 11 which may be formed by metal tips and serve to break open the end walls of the capsule 16 in the switching movement of the unit 8 , as a result of which the capsule 16 is captured by the members 44 , 45 in the last phase of translation into the operative position and is thus ruptured at the ends so that the tips protrude into the space 17 , each being surrounded by a jagged opening . the member 44 passes through the associated transition opening 46 of the curved wall 47 after which it can be locked in place by the arms of a star - shaped mount . the outer circumference of this tip 44 forms a gliding surface area by which the medium and the air flow are flared into an envelope flow . the rear tip 45 is secured to the inner side of the face end wall of the part 3 so that the tips 44 , 45 are oriented coaxially relative to each other . for making use of the device 1 the ring 38 , which may be provided with a means for indicating its rotary position and which has spring action to lock into each opening position , is turned until the next capsule 16 is located in the axis 11 and is then opened at both ends . due to this opening action part of the medium trickles via the tip 44 along the flank 22 or 23 onto the bottom 24 of the bowl 21 , i . e . after having left the tip 44 via a free - fall distance . after this the patient sucks on the mouthpiece 31 so that air is drawn in from without through openings in the housing space accommodating the upper end of the capsule 16 and the tip 45 , the air flowing through the upper opening of the capsule 16 into the space 17 . the air flows through the space 17 entraining the remainder of the medium still left in this space 17 , flows through the outlet 15 around the tip 44 directly into the opening 46 and from here against the flank 22 located nearer to the outlet 12 so that this conveying flow is diverted along the flank 22 and the bottom 24 back upwards as well as being directed directly against the surface area 27 on leaving the edge 26 , the conveying flow thereby entraining the medium present in the bowl 21 . in the region of the bowl 21 a rolling flow may briefly materialize , however , the conveying flow gains access whilst being accelerated due to the suction effect through the transition point 25 into the passage 28 , 29 where mollification of the flow takes place which continues up to the outlet 12 . on impinging against the surface area 27 , opposite which the flank 23 is located on a direction of the radius the larger particles of the medium are reduced in size by the force of impact . for the next application the unit 8 is turned further to a location 9 . the unit 8 is rotatable in one direction only , due to a free - wheel lock . downstream of the outlet 15 or the transition point 25 a sieve 48 or a filter inserted e . g . between the parts 3 , 4 is provided in the passage 28 so that any fragments of the fractured capsule 16 or excessively large medium particles cannot gain access to the throat of the patient . furthermore , a valve 49 may be provided in the flow path , namely upstream or downstream of the space 17 , this valve opening as a function of the pressure being lower downstream than upstream . the opening force of this valve may be constant or reducing , the more the opening is made , so that the valve abruptly opens fully following commencement of the opening movement to release the conveying flow pulsedly . the valve 49 returning to its closed position as a function of the pressure may be located near to the outlet 12 within the passage 29 so that the section of the guidance 14 located upstream is sealingly closed off to prevent the ingress of any contamination during the non - active periods . the part 7 is configured as a protective cap which is to be completely removed axially prior to use of the device and in its protective position sealingly accommodates the port 31 including the opening 12 as well as the complete part 4 and the lower section of the part 3 . in fig3 only the upper section of the device is shown as of part 6 , on the underside of which an air pump 50 is arranged as a discharge actuator and pressure generator . here , the upper face end wall of the part 6 does not form a handle , it instead comprising a shell 52 freely protruding upwards in which a dished piston 41 is inserted firmly in place by its shell as far as it will go against the face end wall of the part 6 so that its flared piston lip protrudes beyond the upper end of the shell 52 . the piston lip slides on a cylinder 53 which closely surrounds the outer circumference of the shell 52 and which can be shifted downwards against the force of a spring 54 as far as it will go against the face end wall of the part 6 to supply air through an opening 55 in the crown of the piston as well as in the face end wall of the part 6 around the tip 45 of the capsule 16 . the pump 50 is located in the axis 11 and the face end wall of the cylinder 53 forms the movable handle 33 , on release of which the pump returns to its starting position in drawing in fresh air . due to this action the path through the opening 55 may be closed off from suction by a valve , for example the valve 49 . in this embodiment too , the air flow may be produced solely by suction action through the opening 12 and boosted at any time by actuating the pump 50 . in fig3 the insert 35 is shown in its change position by itself and without insert 34 . all cited effects and properties , such as positions , sizes and the like may be provided precisely as described , merely roughly so or substantially so and may also greatly vary therefrom , depending on the particular application . the device may be configured true to scale as depicted in fig1 to 3 . the defining surface areas of the portions coming into contact with the medium , more particularly the portions 12 , 14 , 18 , 20 to 29 , 44 to 46 , 48 and 49 may be provided with an anti - stick or anti - static coating of metal and / or a plastics material such as tetrafluoroethylene to prevent the medium tacking due to electrostatic charging . the coating is but a few mm thick and may be applied by spraying , bonding , pressurization or the like to the surface areas of the cited portions .

a dispenser for discharging media has a duct including a medium outlet , and a dosage carrier mounted on a base body and including receptacles for receiving doses of the medium entirely enclosed in respective reservoir spaces , a medium holder disposed beneath the reservoir spaces and adjacent the duct for holding the medium when it is released from one of the reservoir spaces , and a device for opening one of the reservoir space to allow the medium to be first deposited in the medium holder , and then picked up and conveyed out the medium outlet by a transfer flow through the reservoir space .

fig1 is a schematic illustration of an intramedullary ( im ) system 10 in place in a femur 20 , in accordance with an embodiment of the present invention . the im system comprises an im nail 30 , having a proximal head 32 and a stem 34 ; at least one screw 40 for securing the im nail at the head within a femoral head 23 of femur 20 ; and at least one sleeve 50 . alternatively , another anchoring element , such as a nail or bolt is used , instead of screw 40 . im system 10 typically further comprises at least one distal anchoring element 60 , such as a screw , nail , or bolt , to secure im nail 30 at stem 34 within a canal 22 of femur 20 . for some applications , head 32 and / or stem 34 define a longitudinal bore ( not shown ). fig2 a is a schematic illustration of head 32 of im nail 30 , and fig2 b is a cross - sectional illustration of head 32 through the line 2 b - 2 b of fig2 a , in accordance with an embodiment of the present invention . head 32 defines at least one hole 36 , typically two holes , as shown in the figures . holes 36 are typically oriented in an angled direction toward a femoral head 23 ( fig1 ) relative to a longitudinal axis of im nail 30 . reference is again made to fig1 . in an embodiment of the present invention , head holes 36 are adapted to receive respective sleeves 50 , which in turn are adapted to slidably receive screws 40 , so as to permit a threaded portion of the screws to engage femoral head 23 and to allow sliding compression of a femoral neck 24 , an intertrochanteric fracture 25 , and / or a subtrochanteric fracture 26 . fig3 is a schematic illustration of sleeve 50 , in accordance with an embodiment of the present invention . sleeve 50 comprises a locking mechanism 51 , which engages head hole 36 , preventing rotational and longitudinal movement between sleeve 50 and head hole 36 . the locking mechanism typically comprises a male coupling element , such as a tab 52 fixed to the outer surface of a depressible tongue 54 , which is adapted to flex inwards toward the center of the sleeve when pressure is applied thereto . when the pressure is removed , tab 52 engages female coupling element , such as a notch 72 of hole 36 , as described hereinbelow with reference to fig4 a . it is noted that in embodiments of the present invention , prevention of rotational and longitudinal movement between sleeve 50 and head hole 36 is not obtained by simply pressure - fitting the sleeve in the hole , or by simply screwing the sleeve in the hole , either of which generally would result in gradual loosening of the sleeve over time . in addition , sleeve 50 typically is shaped to define at least one cutout 56 to receive a screwdriver used by the surgeon to align the tab with the notch , as described hereinbelow with reference to fig4 a and 4b . fig4 a and 4b are cross - sectional illustrations of one of holes 36 of head 32 through the line 4 a - 4 a of fig2 a , in accordance with an embodiment of the present invention . an inner grooved surface 70 of hole 36 is shaped to define a notch 72 , which tab 52 engages when sleeve 50 is inserted into hole 36 and properly aligned , thereby locking sleeve 50 to hole 36 . in the embodiment shown in fig4 a , the radius r 1 of grooved inner surface 70 adjacent to notch 72 is less than the maximum radius r 2 of inner surface 70 in a region further away from notch 72 . to insert sleeve 50 into hole 36 and engage locking mechanism 51 , the surgeon typically first rotationally orients the sleeve so that tab 52 is aligned with a region of hole 36 having maximum radius r 2 , for example at the upper portion of hole 36 . the surgeon then inserts the sleeve in the hole until tab 52 of sleeve 50 meets the upper portion of hole 36 , which blocks further insertion of the sleeve . the surgeon then rotates the sleeve so that tab 52 approaches notch 72 . as tab 52 approaches notch 72 , tab 52 ( and tongue 54 ) is gradually depressed by inner surface 70 , until the tab reaches the notch and the tongue springs back into its original position , forcing the tab into the notch , and locking it therein . such a locking mechanism is generally impervious to loosening under cyclical loading , even over the course of many years . by contrast , two pieces which are attached without a locking mechanism ( e . g ., by being screwed together or wedged together ) are susceptible to gradual loosening over time . in the alternate embodiment shown in fig4 b , the radius r 3 of inner surface 70 adjacent to notch 72 is substantially equal to the maximum radius r 2 of inner surface 70 . hole 36 in this alternate embodiment is typically flared , such that the tab is depressed during insertion of sleeve 50 into hole 36 . insertion of sleeve 50 into hole 36 in this alternate embodiment does not necessarily include rotation of sleeve 50 ( as is described with reference to fig4 a ). fig5 a is a schematic illustration of a head 132 of im nail 30 , in accordance with an embodiment of the present invention . in this embodiment , head 132 of im nail 30 comprises a distal portion 180 , which includes one or more head holes 136 , and a proximal portion 182 . proximal portion 182 is adapted to aid in locating im nail 30 , while distal portion 180 is adapted to be coupled to at least one element , such as a nail , screw , or a sleeve . proximal portion 182 is visually and structurally distinct from distal portion 180 . alternatively or additionally , proximal portion 182 has a diameter d 1 that is less than a diameter d 2 of distal portion 180 adjacent to proximal portion 182 . for some applications , diameter d 1 is between 50 % and about 80 % of diameter d 2 , or is less than about 50 % of diameter d 2 . for some applications , diameter d 1 is between about 25 % and about 50 % of diameter d 2 . typically , for im nails intended for use in adults , diameter d 1 is between about 5 mm and about 10 mm , and diameter d 2 is between about 11 mm and about 17 mm . a length l 1 of proximal portion 182 is typically equal to between about 10 % and about 50 % of a length l 2 of head 132 . for example , length l 1 may be between about 10 mm and about 35 mm , and length l 2 may be between about 40 mm and about 60 mm , in im nails intended for use in adults . although head 132 is shown in the figures as narrowing suddenly , for some applications the diameter of the head decreases gradually from d 2 to d 1 . for some applications , such as for use in conjunction with the techniques described hereinbelow with reference to fig6 or 7 , ( a ) proximal portion 182 is removable , in which case the surgeon typically removes the proximal portion after implanting im nail 30 , or ( b ) head 132 does not comprise proximal portion 182 , so that head 132 does not extend to the surface of femur 20 . fig5 b is a schematic illustration of head 132 of im nail 30 , in accordance with an embodiment of the present invention . in this embodiment , a longitudinal axis of proximal portion 182 is oriented at an angle β with respect to a longitudinal axis of distal portion 180 . angle β is typically between about 4 and about 40 degrees , in this embodiment . optionally , a proximal surface 190 of distal portion 180 is oriented at an angle α with respect to the longitudinal axis of distal portion 180 . angle α is typically between about 4 and about 40 . during an implantation procedure , im nail 30 is typically inserted into femur 20 so that a proximal end 184 of proximal portion 182 is generally flush with or slightly protrudes from a surface region 27 of femur 20 in a vicinity of the greater trochanter or the piriformis ( fig1 ). as a result , a surgeon generally can readily locate the im nail if post - operative access to the implant becomes necessary . in addition , such a narrower proximal portion typically allows greater regrowth and healing of the neck of the femur towards the area of the greater trochanter , than generally occurs upon implantation of conventional im nail heads . for some applications , im nail 30 comprises both narrower proximal portion 182 and locking mechanism 51 , as described hereinabove . for other application , the im nail comprises only one of these features , but is generally otherwise conventional . fig6 is a schematic illustration of an im locating tool 200 , in accordance with an embodiment of the present invention . in this embodiment , proximal portion 32 of im nail 30 does not extend to surface region 27 of femur 20 . without the use of im locating tool 200 , it is sometimes difficult for the surgeon to locate proximal portion 32 of im nail 30 if post - operative access to the implant becomes necessary . a distal end 220 of the locating tool comprises or is removably coupled to one or more connecting elements 240 , which typically comprise a locking mechanism similar to locking mechanism 51 , for locking to im nail 30 , as described hereinabove with reference to fig3 . alternatively , connecting elements 240 comprise another locking mechanism , such as protrusions , clips , or pegs . to use the locating tool , the surgeon temporarily couples connecting elements 240 to respective head holes 36 of im nail 30 . for some applications , the surgeon performs this coupling by removing any sleeves or screws present in holes 36 , and inserting a sleeve ( not shown ), which may be similar to sleeve 50 described hereinabove with reference to fig3 , into each hole 36 . the surgeon then couples each connecting element 240 to one of the sleeves . alternatively , connecting elements 240 are directly coupled to head holes 36 . in either case , after the connecting elements are in a fixed position with respect to im nail 30 , tool 200 is typically placed or slid onto the connecting elements , so as to assume a known , rigid position with respect thereto . ( in embodiments in which connecting elements 240 are an integral part of tool 200 , this step is not necessary .) the use of at least two connecting elements 240 provides for a known , fixed orientation of im locating tool 200 with respect to im nail 30 . for applications that use only a single connecting element 240 , means are provided for ensuring a fixed rotational angle between connecting element 240 and hole 36 , thereby providing a known , fixed orientation of im locating tool 200 with respect to im nail 30 . for example , such means may include a slot in hole 36 . typically , coupling im locating tool 200 to im nail 30 automatically positions a proximal end 230 of the locating tool so as to indicate a site 228 of surface region 27 substantially directly over proximal portion 32 of the im nail . the surgeon typically uses knowledge of the location of site 228 in order to determine an appropriate location at which to drill . for some applications , proximal end 230 comprises means for guiding a marking device 250 or drill , such as a hole through which the marking device or drill is inserted . fig7 is a schematic illustration of an im locating tool 300 , in accordance with an embodiment of the present invention . an im nail 302 comprises a proximal portion 304 which does not extend to a surface region 306 of a femur 308 . the proximal portion defines one or more head holes 310 , and a longitudinal channel 312 open to at least one of the head holes and to a proximal end 314 of proximal portion 304 . without the use of im locating tool 300 , it is sometimes difficult for the surgeon to locate proximal portion 304 of im nail 302 if post - operative access to the implant becomes necessary . im locating tool 300 comprises an elongated element that is both bendable and resilient , i . e ., is able to bend while maintaining longitudinal strength . a tip 316 of tool 300 is sufficiently sharp to pass through femur 308 . in order to locate a site 318 of surface region 306 substantially directly over proximal portion 304 of the im nail , the surgeon inserts tool 300 , sharp end first , into one of head holes 310 . the surgeon guides the tool through channel 312 , so that the tool bends to conform with the channel . after pushing the tool so that tip 316 reaches the end of channel 312 at proximal end 314 , the surgeon continues to push with sufficient force so that tip 316 punches through femur 308 and emerges from surface region 306 at site 318 , thereby externally indicating the location of the site . alternatively , tip 316 is threaded , and the surgeon rotates tool 300 so as to screw tip 316 through femur 308 . further alternatively , tool 300 comprises a flexible drill bit , and the surgeon drills the tool through femur 308 . the surgeon typically uses knowledge of the location of site 318 attained through use of tool 300 in order to determine an appropriate location at which to drill during post - operative access to the im nail . reference is now made to fig8 and 8a , which are schematic illustrations of an introducer 400 applied to a femur 402 , in accordance with an embodiment of the present invention . introducer 400 is adapted to actively reduce and align a fracture 404 of femur 402 , such as a subtrochanteric fracture , while generally minimizing the required size of an incision in the vicinity of the fracture . introducer 400 comprises a support 406 , a coupling element 408 , and a multi - axial control element , such as a biaxial control element 410 . coupling element 408 is adapted to couple introducer 400 to an im nail 412 , which is inserted into a medullary canal 414 of femur 402 . for example , coupling element 408 may comprise a male element adapted to be inserted into a hole defined by a proximal end of a proximal head 416 of im nail 412 . other coupling mechanisms used by conventional introducers may also be used . one or more neck screws 420 secure the im nail at the head within a femoral head 422 of femur 402 . introducer 400 is typically shaped so as to define one or more holes ( not shown ) for guiding respective neck screws 420 during their insertion into femoral head 422 . introducer 400 is shaped to facilitate use with a pin 424 . during a procedure ( which is generally performed using real - time imaging , such as fluoroscopy ), pin 424 is inserted through femur 402 and through an elliptical or otherwise elongated hole 426 , defined by a distal region 428 of im nail 412 in a vicinity of fracture 404 , such that the fracture is between the pin and coupling element 408 . for some applications , pin 424 is threaded in a vicinity of a bone - penetrating tip 430 thereof and / or in a vicinity of one or both regions 432 thereof that pass through femur 402 . pin 424 typically has a diameter of between about 3 and about 6 mm , typically between about 4 and about 5 mm . reference is now made to fig9 a and 9b , which are schematic illustrations of motion of pin 424 , in accordance with an embodiment of the present invention . biaxial control element 410 is adapted to move pin 424 along two axes , as follows : translationally , for example , in a cephalad ( anterior ) direction toward support 406 ( i . e ., in the direction generally indicated by arrow 434 ). in this manner , bone - penetrating tip 430 and a physician - manipulated end 436 of pin 424 generally move equal distances ( fig9 a ). such cephalad movement serves to reduce fracture 404 ; and rotationally , such that bone - penetrating tip 430 and physician - manipulated end 436 move in opposite directions , i . e ., tip 430 moves closer to or further away from support 406 in one of the directions generally indicated by arrow 438 , while end 436 moves in the opposite direction ( fig9 b ). such rotational movement serves to properly align fragments 440 and 442 of femur 402 with one another ( fig8 ). elongated hole 426 typically has a length of about 10 mm to about 12 mm . pin 424 is typically inserted through elongated hole 426 near a distal end thereof , which allows substantial rotation and cephalad motion of the pin before the pin comes in contact with a proximal end of the hole , e . g ., about 10 mm of motion . ( fig8 shows the pin already at the proximal end of hole 426 .) reference is again made to fig8 and 8a . after fracture 404 has been reduced and aligned , a screw ( not shown ) is typically screwed through a hole 444 , defined by distal region 428 of im nail 412 , into fragment 440 , in order to fix im nail 412 to fragment 440 . hole 444 is typically circular and positioned distally to elongated hole 426 ( as shown ), or proximal thereto ( configuration not shown ). pin 424 is then removed from elongated hole 426 . optionally , a second screw ( not shown ) is screwed through elongated hole 426 into fragment 440 to further fix the im nail to the fragment . in an embodiment of the present invention , distal region 428 of im nail 412 defines a secondary elliptical or otherwise elongated hole 446 , in a distal vicinity of elongated hole 426 . in this embodiment , after removal of pin 424 from elongated hole 426 , the pin is inserted through secondary hole 446 . biaxial control element 410 further moves pin 424 in the cephalad direction towards support 406 , in order to further reduce fracture 404 . typically , about 10 mm of reduction is performed using elongated hole 426 , and up to about an additional 10 mm of reduction is performed using secondary elongated hole 446 , for a total reduction of up to about 20 mm . it has been the inventor &# 39 ; s experience that fractures rarely require reduction of more than about 20 mm , after initial reduction with a fracture table . in an embodiment of the present invention , biaxial control element 410 comprises a first member such as a first leg 448 , and a second member such as a second leg 450 , the first and second members comprising set screws 452 and 468 , respectively . the first and second legs each define one or more elliptical or otherwise elongated holes 464 and 458 , respectively . when inserted into elongated hole 426 of im nail 412 , pin 424 passes through one of holes 464 and one of holes 458 . the pin is initially positioned near respective distal ends of the holes . tightening set screw 452 pushes the pin towards a proximal end of the one of the holes 464 , while tightening set screw 454 pushes the pin towards a proximal end of the one of the holes 458 . therefore : tightening both set screws to the same extent and substantially simultaneously moves pin 424 in the cephalad direction towards support 406 ; tightening only set screw 452 rotates pin 424 clockwise , in order to align fragments 440 and 442 ; and tightening only set screw 468 rotates pin 424 counterclockwise , in order to align fragments 440 and 442 . typically , a combination of such tightening motions is performed in order to reduce and align fracture 440 . it is noted that for some configurations ( such as that shown in fig8 ), tightening one of the set screws also induces some net cephalad motion of the center of pin 424 . for some applications , one or both of legs 448 or 450 are removably coupled to support 406 by coupling elements 460 or 462 , respectively ( e . g ., comprising screws or clips ). for example , leg 450 may be removably coupled to support 406 , in which case leg 448 and support 406 are used to insert im nail 412 into intramedullary canal 414 . the absence of leg 450 during this insertion generally makes introducer 400 easier to manipulate . after insertion of the im nail , leg 450 is coupled to support 406 . in an embodiment , biaxial control element 410 comprises an optional shaped element , such as shaped element 454 , coupled within biaxial control element 410 so as to provide means for pulling pin 424 ( or otherwise inducing motion of pin 424 ) in the caudal direction . shaped element 454 is coupled via a joint 456 to the proximal tip of set screw 452 . ( alternatively or additionally , a shaped element is coupled to set screw 452 .) pin 424 passes through a hole in shaped element 454 , such that joint 456 allows set screw 452 to rotate while shaped element 454 substantially does not rotate . in addition , joint 456 couples shaped element 454 and set screw 452 such that movement of either one along the proximal / distal axis induces movement of the other one in the same direction . in particular , distal ( caudal ) motion of set screw 452 causes corresponding caudal motion of pin 424 . ( by contrast , in embodiments not having shaped element 454 or equivalents thereof , proximal motion of set screw 452 causes cephalad motion of pin 424 , while distal motion of set screw 452 does not induce any substantial motion of pin 424 .) it is noted that the configuration and shape of shaped element 454 shown in fig8 is by way of illustration and not limitation . a person of ordinary skill in the art of mechanical design , having read the disclosure of the present patent application , would be able to develop other substantially equivalent means for providing cephalad and caudal motion of pin 424 . in an embodiment of the present invention , introducer 400 is used in conjunction with a surgical plate having one or more elliptical or otherwise elongated holes through which pin 424 is inserted ( configuration not shown ). the plate is secured to the outside of femur 402 in a position suitable for reducing fracture 404 and for aligning fragments 440 and 442 . for this embodiment , techniques described hereinabove with reference to fig8 , 9 a , and 9 b are adaptable for use with the surgical plate , in a manner which would be readily ascertainable by one skilled in the art to which this invention pertains . it will be appreciated that although some embodiments of the present invention have been shown and described herein for use in a femur , these embodiments may be adapted for use in other long bones of the extremities , such as the tibia and humerus , in a manner which would be readily ascertainable by one skilled in the art to which this invention pertains . it will also be appreciated by persons skilled in the art that the present invention is not limited to what has been particularly shown and described hereinabove . rather , the scope of the present invention includes both combinations and subcombinations of the various features described hereinabove , as well as variations and modifications thereof that are not in the prior art , which would occur to persons skilled in the art upon reading the foregoing description .

apparatus for treating a fracture of a bone of a subject including an intramedullary nail insertable into a medullary canal of the bone of the subject . the im nail has a proximal head that defines at least one hole therethrough . a sleeve , which includes a locking mechanism , is engaged with the hole when the sleeve is inserted in the hole . this engagement prevents rotational movement between the sleeve and the nail and inward and outward longitudinal movement of the sleeve relative to the nail .

in carrying out my invention i show in fig1 a transverse section through a commercial dishwashing machine indicated generally at a . the machine has a dish - receiving compartment b , in which the ware may be washed , rinsed and sterilized . since the novelty in the present invention lies in the particular shape of the spray manifold and the means for quickly mounting it in the compartment b , or removing it therefrom , i have not shown in detail how the ware is moved into and out from the compartment because this may be done by hand or by a mechanism . the rear wall 1 of the compartment b has a hot water inlet pipe c , and if the compartment is used for washing the ware , the hot water should be at a temperature of 140 ° f ., and the detergent may be mixed with this hot water and then pumps , not shown , may be used for recirculating the wash water for a predetermined time period . on the other hand , if the compartment is used for rinsing and sterilizing the ware at a low temperature of 140 ° f ., for the hot water , a sterilizing agent such as chlorine , is mixed with the hot water and the water is recirculated for a predetermined time period in the compartment . in my copending patent application on a low temperature conveyor rack - type dishwasher , ser . no . 26 , 016 , filed apr . 2 , 1979 , i show the rinse compartment divided into two sections , the first section using hot rinse water at 140 ° f ., for removing the detergent wash water from the ware and the second section using chlorine in the 140 ° f ., rinse water for rinsing and sterilizing the ware . i will now describe in detail the particular structure of the hot water inlet pipe c and the novel means for removably supporting the inlet end of a spray manifold shown at d , in fig1 and 3 . the hot water inlet pipe c , is arranged in a vertical position and is in communication with a source of hot water , not shown . the top of the hot water inlet pipe c , is closed at 4 , see fig3 and the front portion of the pipe has a hot water outlet opening 5 therein . a u - shaped bracket e , see fig2 and fig4 has its web portion 6 extending across the front portion of the pipe c and it has an opening 7 that registers with the opening 5 in the inlet pipe . the bracket e , is secured to the wall 1 of the dishwasher a by bolts 8 or other suitable fastening means . a support f for the inlet end of the spray manifold d , is secured to the web portion 6 of the bracket e by bolts 9 . both fig3 and 4 show the spray manifold support f provided with a conical - shaped outlet 10 that is in alignment with the openings 5 and 7 of the hot water inlet pipe c , and the bracket e , respectively . the inlet end of the spray manifold d has an outwardly flared portion 11 that receives the conical - shaped outlet 10 of the manifold support f , and makes a water tight seal therewith . the spray manifold has a plurality of jet nozzles g , arranged in a straight row and spaced from one another as shown in fig1 . i provide novel cooperating means on the spray manifold support f , and the spray manifold d for arranging the row of jet nozzles g , in the proper angular position when the inlet end 11 of the spray manifold is coupled to the conical outlet 10 of the manifold support . the particular structure of the hot water pipe c , and the bracket e , may be altered without affecting one of the vital features in this invention . the point to keep in mind is that the support f for the inlet end of the spray manifold d , is anchored in a specific place in the compartment b of the dishwasher and the support f not only has a conical outlet 10 that is in communication with and receives hot water from the hot water inlet pipe c , but in addition , the support has an integral guide wing 12 shown in detail in fig3 and 4 , that underlies a portion of the inlet end 11 of the spray manifold d . also , the guide wing 12 has a central recess 13 with outwardly curved side edges 14 that will guide a pin 15 , which depends from the manifold d , into the recess as clearly shown in fig4 . the center of the guide wing recess 13 lies in a vertical plane in which the longitudinal axis of the manifold d , also lies . the axes of the jet nozzles g , lie in the same vertical plane in which the pin 15 lies . the result is that the mere coupling of the flared inlet end 11 of the manifold d to the conical outlet 10 of the manifold support f will also properly align the row of jet nozzles g , at the correct angle because the coupling cannot be made until the pin 15 is received in the guide wing recess 13 . i have illustrated the spray manifold d , in fig3 and 4 , as directing the hot water spray downwardly from the jets g , because in this case the manifold is positioned above the dish ware , not shown , in the compartment b . it is also possible to place this spray manifold d below the dish ware in the compartment and when this is done , the manifold support f , is rotated about the axis of the conical outlet 10 through a full 180 ° arc so that the guide wing recess 13 will be positioned above the manifold and the manifold will have to be rotated 180 ° on its axis for causing the pin 15 and the jet nozzles g to project upwardly and cause the jets g to point upwardly for causing the hot water to contact the dish ware from the underside . in actual practice there will be at least one spray manifold d placed above and one manifold placed below the dish ware for directing the hot water downwardly and upwardly against the dishes and my invention is broadly drawn to include both arrangements of the manifold or either one . the apparatus for supporting and closing the front end of the spray manifold d , is shown in fig1 and 5 . an arm h , is connected to the top 16 of the dish washer a by bolts 17 or other suitable fastening means . the arm has a downwardly inclined portion 18 and fig5 shows this portion as having an integral boss 19 with a threaded bore 20 whose axis lies in a horizontal plane . a closure cap j , for the front end of the spray manifold d , has an axially aligned and integral threaded rod 21 that is received in the threaded bore 20 in the boss 19 . the cap has a conical - shaped central portion 22 that protrudes from the interior of the cap and whose center is in alignment with the axis of the rod 21 . this conical portion 22 is received in the outwardly flared front end 23 of the spray manifold d , and will make a liquid tight seal with the manifold as well as support it . the cap j may be connected to or disconnected from the front end of the spray manifold d , without the need of any tools . the cap has an integral and outwardly flared skirt or rim 24 and this rim has scallops 25 therein to permit the operator &# 39 ; s fingers to grip the rim for rotating the cap in one direction for connecting the cap to the front end of the manifold for closing and supporting the manifold or for rotating the cap in the opposite direction for freeing the cap from the manifold . the axis of the threaded rod 21 of the closure cap j , is in horizontal alignment with the center of the conical outlet 10 of the manifold support f so that when the manifold d is supported at its outwardly flared forward end 23 by the closure cap j and is supported at its hot water inlet end by the conical outlet 10 of the manifold support f , the axis of the manifold will be in alignment with the axis of the threaded rod 21 and with the center of the conical outlet 10 . in addition , the manifold d will have a water tight seal between the cap conical portion 22 on the cap and the outwardly flared forward end 23 of the manifold as well as have a water tight seal between the conical outlet 10 of the support for the inlet end of the manifold and the outwardly flared end 11 of the manifold . a rotation of the cap j , in one direction will accomplish this and will move the manifold against the conical outlet 10 . therefore a rotation of the cap in one direction will cause the manifold to be supported at both of its ends as well as water sealed at both of its ends . when the cap is rotated in the opposite direction , the spray manifold will be freed at both of its ends and may be removed for inspection and cleaning . the hollow cylindrical interior of the manifold is unobstructed throughout its entire length so that a cleaning brush or cloth can be used for cleaning purposes . this is one of the novel features of my present invention and the other feature is the automatic aligning of the spray jets g , so that they will be held at the proper angle for spraying the hot water either downwardly against the dish ware or upwardly against them or both . it should be noted from fig2 and 4 that the support f , for the inlet end 11 of the spray manifold d , has arcuate - shaped slots 26 for receiving the shanks of the bolts 9 . the center for these arcuate slots coincides with the axis of the opening 7 in the bracket e . it is possible with this structure to loose the bolts 9 and rotate the support f , clockwise or counterclockwise through a desired angle so as to swing the guide wing 12 and its guide slot 13 to the right or to the left of a vertical plane that extends through the common axis of the openings 5 , 7 and 10 . now when the manifold d , is connected to the member f , the manifold must be rotated on its longitudinal axis to swing the pin 15 into alignment with the guide slot 13 whereupon the manifold can be moved to cause the pin 15 to enter the guide slot . in this simple manner , the nozzles g on the manifold d will be inclined at the desired angle .

a removable and self sealing spray manifold that has an unobstructed cylindrical interior extending throughout its entire length . novel self sealing and manifold supporting means is provided at each end of the manifold . the rear end supporting means for the manifold connects the manifold to a hot water inlet pipe and includes means for correctly positioning the spray nozzles for directing the hot water against the ware in the racks . the means for supporting the front manifold end includes a self - sealing cap that can be removably connected to the manifold without the need of using any tools .

‘ kinnowls ’ is a mandarin selection developed at riverside and exeter , calif . by mutation breeding of the mandarin cultivar ‘ kinnow ’, for which harvest is typically begun from mid - january to mid - february , depending on location . evaluation of ‘ kinnowls ’ began on the original tree at exeter , calif . in 2001 and has continued annually until the present . ‘ kinnowls ’ has been asexually reproduced by grafting ( budding ), using the standard t - bud method generally used to propagate citrus in california . asexual propagation of the selected tree was first accomplished in january 2003 at exeter , calif . to produce 72 trial trees on carrizo and c35 rootstocks . ‘ kinnowls ’ distinguishes itself by being low seeded ( 2 - 3 seeds / fruit ) in all situations of cross - pollination , while ‘ kinnow ’ has 15 - 30 seeds per fruit in cross - pollinated situations . at riverside , calif . ‘ kinnowls ’ matures in winter ( mid - january ) and holds its fruit quality characteristics through april . fruit size is large for mandarins , classed as jumbo by state of california standards and size 21 for industry packing standards . fruit are oblate in shape with an orange rind color and a very smooth rind texture . flesh is deep orange in color and finely - textured . fruit are easy to peel and juicy , with a rich , sweet and distinctive flavor when mature . tree growth habit is vertical and vigorous , producing a large and rather dense upright crown with excellent production commencing in the third year after planting . ‘ kinnowls ’ is well adapted to growing in all california climate zones normally associated with citrus , including desert regions , because the fruit , which matures during january through april at most locations , does well in hot climates where it matures in december . alternate bearing can be a problem in trees that are not culturally managed to reduce this tendency . ‘ kinnowls ’ mandarin can be grown according to accepted cultural practices for larger , more vigorous mandarin varieties , including planting densities of 180 - 250 trees per acre , normal fertilization and pest control practices , and the use of standard rootstocks for mandarins . other rootstocks adapted to more marginal growing conditions of salinity , high ph or very heavy soils , including the lemon types c . macrophylla , volkameriana , and rough lemon , may be useful in those conditions but overall fruit quality would likely be affected negatively . sour orange or mandarin type rootstocks such as cleopatra might be more suitable in these marginal conditions since fruit quality would not be affected to the extent the lemon - type rootstocks impart . ‘ kinnowls ’ is a very vigorously growing tree and therefore pruning will likely be necessary to control this vigor . such pruning should include topping the trees to control vertical growth and selective interior pruning to enhance production and health of the tree . these pruning procedures can be applied after the second year of full fruit production and regularly thereafter . the royal horticulture society ( r . h . s .) color numbering system is used herein for the color description of the rind , seed , bark , leaf , flower , flesh color and other interest of the ‘ kinnowls ’ mandarin cultivar . a comparison of ‘ kinnowls ’ with other low - seeded late - season mandarins is provided in table 1 below . ‘ kinnowls ’ is distinctive in having a very wide climatic growing area ( including very hot desert areas ), excellent production ( though some tendency to alternate bear ), and fruit quality characteristics ( large size , shape , very smooth rind texture , and very rich , sweet flavor ) that may be preferred in some markets . tree size and growth characteristics of ‘ kinnowls ’ have been consistent with those of ‘ kinnow ’ throughout the evaluations . growth of both the ‘ kinnow ’ and ‘ kinnowls ’ varieties have been quite vigorous throughout the evaluation period , producing large , vertically growing trees with dense crowns . the eleven - year - old ‘ kinnowls ’ mother tree at lindcove , calif . on carrizo citrange rootstock , shown in fig3 , is 3 . 1 m high and 3 . 0 m wide with an upright , though beginning to spread , crown exhibiting a dense growth habit and yielding a canopy volume of 14 . 6 m 3 . in comparison , an eleven - year - old ‘ kinnow ’ control tree has averaged 3 . 1 m tall and 2 . 9 m wide , yielding a canopy volume of 13 . 7 m 3 on carrizo citrange rootstock . these trees are smaller than normal because they were in a very high density planting until surrounding trees were removed at 7 years - of - age . in the younger , multi - location trials with more typical tree spacing , five - year - old ‘ kinnowls ’ trees on carrizo rootstock have averaged 3 . 1 m in height and 2 . 9 m in diameter with canopy volumes of 13 . 7 m 3 . trees on c35 rootstock averaged 3 . 2 m in height and 3 . 0 m in diameter with canopy volumes of 15 . 1 m 3 . bud unions are slightly benched , as shown in fig5 , resulting in a scion circumference for the eleven - year - old ‘ kinnowls ’ mother tree on carrizo rootstock of 44 . 5 cm with the rootstock circumference 56 . 5 cm measured 38 and 18 cm above the soil level , respectively . scion circumference for five - year - old ‘ kinnowls ’ trees on carrizo rootstock averaged 40 . 0 cm with the rootstock circumference averaging 50 . 5 cm when measured about 25 and 15 cm above the soil level , respectively . scion circumference for five - year - old ‘ kinnowls ’ trees on c35 rootstock averaged 41 . 0 cm with the rootstock circumference averaging 51 . 5 cm when measured about 25 and 15 cm above the soil level , respectively . leaves of ‘ kinnowls ’, as shown in fig7 , are moderately large for a mandarin ( 80 . 8 mm in length × 25 . 5 mm in width ), lanceolate in shape and concave in cross - section and are dark - green in color ( adaxial — rhs green 137a , abaxial — rhs yellow - green 146b ). the leaves have an acute apex with occasional weak emargination and an acute base . petioles are medium in length ( 10 . 1 mm ) and normally lack wings . the selection further lacks thorns . as shown in fig8 , flowers of ‘ kinnowls ’ are hermaphroditic , borne in clusters , medium in length , with greenish - white ( rhs green white 157d , adaxial and abaxial ) petals averaging 13 . 1 mm in length and 6 . 2 mm in width , and with about 18 anthers which are yellowish in color ( yellow 13b ). the five sepals are rudimentary , yellow - green ( rhs yellow green 1d ) in color and partly fused into a calyx . the free portion of the sepals averages 1 . 53 mm in length and 1 . 97 mm in width . the fused portion is about 1 . 0 mm in length . pollen is yellowish in color ( rhs yellow 12b ). z , y bud union measurements are averages for 5 - year - old trial trees on carrizo z or c35 y measured about 10 cm above ( for scion ) and 10 cm below ( for rootstock ) budunion , generally about 15 and 25 cm above soil . pollen viability for ‘ kinnowls ’ is moderately low ( 15 - 25 % germination ) in comparison to ‘ kinnow ’ (˜ 70 % germination ), and pollen production in comparison to normal ‘ kinnow ’ is significantly reduced . these pollen characteristics suggest that ‘ kinnowls ’ will not cause appreciable seediness in adjacent varieties . crosses of ‘ kinnowls ’ pollen onto clemenules and w . murcott gave low fruit set ( 6 and 9 % respectively ) and fruit set from these pollinations had few seeds ( average 1 . 8 and 2 . 2 seeds / fruit respectively ). as shown in fig1 , fruit of ‘ kinnowls ’ are oblate in shape with no neck . the fruit has a rounded basal end which is flattened at the stem attachment point with a truncate ( slightly depressed ) distal end . the fruit is large - sized for a mandarin ( classed as jumbo by state of california standards and size 21 for industry packing standards ) averaging 2 . 7 in ( 68 . 0 mm ) in diameter and 2 . 2 in ( 55 . 2 mm ) in height . fruit average 0 . 32 lb ( 145 g ) in weight . it has a very smooth , orange color rind and slightly conspicuous , slightly depressed oil glands . the rind is slightly adherent at maturity and relatively thin , averaging 0 . 1 in ( 2 . 5 mm ) in thickness . fruit peel easily . the fruit interior has a moderately fine flesh texture with 10 - 11 segments and is quite juicy , averaging 49 % juice . fruit from trees on carrizo and c35 citrange rootstocks average 12 . 2 - 13 . 9 % soluble solids and 1 . 26 - 2 . 09 % acid in mid - january at four trial locations in california increasing in soluble solids to 13 . 5 - 15 . 8 % with acid decreasing to 0 . 97 - 1 . 98 % in mid - february . by mid - march juice averaged 13 . 3 - 17 . 0 % soluble solids and 0 . 80 - 1 . 87 % acid . fruit generally continue to increase in soluble solids and decrease in acidity well into april and may at all trial sites . see tables 4a - 4b below for mean and standard deviation of soluble solids , acid and solids / acid ratio for ‘ kinnowls ’ on various rootstocks from 2007 to 2009 . the earliest recommended harvest date occurs when fruit reach average soluble solids content of at least 12 % and an average acid content of less than 1 . 2 %. this may occur as early as late november in hot desert regions ( coachella valley of calif . ), but can be as late as early april in cool locations ( irvine , calif .) or years ( 2008 - 9 ). based on evaluation of an average of 1500 fruit per location , fruit average 2 . 45 seeds per fruit in the presence of heavy cross - pollination at all locations from 2007 to 2009 . rarely , individual fruit may have 4 - 7 seeds . in the 2010 - 11 season one tree was identified with a branch on which most fruit had high seed content ( more than 10 seeds / fruit ). however , for 5200 fruit sampled from trail trees during 2009 - 10 and 2010 - 2011 , the percentage of seedy fruit was about 0 . 06 %. seeds are polyembryonic . see table 5 below for average number of seeds per fruit for ‘ kinnowls ’ and ‘ kinnow ’ ( control trees ) from 2007 to 2009 . seeds are polyembryonic , with a wrinkled surface and greyed yellow seed coat ( rhs 161c ). seeds average about 140 mg in weight , with about 10 % of seeds much smaller and apparently lacking developed embryos . full fruit production of ‘ kinnowls ’ normally begins in the third year after planting , however trees can be precocious and set some fruit in the second year after planting . fig4 and 6 illustrate fruit production on a three - year old tree . ‘ kinnowls ’, is similar to ‘ kinnow ’ in reaching high production levels relatively quickly . mean yield of five year - old trees ranged from 152 - 211 lb ( 69 - 96 kg ) on carrizo rootstock and 165 - 196 lb ( 75 - 89 kg ) on c35 rootstock at the four fruiting trial sites . the original ‘ kinnowls ’ mother tree at lindcove , calif . produced 156 lb ( 71 kg ) in the fifth year and in years 9 , 10 and 11 yielded 191 , 101 , 240 lb of fruit respectively , which indicates that the variety has somewhat of a tendency to alternate bearing . in this respect , it is similar to ‘ kinnow ’, which can exhibit severe alternate bearing if the crop is not managed to reduce overproduction in ‘ on ’ years . fruit storage trials included storage of washed but not waxed fruit at 5 . 6 ° c . for up to 30 days with fruit samples taken every 15 days for analysis . data indicates that the storage characteristics of ‘ kinnowls ’ are very good with very little measureable loss of rind quality or color , no significant loss in juice quality or deterioration in taste , and no significant indication of fungal or other disease problems over the 30 day storage period . overall ‘ kinnowls ’ can be considered to be very good in storage ability for 4 - 6 weeks under controlled environment storage conditions . no susceptibilities to plant or fruit diseases , or to pests , beyond those normally associated with citrus species , have been observed .

‘ kinnowls ’ is a mid - to late - season maturing diploid mandarin that combines large - sized fruit of excellent quality and production with low seed content even in mixed plantings . it may be successful in the mid - to - late season marketing window that currently has few low - seeded , high quality cultivars .

with reference to the drawings , which are provided by way of example , for purposes of illustration , and not by way of limitation , the present invention provides for a throwing toy 10 having a leading end 12 , a trailing end 14 , and a longitudinal throwing axis 16 extending along a length of the throwing toy from the leading end to the trailing end of the throwing toy . the throwing toy includes a main body 18 having an elongated , ellipsoidal shape , a leading end 20 and a trailing end 22 , and a fin mounting portion 24 integrally connected to the trailing end of the main body . in a presently preferred aspect , the fin mounting portion is a generally tubular tail portion . the fin mounting portion includes a plurality of fins 26 mounted on the fin mounting portion of the throwing toy , each of the fins having a leading edge 28 , a trailing edge 30 , and a common aerodynamic angle of attack relative to the longitudinal axis . the fins are connected to the fin mounting portion and are configured for rotation of at least one of the leading edge and trailing edge relative to the other of the leading edge and trailing edge . the fins typically are formed of generally planar pieces of polymeric material or other similar suitable pliable material , and are typically adhered along at least a portion of an inner edge 31 of the fins to the outer surface of the generally tubular tail portion at the trailing end of the throwing toy , such as in slots or fin trays 32 , for example . in a presently preferred aspect , the fins are configured to be rotated simultaneously together to present a plurality of aerodynamic surfaces oriented with the same aerodynamic angle of attack , to cause the toy to rotate about the longitudinal throwing axis when the throwing toy is thrown . the fins can be rotated and set together at a desired angle of attack relative to the longitudinal throwing axis between maximum angles of attack on either side of the longitudinal throwing axis , such as to be in line with the throwing axis and to rotate at an angle on either side of this axis , for example . in one presently preferred embodiment , the leading edges of the fins are connected to a common rotatable member 33 , such as a rotatable adjustment ring , for example , that is rotatably connected to the main body , and which in one preferred aspect can extend radially outwardly from the fin mounting portion . the common rotatable member is typically rotatably connected to the main body by a ratchet mechanism , such as a plurality of detents , for example , allowing the common rotatable member to be rotated and set in a desired position relative to the main body and fin mounting portion . alternatively , the common rotatable member can be similarly rotatably connected to the fin mounting portion to be rotated and set in a desired position relative to the main body and fin mounting portion . in a presently preferred aspect , each of the fins includes a flange or extension 34 , best seen in fig6 , 7 and 8 , extending from the leading edge of the fin that protrudes through a corresponding one of a plurality of holes 36 , shown in fig6 , provided in the rotatable adjustment ring , so that each fin rotates about a medial pivot point 38 on the fin located rearwardly of the flange or extension . when the adjustment ring is rotated about the longitudinal throwing axis of the throwing toy , the flanges or extensions protruding into the adjustment ring are caused to correspondingly be rotated and set the angle of all the fins to a new angle of attack , so that when one fin is adjusted all fins are adjusted simultaneously . alternatively , the fins can be mounted to the fin mounting portion of the throwing toy by pivot pins extending into the fin mounting portion at medial pivot points , and a mechanism can be provided that connects the pivot pins 39 of each fin with gears , a filament , or the like , so that when one pivot pin is rotated all pivot pins rotate , causing the fins to rotate together . in a presently preferred aspect , a simple locking mechanism such as a lockable tab or detent may additionally be provided on an adjustment ring to prevent movement from a setting until the thrower so desires . in another presently preferred aspect , an axial tubular bore 40 , shown in fig4 and 6 , is defined within the main body and fin mounting portion of the throwing toy , and extends along the longitudinal throwing axis through the throwing toy from the leading end of the main body of the throwing toy to the trailing end of the fin mounting portion of the throwing toy . in another presently preferred aspect , the throwing toy includes an internal electronic timer and timer display 42 disposed in the main body of the throwing toy for measuring , recording and / or displaying the time the throwing toy is in the air , the “ hang time ” after it is thrown and before it is caught or flight is otherwise terminated , such as by hitting the ground . the electronic timer is started when the throwing toy leaves a thrower &# 39 ; s hand , and is stopped by sensing the impact when the throwing toy is caught or hits the ground . a device such as a weight on a spring can be used to sense the acceleration when thrown and the deceleration on being caught or hitting the ground . the number displayed can be a multiple of the seconds recorded to make the differential times more determinable and make the numerical impact more dramatic for an individual user who is using the timer and adjustable fins to improve his or her performance . there are numerous configurations of apparatus within the scope of the invention to adjust the angle of the fins simultaneously including , but not limited to connecting either end of the fins to a common structure or element so that when one fin is adjusted all fins are adjusted , and a mechanism that connects the pivot point of each fin with gears , filament , and the like , so that when one pivot is rotated all pivots rotate . the invention may be embodied in other forms without departure from the benefits and characteristics described . the embodiments described therefore are to be considered in all respects as illustrative and not restrictive . although the present invention has been described in terms of certain preferred embodiments , other embodiments that are apparent to those of ordinary skill in the art are also within the scope of the invention . accordingly , it is not intended that the invention be limited , except as by the appended claims .

apparatus and method of adjusting the angle of attack to the longitudinal axis of a plurality of aerodynamic surfaces on a high performance throwing toy which affect the performance of such toy and to also provide a means of measuring such performance by recording the time the toy is airborne during flight .

with reference to fig1 through 3 , a preferred embodiment of the leg support crutch 10 is shown as applied to a user ( shown in phantom ). the leg support crutch 10 is defined by a leg cradle 12 , preferably molded in unitary construction , and a detachable support strut 14 . an interengaging structure 16 connects the support strut 14 to the leg cradle 12 in a manner that permits quick detachment and adjustment relative to the cradle , as well as connects the support strut 14 to the cradle 12 in at least two different positions relative to a vertical axis a of the cradle 12 , as described below . the leg cradle 12 supports the thigh , knee and lower leg of a user recuperating from a lower leg or foot injury in a manner that comfortably transfers the weight of the user through the cradle 12 to the support strut 14 . this is done in a manner that also simulates the balance and support normally provided by the user &# 39 ; s lower leg and foot , thus enhancing recuperation while the user remains ambulatory . the leg cradle 12 includes a desirably plurality of fasteners -- four fasteners 20 , 22 , 24 and 26 in the illustrated embodiment -- to securely attach the user &# 39 ; s thigh and lower leg to the leg cradle while in use . each fastener is strategically positioned along the cradle 12 to firmly hold the user &# 39 ; s leg within the cradle 12 without unduly constricting user &# 39 ; s leg . as seen in fig1 through 3 , the leg cradle 12 is principally defined by a first portion 30 , which bears against the user &# 39 ; s thigh , and a second portion 32 , which carries the user &# 39 ; s lower leg . the first and second portions 30 , 32 are contoured to loosely conform to the shape of a user &# 39 ; s thigh and lower leg , respectively . thus , both the first and second portions 30 , 32 generally have an arcuate channel that wraps about a anterior portion of the user &# 39 ; s leg . the channel generally has a u - shaped cross - sectional shape formed between side walls and an interconnecting wall , i . e . a front wall on the first portion 30 and a bottom wall on the second portion 32 . the first and second portions 30 , 32 are formed in a generally l - shaped configuration . the intersection 34 of the first and second portions 30 , 32 is curvilinear in profile to loosely conform to the user &# 39 ; s knee . as shown more clearly in fig2 the contour of the entire leg cradle 12 closely resembles the contour of the front and sides portions of a user &# 39 ; s thigh , knee and lower leg , but not so closely , when in use , so as to uncomfortably constrict the user &# 39 ; s leg . an unobstructed view of the leg cradle 12 is also shown in fig5 . as seen in fig1 the first portion 30 is formed about a generally vertical axis &# 34 ; a &# 34 ; that intersects , in generally normal relationship , with a generally longitudinal axis &# 34 ; b .&# 34 ; the second portion 32 is arranged to lie generally parallel to this longitudinal axis &# 34 ; b &# 34 ;. in one embodiment , the angle between the longitudinal axes &# 34 ; a &# 34 ;, &# 34 ; b &# 34 ; is acute by approximately 5 ° from normal so that , when the user is standing upright in the leg support crutch 10 , the user &# 39 ; s lower leg is supported by the second portion 32 in a slightly elevated manner , with the foot slightly higher than the knee . that is , the angle between the first and second portions is about 85 °. this elevation of the lower leg enhances fluid draining away from the user &# 39 ; s foot and ankle , as well as and blood circulation , during recuperation . it should be recognized that , depending upon the nature of the injury to the lower leg or foot , the incident angle between the first and second portions 30 , 32 may depart from normal by varying degrees without losing the benefits of the present leg support crutch . the length of the first portion 30 desirably equals approximately two - thirds to three - quarters of the length of the user &# 39 ; s thigh , such that the first portion 30 extends substantially up the user &# 39 ; s thigh . this length serves the advantage of extending the moment arm created by the first portion 30 , as discussed in detail below , which serves to minimize the forces experienced by the user &# 39 ; s thigh during use . the extended length of the first portion 30 also serves the advantage of increasing the area across which forces are spread about the user &# 39 ; s thigh , further minimizing the forces experienced by the thigh . the second portion 32 desirably has a length sufficient to support generally the entire length of the user &# 39 ; s lower leg . in the illustrated embodiment , the second portion 32 extends to a point below the user &# 39 ; s calf and just above the user &# 39 ; s ankle to adequately support the user &# 39 ; s foot . the outer end of the second portion 32 ( i . e ., the end near the user &# 39 ; s ankle ), however , does not extend so far as to cause discomfort to the user &# 39 ; s dorsal foot and ankle . the length of the second portion is at least as long as the length of the first portion . with reference now to fig1 and 5 , a pair of integral gussets 36 extend between the first portion 30 and the second portion 32 . in the illustrated embodiment , the gussets 36 are integrally formed with the sides of the first and second portions 30 , 32 and are arranged to straddle the side of the user &# 39 ; s thigh and lower leg , when worn . the gussets 36 reinforce the leg cradle 12 and transfer the weight of the second portion &# 39 ; s outer end ( which supports the user &# 39 ; s foot and lower leg ) to the first portion 30 ( thereby functioning as trusses ). the gussets 36 also advantageously eliminate the direct transfer of rotational forces from the weight of the user &# 39 ; s lower leg to the strut where shear forces would otherwise be generated on the strut . the leg cradle 12 preferably has curled edges 38 throughout , wherein the edges curl away from the user &# 39 ; s body , as shown in fig1 through 3 . this feature minimizes the risk of abrasive contact between the user and the edge of the cradle while in use . the edges also serve the added benefit of reinforcing the cradle 12 about the gussets 36 as they transfer weight from the second portion 32 to the first portion 30 . unlike other leg support crutches that consist of multiple bands mechanically interlinked to simulate a cradle , the preferred embodiment of the leg cradle 12 is made of unitary construction and conforms to the contour of the user &# 39 ; s thigh and leg . this construction more evenly distributes the forces borne the user &# 39 ; s thigh during use , as discussed further below . in the preferred embodiment , the leg cradle 12 is made of molded fiberglass that permits construction of a highly contoured cradle designed to comfortably support a user &# 39 ; s thigh and lower leg by virtually encasing the front and side portions of the thigh and lower leg . this construction also permits highly customized leg support crutches . other similarly sturdy and moldable materials of course can also be used , such as for example plastic ( e . g ., pvc or abs ) and the like . the cradle 12 also desirably includes an insert pad 40 to provide further comfort and secure fit . in the illustrated embodiment , the insert pad 40 is made of textured neoprene ; however , other suitable material ( e . g ., nylon - wrapped foams ) can also be used . as shown in fig5 the insert pad 40 , has a contour conforming generally to the inner surface of the cradle 12 that permits a slip fit of the insert pad 40 into the interior of the cradle 12 . the edges of the insert pad 40 desirably extend beyond the curled edges 38 of the cradle 12 to further protect the user against potential abrasive contact with the rigid cradle during use . fig1 and 5 also illustrate the support strut 14 which includes a rigid longitudinal portion . the rigid longitudinal portion in the illustrated embodiment comprises a telescoping support 44 . the telescoping support 44 includes two concentric tubes 46 , 48 in which an upper end of the smaller diameter tube 46 engages the interengaging structure 16 ( which is described below ). quick - release engagement of the support strut 14 with the leg cradle is permitted by providing a quick - release fastener 50 positioned at the distal end of the smaller diameter tube 46 . the quick - release fastener 50 mates with a corresponding feature in the interengaging structure 16 . the smaller and larger diameter tubes 46 , 48 are movable with respect to each other in a telescoping fashion to adjust the overall length of the telescoping support 44 . a second quick - release fastener 52 is used to securely fasten these tubes together once the length of the support 44 has been adjusted to a desired length . in the illustrated embodiment , the quick - release fasteners each comprise a detent mechanism ; however , other type of known quick - release fasteners can also be used . the quick - release fastener 52 at the lower end of the support 44 includes a pair of spring - biased detent balls positioned at opposite ends of the smaller diameter tube 46 . the larger diameter tube 48 includes a plurality of holes 54 aligned in series to receive the second quick - release fastener 52 . the second quick - release fastener 52 itself may be adjustably positioned within one of a series of holes 58 in the smaller diameter tube 46 . the upper quick - release fastener 50 includes a similar structure and cooperates with a pair of holes formed in the corresponding structure of the interengaging structure , as described below . at a lower end of the support strut 14 , the larger diameter tube 48 supports a non - skid cap 60 preferably made of rubber or other suitable material to minimize slippage of the support strut 14 with the ground during use . the non - skid cap 60 may be of various configurations and preferably comprises a generally form fitting sleeve closed at the distal end to increase the area of engagement between the support strut 14 and the ground . other configurations are contemplated , including a form fitting sleeve that includes a plurality of projecting feet each of which engage the ground in a non - skid manner . with reference to fig1 and 4 , the leg cradle 12 detachably connects to the support strut 14 via an interconnecting structure 16 positioned near the intersection between the first and second portions 30 , 32 . the interconnecting structure 16 permits quick detachment of the support strut 14 from the leg cradle 12 and permits the user to adjust the support strut &# 39 ; s position relative to the vertical axis &# 34 ; a &# 34 ; of the cradle 12 . in the illustrated embodiment , best seen in fig1 a and 6b , the interconnecting structure comprises a plurality of studs 70 that depend from the leg cradle . these studs 70 generally extend parallel to the vertical axis &# 34 ; a .&# 34 ; fig6 a and 6b show the studs 70 projecting from the underside of the cradle 12 . the studs 70 desirably form a geometric pattern that , in the illustrated embodiment , is a rectangle 72 . a connecting plate 74 is mechanically secured to the studs 70 . as seen in fig6 a and 6b , the connecting plate 74 includes a plurality of holes 80 arranged in sets of geometric patterns that correspond with the geometric pattern 72 of studs 70 . there are preferably at least two sets of hole patterns 84 , 86 that ensure proper mating of the plate 74 to the studs 70 and define at least two positions of the support 44 relative to the front wall of the first portion 30 . to attach the connecting plate 74 to the studs 70 , and , thus , secure the socket sleeve 76 to the leg cradle 12 , a plurality of wing nuts 90 may be used to securely tighten the connecting plate 74 against the cradle 12 . by providing a plurality of hole patterns which mate with the plurality of studs 70 , a user may adjust the support strut 14 with respect to the leg cradle 12 to more closely define a collinear relationship between the user &# 39 ; s femur and the support strut 14 , where desired . fig1 shows the support strut 14 in collinear alignment with the longitudinal axis &# 34 ; a &# 34 ; of the first portion 30 and the user &# 39 ; s femur . by doing so , the present leg support crutch 10 transfers the weight of the user &# 39 ; s body through the femur to the support strut 14 and minimizes stress to the user &# 39 ; s knee from the shear and torsional forces that may result from misalignment of the strut 14 and the femur . in effect , adjustability permits the user to place the strut in a location that most comfortably permits ambulatory movement . as seen in fig1 the connecting plate 74 supports a socket sleeve 76 for detachable holding the support strut 14 to the leg cradle 12 . the socket sleeve 76 includes a hole 78 therethrough that receives the detent balls of the quick - release fastener 50 to releasably lock the strut 14 to the socket sleeve 76 . fig1 also shows the support strut 14 securely fastened to the cradle 12 . the connecting socket 76 slidably receives the upper end of the smaller diameter tube 46 which is locked in a seated position within the connecting socket 68 by the quick - release mechanical fastener 50 . the quick - release feature is advantageous in that a user may quickly detach the support strut 14 from the leg cradle 12 when the user decides to sit down , as shown in fig4 . fig1 through 3 best illustrate the plurality of fasteners 20 , 22 , 24 , 26 used to secure the user &# 39 ; s leg within the cradle . the fasteners 20 , 22 , 24 , 26 are supported on the leg cradle 12 in a manner that permits effective securement to the user during use . in the illustrated embodiment , there are four fasteners that are include straps 100 , 102 made of nylon , each threaded through a plurality of slots 104 provided in the leg cradle 12 . the straps 100 of the upper two fasteners 20 , 24 are preferably wider than the straps 102 of the lower two fasteners 24 , 26 . the difference in width reflects the difference in both the magnitude of the forces borne by the thigh as compared to the lower leg , as well as the size of the thigh as compared to the size of the lower leg . fig5 illustrates the position of the slots 104 and the relative size of the preferred straps 100 , 102 more clearly . the positions of the fasteners 20 - 26 in the present invention and the number thereof are important in achieving the improved level of comfort and effectiveness described herein . in the preferred embodiment , there are two fasteners 20 , 22 associated with the first portion 30 of the cradle 12 and two fasteners 24 , 26 associated with the second portion 32 of the cradle ; however , more fasteners can be used . providing multiple fasteners associated with each cradle portion more effectively distributes the load carried by the user &# 39 ; s leg positioned within the cradle and eliminates potential rocking about a single fastener point of contact when only one fastener is used . the first fastener 20 is preferably placed at an upper end 106 of the first portion 30 of the cradle 12 away from the intersection between the first and second portions 30 , 32 . during use , while the user is in stride , the interaction between the strut 14 and the ground as the user walks have a tendency pull the first portion upper end away from the user &# 39 ; s thigh , thereby causing the cradle to rotate about the user &# 39 ; s knee . ( this rotational axis is normal to the intersection of the longitudinal axes &# 34 ; a &# 34 ;, &# 34 ; b &# 34 ;). additional rotational forces are also experienced about generally the same axis due to the downward force of the user &# 39 ; s leg weight caused by the lower leg being cantilevered beyond the second portion 32 of the cradle 12 . while the rigid construction of the leg cradle 12 and the support strut 14 ( as implemented by the interengaging structure 16 ) will effectively resist these rotational forces , the user &# 39 ; s thigh must necessarily bear some of that resistance . the first portion 30 is , thus , a moment arm about the axis of rotation through the user &# 39 ; s knee . the longer the moment arm , the less force will be transmitted at the first fastener 20 due in acting upon and reacting to the rotational forces . in other words , on the down stroke of the present leg support crutch , the ground ( and the weight of the lower leg ) will exert a rotational force that tends to push the first portion 30 of the cradle 12 against the user &# 39 ; s thigh . the longer the first portion 30 , the greater the area of engagement between the first portion 30 and the user &# 39 ; s thigh , thus distributing those forces to a greater extend and minimizing the forces experienced by the thigh . on the upstroke , however , the user &# 39 ; s forward momentum will translate into forces that tend to pull the first portion 30 away from the user &# 39 ; s thigh . by placing the first fastener 20 as close to the distal end 106 of the first portion as feasible and , thus , maximizing the moment arm as measured by the location of the first fastener 20 , the force transmitted to the thigh when the present leg support crutch is in use is minimized . thus , the present invention minimizes the force exerted on or by the thigh by extending the moment arm of the first portion 30 as far as possible and selectively placing the first fastener 20 very close to the distal end of the first portion 30 . the second fastener 22 is preferably placed proximal the intersection of the first and second portions 30 , 32 but sufficiently spaced therefrom to avoid constriction of the popliteal fossa and popliteal artery contained therein . prolonged constriction of the popliteal artery may result in irreparable damage and may diminish recuperation efforts , besides causing discomfort and pain . the present leg support crutch avoids such constriction by selectively placing the second fastener 22 above the intersection of the first and second portions 30 , 32 . the third and fourth fasteners 24 , 26 are provided in the second portion 32 of the cradle 12 and are positioned such that the third fastener 24 is located about the longitudinal mid - point of the user &# 39 ; s calf and the fourth fastener 26 is located at the narrowing portion of the user &# 39 ; s calf and near the user &# 39 ; s ankle , that is generally at the second portion &# 39 ; s outer end . although relatively minimal , some forces will be experienced by the lower leg on the upstroke of the user &# 39 ; s gait . thus , it is preferably that the third fastener 24 be positioned at the mid - point of the calf where the lower leg may sustain the most force . the fourth fastener 26 positioned at the bottom of the calf and close to the ankle serves to stabilize the lower leg and maintain the user &# 39 ; s foot in a comfortably restrained position to enhance recuperation . with reference to fig5 the first and second fasteners 20 , 22 each preferably include two discrete strap segments , a first strap segment 108 and a second strap segment 110 . at a first end of each first strap segment 108 , a fastening mechanism 114 is provided for detachably affixing the strap segment 108 to a corresponding fastening mechanism 118 on the exterior of the leg cradle 12 . preferably the detachable fastening mechanism is a hook and loop fastener , such as velcro ®, with the hook portion ( 114 ) provided on the first strap segment 108 and the loop portion ( 118 ) provided on the exterior of the leg cradle 12 . similarly , at a first end of each second strap segment 110 , a similar detachable fastening mechanism 116 , such as a hook fastener , is also provided to mate with a corresponding loop fastener ( not shown ) provided on the exterior of the leg cradle 12 on the opposite side of the cradle 12 from the loop portion 118 . the first and second strap segments 108 , 110 may then be buckled together behind the user &# 39 ; s thigh to adjust the straps as tightly as desired . it should be noted that any arrangement of one or multiple straps may be employed to effectively fasten the first portion 30 to the user &# 39 ; s thigh . in the illustrated embodiment , the third and fourth fasteners include a single strap segment 112 , each of which slidably moves within the slots 104 within the second portion 32 of the leg cradle . if desired , the third and fourth straps may also include hook fasteners to engage loop fasteners affixed to the underside of the lower portion to prevent undesired sliding of the straps 112 . the straps may be buckled around the user &# 39 ; s lower leg to comfortably restrain the lower leg within the leg cradle 12 . although this invention has been described in terms of a certain preferred embodiment , other embodiments apparent to those of ordinary skill in the art are also within the scope of this invention . accordingly , the scope of the invention is intended to be defined only by the claims that follow .

a single leg support crutch provides improved stability and balance to a user , who suffers from foot , ankle or lower leg injury , in order to enhance ambulatory movement of the user during recuperation . the leg support crutch comprises a unitary leg cradle that conforms generally to a user &# 39 ; s thigh , knee and lower leg , and a plurality of fasteners that comfortably secure the leg support crutch to the user &# 39 ; s leg while in a bended position . a support strut is releasably attached to the cradle and is positioned to support the weight of the user when standing or walking . a releasable coupling attaches the strut to the cradle at one of a plurality of locations . the multiple locations of the strut on the cradle allow the position of the strut to be adjusted in order to properly align the axis of the strut with the location of the user &# 39 ; s femur in the cradle . as a result , the weight of the user is transferred more efficiently to the strut to improve the user &# 39 ; s comfort when standing or walking .

the present invention is now described with respect to a specific embodiment thereof , wherein a gaming link architecture g_linka is used to provide an on - line gaming service , and wherein a certain gaming link protocol g_linkp is used to establish data communication within g_linka . of course , the invention described herein is not restricted to a particular example , which will be described in what follows , but equally applies to other architectures possibly used to establish and provide an on - line gaming scenario . referring to fig1 a schematic diagram of the gaming link architecture g_linka for providing an on - line gaming environment is presented . the main components of g_linka are a customer site containing customer located equipment cle 110 , a provider site containing provider located equipment ple 120 , and an access aggregation network aan 130 connecting cle 110 with ple 120 . the customer located equipment cle 110 includes a gaming console gc 111 and other hardware components necessary for playing a game , such as a monitor , joysticks , and the like , and a modem such as a broad band modem 112 for establishing the connection to the aan 130 . on the ple site 120 there is located a gaming service provider network gsp 121 , a management network 122 consisting of multi - service operator &# 39 ; s operations support systems mso - oss 123 , a router 123 and a head - end 124 , establishing the connection to the ann 130 , among other components . the access aggregation network ann 130 generally is a wide area network wna , and preferably a broadband access network ban . however , local area networks lan are also possible solutions for networks providing an on - line gaming service . referring now to fig2 a schematic diagram is shown , illustrating the basic elements of the software architecture used in providing an on - line gaming environment . on the cpe site , the main component is a gaming client g_client 210 , whereas on the ple site there is a gaming server g_server 220 , an operations support services engine g_oss 230 , a gaming portal g_portal 240 , and support services g_support 250 . the purpose of the gaming client g_client 210 is to provide the gaming console with services , such as establishing connectivity , registration , and instrumentation . g_client 210 comprises a registration client , an authentication client , a console address management module , and a module for connectivity and service to a gaming service provider gsp 121 on the ple site 120 . g_client 210 supports established methods for data communication and transfer , such as point - to - point protocol ppp , and other recognized data protocols . g_client 210 checks for connection qualification , and administers bundled instrumentation . according to the embodiment of the present invention , and especially useful in connection with a broadband access network ( ban ), a highly functional and adaptive client in form of an ultra - thin client utc is chosen as the component g_client 210 . utc resides on the console in a small segment of random access memory ( ram ), thus leveraging a high bandwidth connection to the gaming console , and using it to care and feed the highly functional and adaptive client . in this case , the component g_client 210 is typically referred to as g_utc . the utc constitutes a continuously resident , tiny core framework , in which client functionality is partitioned into small code segments , loaded and launched as required at run time . the code segments or packages are small , in general 50 kb or less , and with a broadband bandwidth of about 2 mbps take milliseconds to load . with utc , there is no need to maintain state tables ; utc itself becomes a state onto itself , including possible launches from that state . utc packages are thin , take little space away from the primary function of the gc , and do hardly interfere with the gaming software running on the gc . as a further advantage , the gaming client g_client 210 becomes very scalable and flexible , and is growing outside the gc without impacting the footprint occupied within the gc . as another advantage , client upgrades and updates are done automatically and in - service , value - added services are simple to include , and individual client services are easier to design and to implement . also , client code portability between different gaming platforms is highly simplified . this way , g_utc is a prototypical example for a highly functional client . the purpose of the gaming server g_server 220 is to provide the connectivity and registration services for gaming consoles ( gc ), and to manage the registered devices . typically , g server 220 deals with client registration , subscriber authentication , console address management , as well as internet protocol ( ip ) connectivity management and proxy for gaming consoles ( gc ). g_server 220 also manages the different gc and different subscribers being part of the on - line gaming architecture g_linka . further , g_server 220 deals with connection qualification , instrumentation and debugging services for consoles , and with bundled instrumentation , and reports facilities for instrumentation , performance and management to g_client 210 . although designed as an on - line gaming environment , g_server 220 enables one to extend the uses of a plurality of gaming consoles ( gc ) interconnected through a broadband access network beyond gaming and entertainment . the purpose of the operations support services engine g_oss 230 is to provide an application program interface ( api ) to tie - in with the network service provider &# 39 ; s software engines for subscriber authentication , network and policy management , notification , and billing functionalities . g_oss 230 supports multi - protocol api , containing common utilities with plug - in adapters to facilitate connectivity to a majority of other operating support services ( oss ), the plug - in adaptation cartridges supporting hyper text transfer protocol ( http ), simple network management protocol ( snmp ), extensible markup language ( xml ), java ™, oss / j , and the like . further , g_oss 230 handles the task of console - discovery - notification and registration , communicates console to subscriber associations , manages subscriber authentication , and administers connectivity management while addressing state functions such as in - service , suspend , or resume . also , g_oss 230 adds , modifies , or deletes a gc or a subscriber to the on - line gaming service , and takes care of billing and service notification , among other related functionalities . the purpose of the gaming portal g_portal 240 is to provide a site for net - based gaming services . it also acts as a proxy site through which net - based game content providers offer content and services to the user of the gaming console gc . g_portal 240 provides an entry point into the on - line gaming network for game specific servers , for connection servers enabling group gaming , head - to - head services and find - a - friend scheduling , for bulletin boards and chat rooms , as well as for gaming sites and news proxy . optionally , g_portal 240 offers possibilities such as pay - per - play services , advertising , download services , and others . g_server 220 also locally offers the same services . the system of support services g_support 250 fulfills functions such as running a dynamic host configuration protocol ( dhcp ), web servicing , platform and application management , subscriber management , license servicing , and the like . within the system of support services , there is a dynamic host configuration protocol server g_dhcp 251 , a web server g_web 252 dealing with gsp content , gsp data , and gsp instrumentation , as well as a registration server g_reg 253 . g_linkp is used to establish communication within the gaming architecture g_linka , and is used in supporting the intermodule signaling and control communication and small batch data transfer . g_linkp further enables the use of ultra - thin clients ( utc ) for gaming consoles ( gc ). in the present embodiment of the instant invention , the communication medium is an ip - based , packet protocol , running on ip directly , or on top of a point - to - point protocol ( ppp ) including ppp use over ethernet ( pppoe ), utilizing xml for external interfaces , and supporting both connected clients via the transmission control protocol ( tcp ) as well as connectionless clients via the user datagram protocol ( udp ). further , g_linkp attempts to keep small messages , typically smaller than the maximum transmission unit ( mtu ). all protocol messages have a common base structure , comprising header , payload , and tail . the header includes information regarding protocol version , message type , control flags , sequence counter , security field , identification of the originating module , identification of the destination module , gaming console class , gaming console vendor , gaming console model , payload size , payload type , and other relevant data characterizing the type and format of the message . the payload contains the main body of the message , comprising any or all of unstructured binary data , structured , formatted data , xml - text - based data , and other interpretable data . optionally , depending on the message type , the tail comprises a sequence counter , a security field , and / or control flags . typical message types of the gaming link protocol include a logon - message glp_hello , a response message glp_rsp , a request for download glp_dreq , an acknowledgment message glp_ack , as well as a non - acknowledgement message glp_nak , an information package glp_info , a data package glp_data , and a control package glp_control . the main communication between the cle site 110 and the ple site 120 over the aan 130 is handled by the client g_client 210 and the server services g_server 220 . a boot process of the gaming console gc generally starts an on - line gaming session . first loading the utc base g_utc from a compact disc ( cd ) or from read - only memory ( rom ) into random access memory ( ram ) initializes a sequence of start - up steps . in this first step , client identification ( id ), information regarding the make and the model of the gc , as well as the internet protocol ( ip ) address all are retrieved from ram . referring now to fig3 a , a message sequence chart ( msc ) is shown for an auto - versioning process of the gaming console gc . it is assumed that the client has a valid and authenticated ip address and client id . the client g_utc transmits a logon message glp_hello to the gsp server g_server , step 3101 . the logon message contains information regarding the client id , the version number of g_linkp used , and the like . next , g_server is going to validate the client and the protocol used , step 3102 . g_server looks up the client id for validity , and decides whether the version of g_linkp is currently supported . in case of an outdated protocol version , a non - acknowledgment message is sent to the client , step 3103 , containing an address and port of updated client software . in a next step , the client requests a proper update , step 3104 , which is followed by the server determining the data for a correct update , step 3105 . the new updated version is determined taking into account new protocol versions , client console class and type , console make and model , and related information . the information is sent to the client g_utc in form of an acknowledgment message , step 3106 . the client then requests a download for the updated version , step 3107 , transmitting the necessary information such as updated file name and client id , to the server g_server . the server g_server transmits data containing the new utc version of the client , step 3108 . the auto - versioning procedure is concluded with an upgrade , step 3109 . the new base client utc is loaded , and an update flag for nvram is set . if the new client is successfully activated , and if the update flag is set , the new client is loaded into ram . optionally , after being loaded into ram , the new client is preserved in nvram , if it was originally stored in nvram . otherwise , if the update flag is not set , the old base client is reactivated , and the autoconfiguration procedure is repeated . referring now to fig3 b , a message sequence chart ( msc ) is shown , how a utc client is supported by the support services , and especially by g_server . it is assumed that the client has a valid and authenticated ip address and client id . it is further assumed that g_utc is running . the client g_utc transmits a logon message glp_hello to the gsp server g_server , step 3201 . the logon message contains information regarding the client id , the version number of g_linkp used , and the like . next , g_web is going to validate the client and the protocol used , step 3202 . g_web looks up the client id for validity , and decides whether the version of g_linkp is currently supported . in case of authenticated information , an acknowledgment message is sent to the client , step 3103 . the client g_utc then transmits information to the server g_web , regarding an active element of the client , step 3204 . the active element refers for example to a particular gaming situation of an ongoing interactive computer game , or it possibly refers to information determining gaming characteristics of a certain user , such as information contained in a personal profile . the support server sets a state and a jump table , and updates a client record , step 3205 . this step is based on a current state and transition table of the client , and transition options with prompts and probabilities are determined . these options are sent back to the client as control data , step 3206 . g_utc then presents a menu to the user , step 3207 . possible options are different choices within a gaming scenario , different gaming services to be loaded and activated , different gaming qualities , and the like . after the selection is made , the client transmits the corresponding download request , step 3208 , and the server responds by transmitting the corresponding data to the client , step 3209 . optionally , based on certain probabilities with respect to certain download requests , g_server chooses to preload one or more selection modules , step 3210 , the modules resulting from a next probable transition taking place on the cle site . this prefetching process represents a form of caching , which provides the end user with real - time responsiveness . referring now to fig3 c , a message sequence chart ( msc ) is shown , for a method of utc selection . the client g_utc is running on the gc , and is offering a menu of selections to the subscriber , or to a user on the cle site , step 3301 . optionally , one or more than one probable selections are preloaded by g_utc . the subscriber or user then makes a selection , which corresponds to a transition for g_utc . g_utc loads and runs the selected transition , step 3302 . optionally , when the selection was preloaded , a process of loading the selection is not required . a new state is now loaded and activated . g_utc stays active as supervisor , and for a return to a main menu , but spawns a selected transition module . the client g_utc then transmits information to the server g_server , regarding an active element of the client , step 3303 . the active element refers for example to a particular gaming situation of an ongoing interactive computer game , or it possibly refers to information determining gaming characteristics of a certain user , such as information contained in a personal profile . the support server sets a state and a jump table , and updates a client record , step 3304 . this step is based on a current state and transition table of the client , and transition options with prompts and probabilities are determined . these options are sent back to the client as control data , step 3305 . the client transmits a corresponding download request , step 3306 , and the server responds by transmitting the corresponding data to the client , step 3307 . optionally , based on certain probabilities with respect to certain download requests , g_server chooses to preload one or more selection modules , step 3308 , the modules resulting from a next probable transition taking place on the cle site . the above - described procedures illustrate the basic modus operandi of the instant invention , and it is obvious to a person of skill in the art that the presented communication protocols are easily extended to incorporate and fulfill a variety of other functionalities . besides the described autoconfiguration procedure , the utc selection step possibly offers a selection of configuration options that are settable and adaptable by the subscriber or by the user . for example , certain gaming requests are excluded from the gc , or are only possible to be activated at a certain point in time , say in the evening after 10 p . m . selected options are then stored in a personal profile . the selected options include options regarding gaming executed on the gaming console , options regarding parental control issues , and other options . the personal profile is either located on the provider site , associated with a client id and ip address , and is accessed by the support services when a request from a certain client is registered , or the profile is stored in the nvram of the gaming console , and is loaded at boot time . alternatively , a given personal profile is not associated with a specific ip address , but is associated with a net - mask or a subnet - mask . this way , for example , a complete home is declared as a violence free gaming zone . the personal profile is optionally used to protect the gsp from certain legal liabilities . for example , according to a given legislation , the provider of a game , and therefore by extension the gsp , has a liability and / or a responsibility to ensure age appropriate contents . by using the personal profile to determine an age profile of its audience , an appropriate utc instance is loaded enforcing and allowing only approved age appropriate content . this way , the gsp exercises age control on the services and games provided . the same way as the personal profile is used to exercise age control , the personal profile is optionally used to exercise parental control . it is possible for parents to block the access to certain type of games , which for example engage their user in violent actions , confront their users with sexual content , and challenge their user with contents of profanity . this way , it is possible for parents to ensure that their educational measures are not undermined by gaming activities performed by their children in their recreational activities . this way , it is possible for younger audience to safely participate in new forms of social interactions related to online gaming activities . of course , the concept of parental control as described above is easily extended to other forms of control for designated user groups of a given gaming console ( gc ). the autoconfiguration procedure also allows one to efficiently deal with security issues . g_utc itself is the distributed key for security , and the possibility to constantly and automatically update g_utc introduces enough flexibility into the gaming system , to provide a secure gaming environment . although the instant invention has been described with respect to a specific embodiment thereof , various changes and modifications are optionally carried out by those skilled in the art without departing from the scope of the invention . therefore , it is intended that the instant invention encompass such changes and modifications as fall within the scope of the appended claims .

an interactive gaming system comprising a gaming console and a gaming service provider is disclosed . the gaming console contains a storage medium , on which data relating to a configuration of the gaming console are stored . the gaming console further contains a processor in communication with the storage medium for retrieving data therefrom and executing the data , the data relating to the configuration of the gaming console . a gaming service provider provides instruction data to the gaming console , and a connecting network enables a connection between the gaming console and the gaming service provider . further , a gaming client is stored on the gaming console . the gaming client establishes a connection between the gaming console and a gaming service provider and controls events taking place on the gaming console . the configuration of the gaming console is established by the gaming client according to messages sent to and received from the gaming service provider and to messages stored within a personal profile .

as used herein , the term &# 34 ; alkyl &# 34 ; is intended to refer to an unbranched or branched alkyl group comprising carbon atoms , such as methyl , ethyl , propyl , isopropyl , n - butyl , tert - butyl , hexyl , and octyl . the term &# 34 ; pharmaceutical salt &# 34 ; refers to a salt that retains the desired biological activity of the parent compound and does not impart undesired toxicological effects thereto . examples of such salts are ( a ) salts formed with cations such as sodium , potassium , nh 4 + , magnesium , calcium polyamines , such as spermine , and spermidine , etc . ; ( b ) acid addition salts formed with inorganic acids , for example hydrochloric acid , hydrobromic acid , sulfuric acid , phosphoric acid , nitric acid and the like ; ( c ) salts formed with organic acids such as , for example , acetic acid , oxalic acid , tartaric acid , succinic acid , maleic acid , fumaric acid , gluconic acid , citric acid , malic acid , ascorbic acid , benzoic acid , tannic acid , palmitic acid , alginic acid , polyglutamic acid , naphthalenesulfonic acid , methanesulfonic acid , p - toluenesulfonic acid , naphthalenedisulfonic acid , polygalacturonic acid , and the like ; and ( d ) salts formed from elemental anions such as chlorine , bromine , and iodine . a first aspect of the present invention is a method of combating viral infection comprising administering a compound of formula i , wherein r 1 , r 2 , r 3 , r 4 , r 5 , r 6 , x , and y are defined as stated above , or a pharmaceutical salt thereof . the amphipathic compounds of formula i , which are generally analogs of phosphatidylcholine , include a glycerol backbone ( represented by the chain of three carbon atoms to which other functional groups are bonded ), lipophilic moieties ( represented by r 1 and r 2 ) bonded to positions 1 and 2 of the glycerol backbone through functional groups ( represented by x and y ) that are generally resistant to phospholipase degradation , and polar phosphate and quaternary amine groups ( linked to one another through a short alkyl group ) bonded to position 3 of the glycerol backbone . each of these components of the compounds of formula i is described separately below . in formula i , as described above , r 1 is a lipophilic moiety ; the lipophilicity of r 1 allows the compounds of formula i to bind with the cell membrane of a cell infected with a retrovirus to provide an anchor thereto . r 1 can be an unbranched or branched , saturated or unsaturated c 6 to c 18 alkyl group . preferably , r 1 is an unbranched saturated or unsaturated c 8 to c 12 alkyl group , and more preferably , r 1 is an unbranched saturated c 10 or c 12 alkyl group . in compounds of formula i , x is a functional group that links the lipophilic moiety r . and the glycerol backbone of the compound . x is selected from the group consisting of nhco , ch 3 nco , conh , conch 3 , s , so , so 2 , o , nh , and nch 3 ; these functional groups are resistant to the hydrolytic activity of cellular lipases , in particular phospholipase a , which is specific for ester linkages at position 1 ( as are present in phosphatidyl choline ). preferably , x is s or nhco , with nhco being most preferred . in formula i , r 2 is a lipophilic moiety which , as is true for r 1 , enables the compounds of formula i to bind with the cell membrane of an infected cell . r 2 can be an unbranched or branched , saturated or unsaturated c 6 to c 14 alkyl group . preferably , r 2 is an unbranched saturated or unsaturated c 8 to c 12 alkyl group , and more preferably , r 2 is an unbranched saturated c 8 or c 10 alkyl group . it is also preferred that r 1 and r 2 together contain between 18 and 22 carbon atoms . r 2 is bonded to position 2 of the glycerol backbone through a functional group y , which is selected from the group consisting of nhco , ch 3 nco , conh , conch 3 , s , so , so 2 , o , nh , and nch 3 . like x , y should be a moiety that is resistant to the hydrolytic activity of cellular lipases , and in particular phospholipase b , as this enzyme is specific for ester linkages at position 2 . preferably , x is s or o , with o being more preferred . the polar hydrophilic end of the amphipathic compounds of formula i , which can play a role in membrane interaction , comprises an amphoteric phosphoalkyl quaternary amine group in which the phosphate moiety carries the negative charge and the quaternary amine moiety carries the positive charge . in this group , r 6 , which is a branched or unbranched , saturated or unsatured c 2 to c 6 alkyl group , is preferably saturated c 2 . r 3 , r 4 , and r 5 are independently selected from the group consisting of methyl and ethyl , with methyl being preferred , and with r 3 , r 4 , and r 5 each being methyl being more preferred , or r 3 and r 4 together form an aliphatic or heterocyclic ring having five or six members and r 5 is methyl or ethyl . exemplary compounds of formula i include 1dodecanamido - 2 - decyloxypropyl - 3 - phosphocholine ( cp - 128 ), 1 - dodecanamido - 2 - octyloxypropyl - 3 - phosphocholine ( cp - 130 ), 1 - dodecanamido - 2 - dodecyloxypropyl - 3 - phosphocholine ( cp - 131 ), and 1 - dodecyloxy - 2 - decyloxypropyl - 3 - phosphocholine ( cp - 129 ). these compounds of formula i can be synthesized according to the procedures set forth in examples 1 and 2 below . other compounds of formula i can be synthesized using the same method with the appropriate reagents substituted for those listed . another aspect of the invention is a method of combating viral infection by administering compounds of formula ii , wherein r 1 , r 2 , r 3 , r 4 , r 5 , x , m , and n are defined as stated above , or a pharmaceutical salt thereof . compounds of formula ii are amphipathic moieties having a lipophilic moiety ( represented by r 1 ) linked to a five - or six - membered ring structure ( which is optionally sustituted 1 to 3 times with c 1 to c 3 alkyl ) and a hydrophilic moiety that includes phosphate and quaternary amine groups linked by a short alkyl group that is bonded to the ring structure through the phosphate group . the hydrophilic group is linked to the ring at position 1 , and the lipophilic group is linked to the ring at positions 2 , 3 , or 4 . like the compounds of formula i , the compounds of formula ii are analogs of phosphatidyl choline . however , the ring structure provides a more conformationally restricted framework for the compound than compounds lacking a ring structure ; this restricted framework can provide the compound with more favorable interaction with the cellular membrane and thereby increase its efficacy . in the compounds of formula ii , r 1 can be an unbranched or branched , saturated or unsaturated c 6 to c 20 alkyl group . as with the compounds of formulas ii , r 1 is a lipophilic moiety which binds with the cell membrane of infected cells to provide an anchor thereto . preferably , r 1 is unbranched saturated or unsaturated c 16 to c 18 alkyl . more preferably , r 1 is unbranched saturated or unsaturated c 16 to c 18 alkyl . in compounds of formula ii , x is a functional group that links the lipophilic moiety r 1 to position 1 of the ring structure . x should be a functional group , such as nhco , ch 3 nco , conh , conch 3 , nh , nch 3 , s , so , so 2 , or o , that is able to withstand the hydrolytic activity of cellular lipases . preferably , y is s or nhco . as stated above , the polar hydrophilic end of the amphipathic compounds of formula ii comprises a phosphate group bonded to the ring structure , a short alkyl group r 5 linked at one end thereto , and a quaternary amine group linked to the opposite end of the short alkyl group . r 5 is a saturated or unsaturated , branched or unbranched c 2 to c 6 alkyl group , and is more preferably c 2 . r 2 , r 3 , and r 4 are independently selected from the group consisting of methyl and ethyl , with methyl being preferred , or r 2 and r 3 together form an aliphatic or heterocyclic five - or six - membered ring structure and r 4 is methyl or ethyl . it is more preferred that r 2 , r 3 , and r 4 are each methyl . in the compounds of formula ii , m can be 1 , 2 , or 3 , and n can be 0 , 1 , or 2 . preferably the ring structure is a five - or six - membered ring ; thus , preferably m is 2 or 3 when n is 0 , m is 1 or 2 when n is 1 , and m is 1 when n is 2 . as noted above , the ring structure provides conformational rigidity to the compound . exemplary compounds of formula ii include 3 - hexadecylthio - cyclohexylphosphocholine ( ink - 1 ), 3 - hexadecanamido - cyclohexylphosphocholine , 3 - hexadecanamido - cyclopentylphosphocholine , and 3 - hexadecylthio - cyclopentylphosphocholine . these compounds of formula ii can be synthesized by following the teachings of example 3 below in combination with procedures known to those skilled in the art . an additional aspect of the present invention is a method of combating viral infection with compounds of formulas iii and iv . these compounds substitute a moiety z for the alkyl - quaternary amine of the compounds of formulas i and ii , wherein z is as defined above . z is a moiety that has demonstrated anti - viral activity by itself ; thus conjugation of z to the remainder of the compounds of formulas iii and iv provides a compound that potentially includes multiple active sites for viral inhibition . in the compounds of formula iii r 1 , r 2 , x and y are defined above . r 1 is a lipophilic moiety ; the lipophilicity of r 1 allows the compounds of formula i to bind with the cell membrane of a cell infected with a retrovirus to provide an anchor thereto . r 1 can be an unbranched or branched , saturated or unsaturated c 6 to c 18 alkyl group . preferably , r 1 is an unbranched saturated or unsaturated c 8 to c 12 alkyl group , and more preferably , r 1 is an unbranched saturated c 10 or c 12 alkyl group . in compounds of formula iii , x is a functional group that links the lipophilic moiety r 1 and the glycerol backbone of the compound . x is selected from the group consisting of nhco , ch 3 nco , conh , conch 3 , s , so , so 2 , o , nh , and nch 3 ; these functional groups are resistant to the hydrolytic activity of cellular lipases , in particular phospholipase a , which is specific for ester linkages at position 1 ( as are present in phosphatidyl choline ). preferably , x is s or nhco , with nhco being most preferred . in formula iii , r 2 is a lipophilic moiety which , as is true for r 1 , enables the compounds of formula iii to bind with the cell membrane of an infected cell . r 2 can be an unbranched or branched , saturated or unsaturated c 6 to c 14 alkyl group . preferably , r 2 is an unbranched saturated or unsaturated c 8 to c 12 alkyl group , and more preferably , r 2 is an unbranched saturated c 8 or c 10 alkyl group . it is also preferred that r 1 and r 2 together contain between 18 and 22 carbon atoms . r 2 is bonded to position 2 of the glycerol backbone through a functional group y , which is selected from the group consisting of nhco , ch 3 nco , conh , conch 3 , s , so , so 2 , o , nh , and nch 3 . like x , y should be a moiety that is resistant to the hydrolytic activity of cellular lipases , and in particular phospholipase b , as this enzyme is specific for ester linkages at position 2 . preferably , x is s or o , with o being more preferred . in the compounds of formula iii , z is a moiety of formula v . moieties of formula v are intended to be anti - viral agents , and thus potentially provide an additional active site for anti - viral activity that may act through a different mechanism . in the moieties of formula v , v is h , or n 3 , or v and w together from a covalent bond with h and n 3 being preferred . w is h or f , with h being preferred . in the compounds of formula iiii , b is a purinyl moiety of formula vi or a pyrimidinyl moiety of formula vii , each of which are substituted as described above . as used herein , a purinyl moiety comprises six - and five - membered aromatic rings having the molecular structure illustrated in formula vi . those skilled in this art will appreciate that the double bonds illustrated in formula vi are present to represent that the purinyl moieties have aromatic character , and that these double bonds may shift their positions in certain compounds due to the presence of certain substituents to retain the aromatic character of the moiety ; in particular , those moieties having ═ o or nh 2 substituents at positions 2 and 4 , such as adenine , guanine , xanthine , and hypoxanthine , are generally illustrated as having double bonds shifted from the positions shown in formula vi . similarly , as used herein a pyrimidinyl moiety comprises a six - membered aromatic ring having the molecular structure illustrated in formula vii . those skilled in this art will appreciate that the double bonds illustrated in formula vii are included therein to represent that the moieties of formula vii have aromatic character , and that these double bonds may shift for certain substituents , in particular for ═ o and nh 2 at positions 2 and 4 , in order for the moiety to retain its aromatic character . preferably , b is selected from the group consisting of adenine , thymine , cytosine , guanine , hypoxanthine , uracil , 5 - fluorouracil , 2 - fluoro - adenine , 2 - chloro - adenine , 2 - bromo - adenine , and 2 - amino - adenine . preferably , z is 3 &# 39 ;- azido - 3 &# 39 ;- deoxythymidine , dideoxyinosine , dideoxycytidine , or 2 &# 39 ;, 3 &# 39 ;- didehydro - 3 &# 39 ;- deoxythymidine . an exemplary preferred compound of formula iii is 3 &# 39 ;- azido - 3 &# 39 ;- deoxy - 5 &# 39 ;-( 3 - dodecanamido - 2 - decyloxypropyl )- phosphothymidine . a further aspect of the present invention is a method of inhibiting viral infections comprising administering to a subject an effective infection - inhibiting amount of a compound of formula iv , wherein r 1 , r 2 , x , m , n , and z are as defined above . in the compounds of formula iv , r 1 can be an unbranched or branched , saturated or unsaturated c 6 to c 20 alkyl group . as with the compounds of formula ii , r 1 is a lipophilic moiety which binds with the cell membrane of infected cells to provide an anchor thereto . preferably , r 1 is unbranched saturated or unsaturated c 10 to c 18 alkyl . more preferably , r 1 is unbranched saturated or unsaturated c 16 to c 18 alkyl . in compounds of formula iv , x is a functional group that links the lipophilic moiety r 1 to position 1 of the ring structure . x should be a functional group , such as nhco , ch 3 nco , conh , conch 3 , nh , nch 3 , s , so , so 2 , or o , that is able to withstand the hydrolytic activity of cellular lipases . preferably , x is s or nhco . as stated above , the polar hydrophilic end of the amphipathic compounds of formula iv comprises a phosphate group bonded to the ring structure and a moiety z as defined in formula v . in the moieties of formula v , v is h , or n 3 , or v and w together form a covalent bond , with h and n 3 being preferred . w is h or f , with h being preferred . in the compounds of formula iv , b is a purinyl moiety of formula vi or a pyrimidinyl moiety of formula vii , each of which are substituted as described above . as used herein , a purinyl moiety comprises six - and five - membered aromatic rings having the molecular structure illustrated in formula vi . those skilled in this art will appreciate that the double bonds illustrated in formula vi are present to represent that the purinyl moieties have aromatic character , and that these double bonds may shift their positions in certain compounds due to the presence of certain substituents to retain the aromatic character of the moiety ; in particular , those moieties having ═ o or nh 2 substituents at positions 2 and 4 , such as adenine , guanine , xanthine , and hypoxanthine , are generally illustrated as having double bonds shifted from the positions shown in formula vi . similarly , as used herein a pyrimidinyl moiety comprises a six - membered aromatic ring having the molecular structure illustrated in formula vii . those skilled in this art will appreciate that the double bonds illustrated in formula vii are included therein to represent that the moieties of formula vii have aromatic character , and that these double bonds may shift for certain substituents , in particular for ═ o and nh 2 at positions 2 and 4 , in order for the moiety to retain its aromatic character . preferably , b is selected from the group consisting of adenine , thymine , cytosine , guanine , hypoxanthine , uracil , 5 - fluorouracil , 2 - fluoro - adenine , 2 - chloro - adenine , 2 - bromo - adenine , and 2 - amino - adenine . preferably , z is selected from the group consisting of 3 &# 39 ;- azido - 3 &# 39 ;- deoxythymidine , dideoxyinosine , dideoxycytidine , and 2 &# 39 ;, 3 &# 39 ;- didehydro - 3 &# 39 ;- deoxythymidine . in the compounds of formula iv , m can be 1 , 2 , or 3 , and n can be 0 , 1 , or 2 . preferably , the ring structure is a five - or six - membered ring ; thus m is 2 or 3 when n is 0 , m is 1 or 2 when n is 1 , and m is 1 when n is 2 . the ring structure provides conformational rigidity to the compound . experimentation has demonstrated the efficacy of the compounds of formulas i , ii , iii and iv in combating viral infection . for example , compounds cp - 128 , cp - 129 , cp - 130 , cp - 131 , and ink - 1 in nanomolar concentration substantially inhibit the hiv - 1 activity in cem - ss cells . further , these compounds did so at noncytotoxic levels , thus indicating their promise as therapeutic agents for treatment of viral infections . the compounds of formulas i , ii , iii and iv are believed to attach to the cell membrane and thus are particularly effective against infections caused by membrane - containing or envelope - containing viruses , as these viruses typically require access to the cell membrane to multiply and assemble through the manufacture of new viral particles . for example , the compounds of formulas i , ii , iii and iv can inhibit the transport and / or incorporation of hiv - 1 major glycoprotein gp12o in the cell membrane of an infected cell prior to viral assembly . such inhibition can block the transmission of infectious hiv - 1 into neighboring cells . in addition , compounds of formulas i , ii , iii and iv can inhibit the production of the hbv core and &# 34 ; e &# 34 ; antigens , each of which contribute to the assembly of new virus particles and the spread of hbv infection . other infections for which the compounds of formulas i , ii , iii and iv should be efficious include those caused by other membrane - containing or envelope - containing herpesviruses , influenza , respiratory syncytial virus , mumps , measles , and parainfluenza viruses . experimentation has also shown that the compounds of formulae i , ii , iii , and iv have potent anti - tumor activity . in particular , some of these compounds have ic 50 values of approximately 1 . 2 μm against the kb - cell line . in the manufacture of a medicament according to the invention , hereinafter referred to as a &# 34 ; formulation ,&# 34 ; the compounds of formulas i , ii , iii and iv are typically admixed with , among other things , an acceptable carrier . the carrier must , of course , be acceptable in the sense of being compatible with any other ingredients in the formulation and must not be deleterious to the patient . the carrier may be a solid or a liquid , or both , and is preferably formulated with the compound as a unit - dose formulation , for example , a tablet , which may contain from 0 . 5 percent to 95 percent by weight of the active compound . one or more active compounds may be incorporated in the formulations of the invention , which may be prepared by any of the well known techniques of pharmacy consisting essentially of admixing the components . the formulations of the invention include those suitable for oral , rectal , topical , intrathecal , buccal ( e . g ., sub - lingual ), parenteral ( e . g ., subcutaneous , intramuscular , intradermal , or intravenous ) and transdermal administration , although the most suitable route in any given case will depend on the nature and severity of the condition being treated and on the nature of the particular active compound which is being used . formulations suitable for oral administration may be presented in discrete units , such as capsules , cachets , lozenges , or tablets , each containing a predetermined amount of the active compound ; as a powder or granules ; as a solution or a suspension in an aqueous or nonaqueous liquid ; or as an oil - in - water or water - in - oil emulsion . such formulations may be prepared by any suitable method of pharmacy which includes the step of bringing into association the active compound and a suitable carrier ( which may contain one or more accessory ingredients as noted above ). suitable solid diluents or carriers for the solid oral pharmaceutical dosage unit forms are selected from the group consisting of lipids , carbohydrates , proteins and mineral solids , for example , starch , sucrose , lactose , kaolin , dicalcium phosphate , gelatin , acacia , corn syrup , corn starch , talc and the like . capsules , both hard and soft , are filled with compositions of these active ingredients in combination with suitable diluents and excipients , for example , edible oils , talc , calcium carbonate and the like , and also calcium stearate . in general , the formulations of the invention are prepared by uniformly and intimately admixing the active compound with a liquid or finely divided solid carrier , or both , and then , if necessary , shaping the resulting mixture . for example , a tablet may be prepared by compressing or molding a powder or granules containing the active compound , optionally with one or more accessory ingredients . compressed tablets may be prepared by compressing , in a suitable machine , the compound in a free - flowing form , such as a powder or granules optionally mixed with a binder , lubricant , inert diluent , and / or surface active / dispersing agent ( s ). molded tablets may be made by molding , in a suitable machine , the powdered compound moistened with an inert liquid binder . liquid preparations for oral administration are prepared in water or aqueous vehicles which advantageously contain suspending agents , for example , methylcellulose , acacia , polyvinylpyrrolidone , polyvinyl alcohol and the like . formulations suitable for buccal ( sub - lingual ) administration include lozenges comprising the active compound in a flavored base , usually sucrose and acacia or tragacanth ; and pastilles comprising the compound in an inert base such as gelatin , glycerin , sucrose , or acacia . formulations of the present invention suitable for parenteral administration conveniently comprise sterile aqueous preparations of the active compound , which preparations are preferably isotonic with the blood of the intended recipient . these preparations are preferably administered intravenously , although administration may also be effected by means of subcutaneous , intramuscular , intrathecal , or intradermal injection . the formulation should be sufficiently fluid that for easy parental administration . such preparations may conveniently be prepared by admixing the compound with water or a glycine buffer and rendering the resulting solution sterile and isotonic with the blood . such preparations should be stable under the conditions of manufacture and storage , and ordinarily contain in addition to the basic solvent or suspending liquid , preservatives in the nature of bacteriostatic and fungistatic agents , for example , parabens , chlorobutanol , benzyl alcohol , phenol , thimerosal , and the like . in many cases , it is preferable to include osmotically active agents , for example , sugars or sodium chloride in isotonic concentrations . injectable formulations according to the invention generally contain from 0 . 1 to 5 percent w / v of active compound and are administered at a rate of 0 . 1 ml / min / kg . formulations suitable for rectal administration are preferably presented as unit dose suppositories . these may be prepared by admixing the active compound with one or more conventional solid carriers , for example , cocoa butter , and then shaping the resulting mixture . formulations suitable for topical application to the skin preferably take the form of an ointment , cream , lotion , paste , gel , spray , aerosol , or oil . carriers which may be used include vaseline , lanolin , polyethylene glycols , alcohols , and combinations of two or more thereof . the active compound is generally present at a concentration of from 0 . 1 to 15 percent w / w , for example , from 0 . 5 to 2 percent w / w . formulations suitable for transdermal administration may be presented as discrete patches adapted to remain in intimate contact with the epidermis of the recipient for a prolonged period of time . such patches suitably contain the active compound as an optionally buffered aqueous solution of , for example , 0 . 1 to 0 . 2m concentration with respect to the said active compound . formulations suitable for transdermal administration may also be delivered by iontophoresis ( see , for example , pharmaceutical research 3 ( 6 ), 318 , ( 1986 )) and typically take the form of an optionally buffered aqueous solution of the active compound . suitable formulations comprise citrate or bis \ tris buffer ( ph 6 ) or ethanol / water and contain from 0 . 1 to 0 . 2m active ingredient . the compounds of formulas i , ii , iii and iv are administered in an amount sufficient to combat viral infection . the dose can vary depending on the compound selected for administration , the subject , the route of administration , and other factors . preferably , the compound is administered in an amount of at least 0 . 1 ng / kg , 1 ng / kg , 0 . 001 μg / kg or more , and is adminstered in an amount no greater than 0 . 1 g / kg , 0 . 01 g / kg , 1 mg / kg , or less . the invention is illustrated in greater detail in the following nonlimiting examples . in the examples , &# 34 ; g &# 34 ; means grams , &# 34 ; mg &# 34 ; means milligrams , &# 34 ; μg &# 34 ; means micrograms , &# 34 ; μm &# 34 ; means micromolar , &# 34 ; ml &# 34 ; means milliliters , &# 34 ;° c .&# 34 ; means degrees celsius , &# 34 ; thf &# 34 ; means tetrahydrofuran , &# 34 ; dmf &# 34 ; means dimethylformamide , &# 34 ; mol &# 34 ; means moles , &# 34 ; mmol &# 34 ; means millimoles , and &# 34 ; psi &# 34 ; means pounds per square inch . the procedure set forth below was used to prepare the following compounds : 3 - amino - 1 , 2 - propanediol was reacted with lauroyl chloride at room temperature in pyridine and dimethyl formamide . the resulting dodecanamido propanediol was recrystallized from chloroform , then reacted with triphenylmethyl chloride . the tritylated product was recrystallized from hexanes . the c - 2 hydroxyl was alkylated by reaction with sodium hydride and the appropriate alkyl bromide in tetrahydrofuran for formation of the ether linkage at c - 2 ( 1 - bromodecane for cp - 128 ; 1 - bromooctane for cp - 130 ; 1 - bromododecane for cp - 131 ). column chromatography on silica gel with a discontinuous gradient of hexanes : ethyl acetate ( 95 : 5 to 80 : 20 ) produced the desired 1 - dodecanamido - 2 - alkoxy - 3 - trityloxypropane . detritylation with p - toluensulfonic acid in 5 : 1 methylene chloride : methanol gave product having a free primary hydroxyl after column chromatography ( hexanes : ethyl acetate 95 : 5 to 0 : 100 ). reaction with 2 - bromoethyl phosphodichloridate in diethyl ether and pyridine produced the phosphate ester , which was purified on silica gel with chloroform : methanol ( 100 : 0 to 2 : 1 ). displacement of the bromide with aqueous trimethylamine in chloroform : isopropanol : dimethyl formamide ( 3 : 5 : 5 ) gave the final phosphocholine product after column chromatography with chloroform : methanol : ammonium hydroxide ( 70 : 35 : 1 to 70 : 35 : 7 ). isopropylidene glycerol was alkylated using potassium hydroxide and 1 - bromododecane in toluene . the resulting ketal was hydrolyzed with hydrochloric acid in methanol , and the diol formed thereby was recrystallized from methanol . the remaining reaction steps ( tritylation , alkylation , detritylation , phosphorylation , amination ) followed the procedures described above in example 1 for the alkylamido derivatives . 2 - cyclohexenone ( 0 . 14 mol , 13 . 4 ml ) was dissolved in 10 ml of 10 percent sodium hydroxide and 50 ml of thf . an equimolar amount of hexadecyl mercaptan ( 0 . 14 mol , 42 . 9 ml ) was added to the unsaturated ketone and the mixture refluxed to produce 3 - hexadecylthiocyclohexanone ( 70 percent yield ). this product ( 5 . 23 mmol , 1 . 851 g ) was dissolved in methanol and reduced with sodium borohydride ( 5 . 23 mmol , 0 . 199 g ) to give a racemic mixture of 3 - hexadecylthiocyclohexanol ( yield 62 percent ; cis : trans ratio 4 : 1 ). the phosphorylating agent was prepared by refluxing phosphorus oxychloride ( 0 . 65 mol , 60 . 8 ml ) and 2 - bromoethanol ( 0 . 38 mol , 27 . 0 ml ) in 25 ml of trichloroethylene to produce 2 - bromoethyl dichlorophosphate ( yield 53 percent ). the 3 - hexadecylthiocyclohexanol ( 0 . 56 mmol , 0 . 200 g ) was dissolved in diethyl ether : thf ( 2 : 1 ) and refluxed with the 2 - bromoethyl dichlorophosphate ( 222 mmol , 0 . 3 ml ) to produce 3 - hexadecylthiocyclohexyl phosphoethyl bromide ( yield 54 percent ). the latter ( 0 . 276 mmol , 0 . 150 g ) was dissolved in isopropyl alcohol chloroform : dmf ( 5 : 3 : 5 ) and heated at 65 ° c . with trimethylamine ( 0 . 042 mol , 2 ml ) to produce the desired product , 3 - hexadecylthiocyclohexyl - phosphocholine ( yield 38 percent ). this procedure can also be used to prepare 3 - alkylthio - cyclopentyl derivatives by substituting 2 - cyclopentenone . 2 - cyclohexenone is reacted with benzylamine to give 3 - benzylaminocyclohexanone . hydrogenolysis of the benzylamino group then gives 3 - aminocyclohexanone . reaction with hexadecanoyl chloride affords 3 - hexadecanamidocyclohexanone , which is then reduced with sodium borohydride to produce a cis / trans mixture of 3 - hexadecanamidocyclohexanol . separation by column chromatography then gives the pure isomers . reaction with bromoethylphosphodichloridate , then with trimethylamine will produce 3 - hexadecanamidocyclohexylphosphocholine . synthesis of the 2 - and 4 - alkylamido derivatives can be carried out following essentially similar procedures with the substitution of appropriate starting materials . 3 - dodecanamido - 2 - decoxy - propanol was synthesized via the scheme described in morris - natschke et al ., c . i . med . chem . 29 : 2114 ( 1986 ). this alcohol was phosphorylated with diphenyl chlorophosphate in pyridine to give the corresponding phospate ester . the phenyl groups were then removed via hydrogenolysis with pto 2 . the phosphatidic acid derivatives were then conjugated to the 5 &# 39 ;- hydroxyl of azt ( dcc condensation ). isopropylideneglycerol ( solketal , 26 . 4 g , 0 . 20 mol ) in 60 ml of tolune was added dropwise to a solution of powdered koh ( 22 . 4 g ., 0 . 04 mol ) in 150 ml toluene . the resulting mixture was refluxed for 4 hours . 1 - bromododecane ( 50 g , 0 . 20 mol ) in 40 ml of tolune was then added dropwise , and the solution was refluxed for 10 hours . after cooling , the reaction mixture was diluted with 200 ml of ice - water and extracted with diethyl ether ( 3 × 100 ml ). the ether layers were dried over magnesium sulfate , and the solvent was removed in vacuo . the residue was dissolved in 60 ml of diethyl ether and 260 ml of meoh . concentrated hcl ( 60 ml ) was added , and the solution was refluxed for 16 hours . after cooling , ice - water ( 150 ml ) was added , and the layers were separated . the aqueous layer was extracted with diethyl ether ( 2 × 75 ml ). the combined organic fractions were then dried over sodium sulfate , filtered , and concentrated in vacuo . the solid residue was recrystallized from meoh to give 37 g ( 0 . 14 mol , 71 %) of a white solid . the diol synthesized in section a was tritylated with trityl chloride ( 59 g , 0 . 21 mol ) in pyridine ( 200 ml ) at 70 ° c . for 5 hours and then at room temperature overnight . the pyridine was removed under vacuum , and the solid residue was partitioned between water and chcl 3 . the chcl 3 layer was washed with 5 percent hcl and water , then dried over magnesium sulfate . after removal of solvent , the product was recrystallized from hexanes : ethyl acetate ( 10 : 1 ) to give 19 g of pure product . the trityl ether of section b ( 13 . 5 g , 0 . 027 mol ) was added dropwise to an ice - cooled suspension of sodium hydride ( 80 %, 1 . 6 g , 0 . 054 mol ) in 150 ml of tetrahydrofuran under nitrogen . after stirring for 2 hours at room temperature , heat was applied ( 55 ° c .). 1 - bromodecane ( 6 g , 0 . 027 mol ) was added dropwise ; heating was continued for 6 hours . after cooling for 3 hours , water was added slowly . diethyl ether ( 2 × 100 ml ) was added , and the solution washed with 15 percent sodium thiosulfite , water , and brine . after drying over sodium sulfate , the ether was removed , and the residue was chromatographed with a gradient of hexanes : ethyl acetate ( 100 : 0 to 20 : 1 ) to give 9 g ( 52 %) of a clear liquid . detritylation of the product of section c was accomplished using p - toluenesulfonic acid ( 0 . 9 g ) in chcl 3 : meoh ( 72 ml : 36 ml ) ( stirred at room temperature for 48 hours , added 10 percent sodium bicarbonate , extracted with chcl 3 , dried over magnesium sulfate , and concentrated ). the residue was purified by column chromatography using a gradient of hexanes : ethyl acetate ( 20 : 1 to 5 : 1 ) to give 3 . 5 g ( 63 %) of pure 3 - dodecyloxy - 2 - decyloxy - 1 - propanol . diphenylchlorophosphate ( 0 . 7 ml , 3 . 4 mmol ) in 10 ml of diethyl ether was cooled to 4 ° c . under nitrogen . 3 - dodecyloxy - 2 - decyloxy - 1 - propanol ( 1 . 0 g , 2 . 6 mmol ) in 15 ml of pyridine and 5 ml of diethyl ether was added . the solution was warmed to room temperature then heated to about 52 ° c . for 3 hours . it was then cooled to room temperature , diluted with 50 ml of diethyl ether , and washed with water ( 2 × 25 ml ), 0 . 5 n hcl ( 25 ml ), and then water ( 25 ml ). the organic layer was dried over sodium sulfate , filtered , and concentrated in vacuo to an oil . chromatography with a gradient of hexanes : ethyl acetate ( 10 : 1 to 1 : 1 ) produced 980 mg ( 1 . 5 mmol , 60 %) of pure product . pto 2 ( 69 mg ) was placed in a parr hydrogenation bottle . the diphenyl phosphate of section e ( 500 mg ) in 100 ml of etoh was then added . the reaction mixture was hydrogenated at 15 psi for 1 . 5 hours until hydrogen uptake ceased . the reaction mixture was then filtered through celite , and the etoh was removed in vacuo . the oil was dissolved in 25 ml of pyridine , concentrated in vacuo , and dried under high vacuum to give 350 mg of pure solid phosphatidic acid . azt ( 43 mg , 0 . 16 mmol ) and the phosphatidic acid of section f ( 105 mg , 0 . 22 mmol ) were azeotropically dried with pyridine ( 3 × 3 ml ) by in vacuo removal . dicyclohexylcarbodiimide ( 220 mg , 1 . 07 mmol ) was added , and the drying was repeated 4 times . a final 3 ml portion of pyridine was added , and the reaction mixture was stirred at room temperature in a desiccator for 4 days . water ( 1 g ) was added , and the mixture was stirred for 4 hours . the solvents were removed in vacuo , and the crude material was chromatographed on 2 g of silica gel using a gradient of chcl 3 : meoh ( 15 : 1 to 2 : 1 ). the product was dissolved in 11 ml of chcl 3 : meoh : h 2 o ( 4 : 6 : 1 ) and stirred with 1 . 5 g of whatman preswollen microgranular cation ( na + ) exchange concentrated in vacuo to give 37 mg of product ( 22 %). fab ms showed a mh + na ! ion at 752 . 4350 ( c 35 h 64 n 5 o 9 pna , 1 . 4 ppm ) and a m + 2na ! + ion at 774 . 4179 ( c 35 h 63 n 5 o 9 pna 2 , 2 . 0 ppm ). the inhibitory effects of synthetic phospholipid compounds on the replication of human immunodeficiency virus type 1 ( hiv - 1 ) virus in cells was examined by the plaque assay procedure of l . kucera et al ., aids research and human retroviruses 6 , 491 ( 1990 ). in brief , cem - ss cell monolayers were infected with hiv - 1 . infected cells were overlaid with rpmi - 1640 medium plus 10 percent fetal bovine serum ( fbs ) supplemented with different concentrations of inhibitor . plaques were counted at five days after infection . in this assay hiv - 1 syncytial plaques are seen as large , multicellular foci ( 10 to 25 nuclei / syncytium ) that appear either brown and granular or clear . since the number of hiv - 1 syncytial plaques correlates with reverse transcriptase ( rt ) and p24 core antigen activity in the hiv - 1 infected cell overlay fluids , the syncytial plaque assay can be used to quantify the amount of infectious virus . reverse transcriptase activity was assayed according to a described procedure ( b . j . poeisz et al ., proc . nat . acad . scie . ( u . s . a .) 77 , 7415 ( 1980 )). the activity of p24 core antigen induced by hiv - 1 infection of cem - ss cells was measured spectrophotometrically using the commercial coulter eia . the results ( table 1 ) showed that all of the lipid compounds tested have an ic 50 against hiv - 1 syncytial plaque formation ranging from 0 . 11 to 0 . 64 μm . the compounds &# 39 ; ic 50 for cell cytotoxicity ranged from 11 . 85 to 75 . 7 μm . the highest differential selectivity ( 611 . 7 ), which is a ratio of the cytotoxicity to the anti - hiv - 1 activity , was obtained with compound cp - 130 . table 1______________________________________evaluation of ether lipids for cytotoxicityand anti - viral activity in cem - ss cellsic . sub . 50 ( μm ) differentialcompounds cytotoxicity anti - hiv - 1 activity selectivity______________________________________cp - 128 31 . 6 0 . 14 225 . 7cp - 129 75 . 7 0 . 64 176 . 0cp - 130 67 . 2 0 . 11 611 . 7cp - 131 36 . 6 0 . 32 114 . 2jm - 1 ( cis ) 11 . 85 0 . 42 28 . 2______________________________________ cytotoxicity was measured by uptake of tdrh . sup . 3 into total dna in the presence of serial concentrations of compound . antihiv - 1 activity was measured by standard plaque assay using cemss cell monolayers . differential selectivity was determined by dividing the ic . sub . 50 for cytotoxicity by the ic . sub . 50 for antihiv - 1 activity . cytotoxicity was measured by uptake of tdr - h 3 into total dna in the presence of serial concentrations of compound . anti - hiv - 1 activity was measured by standard plaque assay using cem - ss cell monolayers . differential selectivity was determined by dividing the ic50 for cytotoxicity by the ic50 for anti - hiv - 1 activity . human hepatoblastomas ( hepg2 ) cells were tranfected with plasmid dna containing tandem copies of hbv genomes . these cells constituitively replicate hbv particles . hepg2 cells were treated with varying concentrations of cp - 128 to determine the toxic cell concentration ( tc 50 ) by neutral red dye uptake . also , the inhibitory concentration ( ic 50 ) of cp - 128 for hbv replication was determined by elisa . it was determined that cp - 128 cytotoxicity ( tc 50 ) was 61 . 7 μm and the anti - hiv - 1 activity ( ic 50 ) was 15 . 6 μm ( table 1 ). these data indicate that cp - 128 has selective anti - hbv activity . mechanism studies indicate that cp - 128 can have an inhibitory effect on the cellular production of hbv - induced dna , core antigen ( hbcag ) and &# 34 ; e &# 34 ; antigen ( hbeag ). as a result , it is postulated that cp - 128 and other compounds of the present invention are likely inhibiting the assembly of hbv nucleocapids and the packaging of viral pregenomic dna . the foregoing examples are illustrative of the present invention and are not to be construed as limiting thereof . the invention is defined by the following claims , with equivalents of the claims to be included therein .

a method of treating viral infections , and in particular hiv - 1 , hepatitis b virus and herpes viruses , is disclosed . the method comprising administering to a subject in need of such treatment an infection - combating amount of a phospholipid or phospholipid derivative .

as stated hereinabove , the present invention provides a safe and effective method for enhancing breasts . the method helps to firm up and support the breasts through the filling up of glands which end up taking up more space in the breasts hence resulting in stretching and enlarging said breasts . one should find a room or a place where one will be able to relax and feel comfortable and uninterrupted . one can do the exercise in one 30 to 40 minute sitting for both breasts or two 15 to 20 minute sittings , one for each breast . one can do these exercises on oneself or can even have someone else help . to begin with , one should be in a comfortable and relaxed position lying down or sitting up . one can have some soft relaxing music playing to soothe mind and body . if one wishes to use some massage oil , it can be applied a little bit on the finger tips of your hand ( optional — to prevent skin irritation but is not necessary ). with three fingertips of the hand clumped together , one begins about two inches below the left collar bone and gently massages with the fingers in a tiny one inch circle for about 20 seconds . the massaging must be gentle . one must not dig into the breast and hurt oneself . one is just trying to gently stimulate the lobules . take the time to feel the skin under the fingers and breast tissue and muscle below it . one wants to stimulate each individual lobule with the fingertips to make sure one massages each little section completely . after about 20 seconds one moves the fingers clockwise to the spot right next to where one just massaged and does the same thing for another 20 seconds . one continues doing this by going all the way around clockwise under the arm , at the bottom of the breast , to the middle of the chest and back to below the collarbone . one will continue going clockwise and working closer to the nipple in smaller and smaller circles . one should do this on about 50 contact points on the breast and for about 20 seconds each . it should take about 10 minutes . it is important to take the time to feel the texture of the breast . for the first few times until the lobules begin to grow , this exercise can also make one aware of any lumps or abnormalities . if so , one should stop immediately and have it checked by a doctor . once one has completed this exercise , begin kneading the left breast with the right hand much like if one were kneading dough for making bread . again paying special attention to try to contact all the lobules located in the breast tissue . one should knead and rub the breast going toward the nipple and away from the nipple . it should not hurt , if it does stop and try later . if it still hurts at a later time , stop doing it and contact a doctor . this should take between 5 and 10 minutes . while you are doing this , it is also important that one gently touches and rubs the nipple . the first few times it will probably be sensitive but it will become less sensitive as time passes . again , it should not hurt . if it does , stop and try later . if it continues to hurt contact a doctor . after a few weeks , as one continues this process , one will notice that the nipples and areola will also get larger as the breasts get larger . now do the same exercises with the right breast . as days pass , breasts and nipples will become less sensitive to the rubbing . one will notice the breasts beginning to feel slightly fuller . as one rubs the fingertips is small circles as in the first exercise and even when one kneads the breasts one will begin to feel the little lobules under the skin through the breast tissue . at this point , one knows that the breasts are beginning to change to be able to produce milk . in the second week , after each time one has finished kneading , touching and rubbing the breasts &# 39 ; nipples , one will begin to gently massage the breast in large circles from the outer sections of the breast , to the areola and nipple . beginning about 2 inches from the collarbone and making large circular motions working down to the areola . now move the hand to where the arm and chest meet and make circular motions down to the areola . move the hand to where the chest meets the armpit and do circular motions to the areola . one should continue doing this around the whole breast from the outer part of the breast to the areola for about 2 to 5 minutes , to try to direct the milk flow to the areola and nipple area . behind the areola are pockets where milk will run into . with the thumb and finger spread about 1½ to 2 inches apart , one will gently place the thumb and finger on the outside of the areola and press them on the breast towards the chest . you will slowly begin to squeeze the fingers towards the nipple to try to squeeze milk out of the nipple . do not squeeze the nipple itself because it will hurt and not accomplish anything . nothing will probably come out the first few times trying this procedure . by the end of the 2 nd or early in the 3 rd week one will notice a little bit of pasty discharge as one squeezes the areola out of the nipple . this is expected , because it is just clearing of the ducts . however , there should be no bleeding from the nipple . since there are many ducts ending at the nipple one might see this discharge a couple of times . after the bit of discharge is finished one will begin to notice just a drop or two of clear liquid which is colostrum . in the next few days one will notice a little more of this clear liquid come out of the breast when squeezed . after a week or so the liquid begins to change into a hazy white colour . later on as the milk production increases , the milk will become whiter . after the milk production is active , one has the choice to continue massaging and to extract the milk from each breast or just to continue stimulating the milk production every few days . one &# 39 ; s body gets into a routine and will fill up with milk as per the routine that is chosen . every person is different so monitoring one &# 39 ; s own situation is key . the fact that one should remember is that if one stops extracting the milk on a routine basis , the breasts will slowly stop producing it . if one decides not to do it anymore one can stop altogether or stop for a while and then restart over again at a later time . you can choose to increase the breast size a few weeks before a special occasion and then stop . some side effects may be associated to and result from the above described method but nothing out of the ordinary . they could include : tenderness or sensitivity in the breast and / or nipple due to the exercises / massages , tenderness or sensitivity in the breast and / or areola as the breast begins growing , muscle soreness due to some exercises , slight weight gain of approximately 5 to 10 pounds , and possibly slight leakage of milk from the breasts as the process advances . with respect to the above described method then , it is to be realized that the optimum results will be achieved by conforming as closely as possible to the program provided and that , in any event , results may vary from one participant to another . as a result of experiments utilizing the method of the present invention it has been recorded that if one were to stop the process , once restarting the process the results come faster . chest measurements have also shown that the increase in size is consistent across the whole of the breast area . further , it would appear that the method may work faster if a partner is present and performing the massaging steps probably due to the fact that said partner would have better access to all areas of the breast for performing the method . as for timeframes , it has been observed that a change in breast tissue texture would take place in the first week , followed by a slight size increase by the tenth day or so . a plateau is then reached between the second and third week , with continued increase after that . finally , no permanent side effects have been observed during or after the trials . other embodiments and uses of the invention will be apparent to those skilled in the art from consideration of the specification and practice of the invention disclosed herein . the specification and examples should be considered exemplary only and do not limit the intended scope of the invention .

a method for the enhancement of breasts is provided which is all natural and involves no drugs , topical or oral compositions , hormones or surgery and is self administered .

this invention relates to a process for the treatment of dental cavities , characterised in that it comprises at least one step wherein the dental surface or enamel is irradiated with neodymium yag laser . preferably , the dental surface or enamel is subject to an nd : yag laser irradiation with a degree of multi - focality and multiple focus which is variable and regulated at will from maximum focusing of the laser beam to complete defocusing . the variable focusing and defocusing is regulated at will and takes place on the optical fibre wherethrough the nd : yag laser is transmitted . the fact that different types of focus or focusing maybe applied at will on the laser beam is useful to eliminate and prevent many of the undesirable side effects that take place when there are abrupt thermal changes ( heating and cooling ) caused by irradiation on the dental enamel surface ( and , as it will be seen further below in a preferred embodiment , also on a biomaterial that is applied to said surface ). this undesirable side effects take place when the laser beam is focused , the most significant being the following : 1 . concave depressions in the form of super imposed slices of fussed and melted enamel on the treated surface , due to the abrupt heating . 2 . cracks of a very variable size on the same surface , due to the abrupt cooling . 3 . capture and incorporation of impurities and colouring agents in the enamel , which gives it an unaesthetic appearance . the possibility to regulate the focus or focusing of the laser beam at will allows for the treatment , whether preventive or corrective , of dental cavities and each of its applications to make all the undesirable side effects listed to disappear , leading to a microscopic , uniform , smooth , waterproof , very aesthetic microfusion , all of which increases the hardness and microhardness of the enamel ( and , as it will be seen further below , also of the biomaterial that may be applied on the enamel ). in a preferred embodiment , the dental surface or enamel is subjected to an nd : yag laser irradiation which density is between 3 and 30 j / mm 2 , both limits included , and , more preferably 4 j / mm 2 . in another preferred embodiment , the laser radiation frequency is between 1 and 10 khz , both limits included , and , more preferably 1khz . also preferably , the dental surface or enamel is subjected to an nd : yag irradiation which pulse energy is between 1 y 10 mj / pulse , both limits included , and , more preferably , 2 mj / pulse . in another preferred embodiment , the laser irradiation spot size is between 1 and 6 mm , both limits included , and , more preferably , 3 mm or 5 mm . in another preferred embodiment , the process disclosed is characterised in that the dental surface or enamel is subjected to an nd : yag laser irradiation which exposure time is between 1 and 6 seconds , both limits included , and , more preferably , 2 seconds . also preferably , the dental surface or enamel is subjected to an nd : yag laser irradiation which peak power is between 70 and 125 kw , both limits included , and , more preferably , 120 kw . in another preferred embodiment of the process , the dental surface or enamel is subjected to an nd : yag laser irradiation which pulse width is between 100 and 130 ns , both limits included , and , more preferably , 110 ns . another preferred condition for the laser irradiation is that the mean energy is between 10 and 50 w , both limits included , and , more preferably , 13 w . preferably , the dental surface or enamel is subjected to a nd : yag laser irradiation which total energy per application is between 15 and 220 j , both limits included , and , more preferably , 26 j . in a particular embodiment the process for the treatment of cavities is characterised in that the nd : yag laser is irradiated according to the following parameters : density : between 3 and 30 j / mm 2 both limits included , frequency : between 1 and 10 khz , both limits included , pulse energy : between 1 and 10 mj / pulse , both limits included , spot size : between 1 and 6 mm , both limits included , exposure time : between 1 and 6 s , both limits included , peak power : between 70 and 125 kw , both limits included , pulse width : between 100 and 130 ns , both limits included , average energy : between 10 and 50 w , both limits included , and total energy per application : between 15 and 220 j , both limits included . density : 4 j / mm 2 , frequency : 1 khz , pulse energy : 2 mj / pulse , spot size : 3 mm , exposure time : 2 s , peak power : 120 kw , pulse width : 110 ns , average energy : 13 w , and total energy per application : 26 j . density 4 j / mm 2 , frequency : 1 khz , pulse energy : 2 mj / pulse , spot size : 5 mm , exposure time : 2 s , peak power : 120 kw , pulse width : 110 ns , average energy : 13 w , and total energy per application : 26 j . preferably in the process , prior to the laser irradiation , the dental surface or enamel to be treated is etched with an acid for a time between 0 . 5 and 2 minutes , primarily in order to reduce the light reflection thereof . said acids is preferably orthophosphoric acid , and the etching time is 1 minute . the process disclosed so far is used for the total preventive treatment of dental cavities . if a step is added to the process wherein a biomaterial is applied on the dental surface or enamel or in dentin prior to the nd : yag laser irradiation , the process may also be applied as a corrective treatment for dental cavities . said application of the biomaterial is preferably performed in layers , with a thickness of between 0 . 5 and 2 mm , both limits included , and , more preferably , with a thickness of 1 mm . if a biomaterial is applied on the dental surface or enamel to be treated , both ( the biomaterial and dental surface ) are subjected to an nd : yag laser irradiation with a degree of multi - focality and multiple focus , which is variable and regulated at will from maximum focusing of the laser beam to complete defocusing . in this way , the biomaterial is irradiated and focus to the dental enamel surface or the dentin , until complete fixation by microfusion is achieved . as mentioned above in regards to the preventive treatment for dental cavities , the variable focusing and defocusing is regulated at will and takes place on the optical fibre wherethrough the nd : yag laser is transmitted . the fact that different types of focus or focusing may be applied on the laser beam is useful to eliminate and prevent the same undesirable side effects that were listed upon describing the characteristics of the preventive treatment . density 28 j / mm 2 , frequency : 5 khz , pulse energy : 8 mj / pulse , spot size : 3 mm , exposure time : 5 s , peak power : 72 kw , pulse width : 120 ns , average energy : 40 w , and total energy per application : 200 j . preferably , prior to applying the biomaterial , the decayed tissue is eliminated ; and , more preferably , the elimination is performed by means of diamond drills and tungsten carbide on a water - cooled turbine . preferably , after eliminating the decayed tissue and prior to applying the biomaterial , the dental area to be treated is weakly etched with an acid , preferably orthophosphoric acid , for a time between 20 seconds and 1 minute , preferably 30 seconds for the dental enamel and 15 seconds for the dentin . in another preferred embodiment , the corrective treatment for dental cavities disclosed so far comprises the following steps : eliminating the decayed tissue ; weakly etching the dental enamel surface or the dentin to be treated with orthophosphoric acid ; applying a biomaterial on said surface , and irradiating with a neodymium - yag laser , with the following parameters : density : 28 j / mm2 ; frequency : 5 khz ; pulse energy : 8 mj / pulse ; spot size : 3 mm ; exposure time : 5 s ; peak power : 72 kw ; pulse width : 120 ns ; average energy : 40 w , and total energy per application : 200 j . this invention also relates to a dental cementing and restorative biomaterial to be used in the corrective treatment described above , characterised in that it is composed of at least mineral hydroxyapatite . preferably , the content by weight of hydroxyapatite is at least 75 %. in order to facilitate the application thereof the biomaterial preferably , consists of a paste that contains at least dense , powdered , micronised mineral hydroxyapatite , mixed with gelatine . in a particular embodiment , the hydroxyapatite maybe mixed with other substances that favour the application thereof and , moreover , leave no residues upon being irradiated with nd : yag laser . one example is the use of gelatines . study of the effects of the neodymium yag laser upon being applied on the human dental surface or enamel in order to perform the process of this invention , a sample was selected composed of 400 healthy human teeth , extracted for orthodontics reasons and carefully selected on the basis of the criterion that they did not present any lesion that might mask the morphological effects of the treatment . the teeth were fixed with 2 . 5 % of glutraaldehyde in 0 . 1 m buffered sodium phosphate ( ph 7 . 02 ) at a temperature of 4 ° c . for 12 hours . subsequently , they were washed in the same buffered in 3 baths , 10 minutes each , and , later , with distilled water ([ 28 ]). subsequently , they were washed with 12 % sodium hypochlorite for 1 hour in order to remove the organic matter from the surface and , finally , all the teeth were weakly etched in a solution of 0 . 5 m orthophosphoric acid for 1 minute , and later rinsed with abundant distilled water ([ 28 ], [ 29 ], [ 30 ] and [ 31 ]) ( fig1 ). the 400 teeth in the sample were coated with acid - resistant wax , leaving 2 uncoated square windows on the enamel of each tooth : one of the windows was used as a control and the other was irradiated with the nd : yag laser ( fig1 and 13 ). after this was done , each of the teeth was individually placed in 50 ml of a de - mineralising solution ( ph = 4 . 5 ) containing 5 % of hydroxyethylcellulose , 0 . 1 m of lactic acid , 1 . 5 mm of calcium chloride and 1 . 5 mm of sodium phosphate , at 37 ° c . for 60 days , in order to form artificial cavity lesions . the corresponding window of each of the 400 teeth in the sample was subjected to irradiation with a dcr - 2 nd : yag laboratory laser system from quanta - ray ( united kingdom ). density : 4 j / mm 2 . frequency : 1 khz . pulse energy : 2 mj / pulse . spot size : 3 mm . exposure time : 2 s . pick power : 120 kw . pulse width : 110 ns . average energy : 13 w . total energy per application : 26 j . from the total sample , 300 teeth were randomly processed in accordance with the conventional sem examination method and coated or metallised with gold in the bio - rad metalliser , model sc 5 . 000 ( holland ). this dental sample was examined with a philips 515 sem ( holland ) at 20 kv , as well as with the edax chemical elemental analyser from philips ( holland ) for the sem . the other sample , composed of a 100 teeth , which was not processed to be examined under the sem , was used . each of the teeth was embedded in epoxy resin such that a portion of a cross section of the lesion and the normal inner layer of the enamel were exposed . this surface was connected in a buehler motopol 8 polishing machine ( germany ) using a metallographic paper grid . subsequently , they were serially polished with 15 mμ , 6 mμ and 1 mμ with a buehler diamond abrasive ( germany ) and , subsequently , with buelher metadi diamond spray ( germany ) on a buehler polishing cloth ( germany ). a diamond tip under a 10 - g load was used in a matsuzawa mth - 1 ( japan ). the results for the kdn hardness were calculated using the equation : where l is the entry length of each depression in the diamond , in microns , and f is the applied force in grams . the most significant structure or change following the laser treatment is the loss of the characteristics of the crystal surface structure ( prisms ), due to fusion of the enamel ( fig1 , 15 and 16 ). these changes were not accompanied by the formation of cracks . the formation of artificial cavities as a lesion always appeared in the control enamel windows ( not treated ); the formation in appearance thereof was completely inhibited in the windows that were laser - irradiated . the microhardness profile of an enamel with laser and the profile of the enamel not treated with laser differ in the degree of hardness and the large increase in khn , that is , a greater hardness , mat be clearly observed in the enamel of the windows treated with laser ; likewise , a significant decrease khn ( lower hardness ) is observed in the control enamel of the untreated windows . it seems to be acceptable that the hardness values measured are proportional to the enamel mineral content ; and , from the profiles found , we may assume that the modifications in the enamel permeability may play a significant role in these processes , which have already been widely discussed in the literature by various authors ([ 32 ], [ 33 ], [ 34 ] and [ 35 ]). the effect presented is a combination of the change in permeability and the increase in the intrinsic resistance to the acid in the solution . therefore , the decrease in the solubility of the enamel treated with the nd : yag laser under the conditions applied eliminates the pores or access spaces to deeper areas , thereby preventing ionic exchange between these areas and the de - mineralising solution ( which produces the artificial cavity lesions ). for all these reasons , it prevents and avoids the formation of cavity lesions . study of the physical - mechanical effects of the neodymium yag laser upon being applied on the human dental surface or enamel . a total sample of 460 healthy teeth was used in this study , whereof 230 teeth were randomly selected for the measurements , and the other 230 were used as a control sample . as in the preceding example , they were carefully selected to ensure that there were no lesions that might mask the effects of the treatment . the teeth selected for the measurements were cleaned with 12 % sodium hypoclhorite for 1 hour in order to eliminate the organic matter from the surface . subsequently , they were rinsed with distilled water and their enamel crowns were cut and separated from the roots . from the 230 teeth , a random sample of 150 crowns was used for the microhardness measurements and the other sample , composed of 80 crowns , was used for the permselectivity and permeability studies . the teeth in the hardness measurement sample were polished perpendicularly to the direction of the prisms ( parallel to the surface ) with polishing paper in a buehler motopol ( polishing machine ( germany ), in order to obtain a small plateau and , subsequently , serially polish them with 15 mμ , 6 mμ and 1 mμ of buehler abrasive diameter ( germany ) and , later , with buehler metadi diamond spray ( germany ) on a buehler polishing cloth ( germany ). the teeth in the permeability study sample were embedded in epoxy resins and subsequently polished . later , an 800 - mμ section was cut using a buehler isometo low - speed saw or cutter ( germany ) and mounted on a concentration of cells . the 230 teeth selected for the measurement sample were subjected to irradiation with a dcr - 2 nd : yag laboratory laser system from quanta - ray ( united kingdom ). density : 4 j / mm 2 . frequency : 1 khz . pulse energy : 2 mj / pulse . spot size : 5 mm . exposure time : 2 s . peak power : 120 kw . pulse width : 110 ns . average energy : 13 w . total energy per application : 26 j . in order to measure the microhardness , a knoop diamond under a 50 - g load was used in a matsuzawa mth - i machine ( japan ). the knoop hardness values were calculated on the basis of the length of each depression in the diamond , using the equation : where f is the force applied in grams and l is the length of the depression produced by the diamond , measured in microns . 20 depressions were made on the plateau of each tooth at 150 mμ , separated by regular space intervals . the hardness measurements on the enamel treated with laser were performed by the same operator and close to the depressions made on the untreated enamel , in order to minimise the experimental error . in all the experiments , the electromagnetic field ( e . m . f .) was measured in a concentration of cells of the type : ref . electr . // solution / membrane - / solution // ref . 1 enamel 2 electr . ag +/ agc // / / // ag +/ agc . where the double vertical lines indicate the location of the clk convergence points . the potential developed through the membranes was measured with a hipotest high - impedance recording potentiometer , model pe - w ( belgium ). all the solutions were prepared with analytical reagent - grade salts and distilled water . 25 of them were buffered with sodium phosphate at ph = 7 . 02 and the influence of the buffer ions on the e . m . f . was discarded . the basis for the calculation is the theory of teorell - meyer - sievers ( tms theory ), which describes the transport of ions through a charged porous membrane the faces of which are in equilibrium with a solution of the same electrolyte . the total membrane potential e is calculated as follows : where r is the gas constant , f is the faraday constant , u =( d − 1 / d + 1 ), a and x are the membrane charge , x and d are determined by applying an interactive minimum adjustment method . the potentials of the membranes not treated with laser were positive and became more positive when the concentration of kci increased . when the enamel membranes are treated with laser , the membrane potentials become more positive than those measured in the natural membranes of the control sample , indicating that the permselectivity of the enamel membranes is modified by the laser radiation . the microhardness values obtained in the control sample of a healthy enamel not treated with laser ranged between 340 and 388 ; these values agree with those previously published by other authors ([ 36 ] and [ 37 ]). in all the teeth in the sample we observe that the knoop hardness increases when measured after the laser was applied . these increases were significant and always occurred when their values were connected and related to the initial hardness values of the corresponding enamel prior to being treated . we observe and show that the high initial hardness values correspond to a given increase in hardness ; and a lower initial hardness corresponds to a big increase in hardness following the laser radiation . study of the morphological effects of the neodymium yag laser upon being applied on the human dental surface or enamel . in order to perform this study , a sample of 350 human teeth extracted for orthodontic reasons was used . they were carefully selected , in order to ensure that there were no lesions that might mask the morphological effects for the treatment . from the total teeth selected , a random sample of 250 teeth were treated with laser on the labial or vestibular surface , and the other 100 teeth were used as a control sample . the 250 teeth in the sample to be treated with laser were fixed with 2 . 5 % glutaraldehyde , in 0 . 1 m sodium phosphate buffer ( ph = 7 . 02 ), at a temperature of 4 ° c . for 12 hours . subsequently , they were washed in the same buffer , with 10 - minute baths each , and , later , with distilled water . thereafter , the teeth were cleaned with 12 % sodium hypochlorite for 1 hour , in order to eliminate the organic matter on the surface and , finally , they were etched with 0 . 5 m orthophosphoric acid for 1 minute and rinsed abundant distilled water . the 250 teeth etched with acid were subjected to irradiation with a dcr - 2 nd : yag laboratory laser system for quanta - ray ( united kingdom ). density : 4 j / mm 2 . frequency : 1 khz . pulse energy : 2 mj / pulse . spot size : 5 mm . exposure time : 2 s . peak power : 120 kw . pulse width : 110 ns . average energy : 13 w . total energy per application : 26 j . a siemens lgk 7672 helium - neo laser ( meinchen , germany ) was used to visualise and locate the nd : yag laser beam in the treated area . the teeth were processed in accordance with the conventional sem method , and coated or coated with gold with a bio - rad sprayer , model sc 5000 ( netherlands ). the entire sample of teeth was examined with a philips 515 scanning electron microscope ( netherlands ) at 5 kv . the degree of roughness of the enamel surface was measured with a mituyo suftest 201 surface roughness meter ( japan ). the measurements were performed on teeth treated with laser and control teeth , using a cut - off value ( lambda c ) of 0 . 25 mm and an evaluation length ( 5 × lambda c ) of 1 . 25 mm . several roughness profile parameters were obtained . the most significant were ra ( lower arithmetic deviation of the roughness profiles ) and pc ( peak count ); defined as follows : ra is the lower arithmetic deviation of the absolute values of the profiles deviated from the central line with the evaluation of length lm . the roughness profiles are given as y = f ( x ), with the “ x ” axis for the centre of the line , and the “ y ” axis in the direction of the magnification of the vertical line . pc is the number of peak profiles ( maximum ) per unit of length . in order to determine the peak count , two parallel lines are drawn at a given level , below and above the central line over the longitudinal evaluation . a peak profile is defined as the proportion of the projecting profile that produces above the upper line , at the two adjacent points of intersection of the profile with the lower line . in this study , a level of 1 . 3 mμ was used to determine the peak count . the surface of human dental enamel normally shows a somewhat smooth area , which may be observed under the sem . in healthy human dental enamel not subjected to any treatment , the most significant structural reliefs are represented by the perikymata ( 21 ), which are regularly distributed as multiple small waves ( fig1 , 18 , 19 and 20 ). a typical roughness measurement of this surface is that obtained on the labial surface of a healthy human premolar tooth with the following parameters : ra = 1 . 6 ± 0 . 1 mμ , and pc = 0 cm − 1 ( fig2 ). under scanning electron microscopy , the characteristic morphology of the hydroxyapatite prisms and the interprismatic matter on an enamel surface etched with acid are clearly observed , and the polyedric structure of the prisms is also sharply seen . the roughness of the enamel etched with acid greatly increases . this increase is represented by a rise in the ra and pc parameters as compared to the values corresponding to healthy non - etched enamel . in all the samples etched with acid , it was observed that ra ranged from 1 . 8 to 2 . 3 mμ , and pc ranged from 35 to 50 cm − 1 . the effects caused by application of the laser under certain parameters on the surface of an enamel previously etched with acid and observed under the sem reveals the loss of the prisms &# 39 ; characteristic structure due to the surface fusion of the dental enamel ( fig2 ). this structural change is directly related to the general decrease in the rough surface ( fig2 ), taking into consideration the significant fact that the enamel etched with acid was evaluated by measuring its profile . the roughness parameter values obtained following the treatment with laser range between 1 . 2 and 1 . 6 mμ for ra , and between 0 and 5 cm − 1 for pc . the sample of teeth etched with acid and treated with laser exhibited a smoother surface , that is , with a lower roughness than the control sample . fig2 shows the roughness profiles obtained on the vestibular face of the enamel surface of different tooth samples : a ) roughness profiles of the control dental sample , teeth not etched with acid and not treated with laser . b ) roughness profiles of the treated dental sample , teeth etched with acid and not treated with laser . c ) roughness profiles of the treated dental sample , teeth etched with acid and subsequently treat - ed with nd : yag laser . we observe the greatest increase in the roughness of the enamel following etching with acid ( b ) and a decreased in or loss of roughness following application of the laser ( c ), the latter being even lower than in the control sample ( a ). this indicates that the absorption of laser energy was sufficient to modify the structure of the enamel surface etched with acid , without the need to coat it with absorbent colouring substances . study of new technology with neodymium : yag laser and mineral hydroxyapatite as a new cementing and restorative material for human teeth . in order to perform the process of this invention , a sample composed of 350 human teeth was selected . the selection criterion was that they show dental cavities ( 250 teeth ) or crown fractures ( 100 remaining ones ). in order to eliminate the decayed tissue , the interior of each tooth with cavities was treated with komet diamond drills and tungsten carbide ( germany ); located on a water - cooled kayo turbine ( germany ). the entire inside of the cavities and the edges of the preparations were etched with 36 % orthophosphoric acid , the enamel for 30 seconds and the dentin for 15 seconds ; subsequently , they were washed with abundant water and dried . the cavities were made , prepared and treated by the same operator in order to minimise the potential experimental error . all the teeth in the sample were fixed with 2 . 5 % glutaraldehyde in 0 . 1 m buffered sodium phosphate ( ph = 7 . 02 ), at 4 ° c ., for 12 hours . subsequently , they were washed with the same buffer in 3 baths , 10 minutes each , and , later , with distilled water . hardness measurements were performed on cross sections of the biomaterial cements applied with the laser , in order to verify whether this hardness is similar to that of healthy dental enamel . the effects generated on the biomaterial by the nd : yag laser irradiation were studied in terms of the microhardness and permselectivity thereof , being evaluated by means of knoop studies and by teorell - meyer - sievers theory , respectively . the treated teeth were studied with the scanning electron miscroscope ( sem ) on the entire outer surface of the inner junction area between the cement biomaterial and the tooth ( enamel and dentin ). roughness measurements were also performed after applying the biomaterial with the laser , on the cementing and restorative surfaces , as well as on the adjacent enamel surface . the total sample was randomly distributed in the following manner : 80 teeth with cavities and 25 teeth with fractures were used for the hardness study and the observation in the sem analyser ; another 80 decayed teeth and 30 fractures teeth were used for the microhardness and permselectivity studies ; and , as the final group , 90 teeth with cavities and 45 teeth with fractures were used for the roughness measurements and the observations with the sem . the teeth in the sample for the hardness measurements were polished with a specific paper in a buehler motopol 8 polishing machine ( germany ). subsequently , they were serially polished with 15 mμ , 6 mμ and 1 mμ of buehler abrasive diamond ( germany ) and , later , with buehler metadi diamond spray ( germany ) on a buehler polishing cloth ( germany ). the teeth in the sample for the permeability studies were embedded in an epoxy resin and polished ; finally , an 800 - mμ section was cut using a buehler isometo low - speed saw or cutter ( germany ) and mounted on a concentration of cells . the composition of the biomaterial paste applied on the teeth was the following : dense , powdered , micronized mineral hydroxyapatite , mixed with gelatine in order to form a very consistent , thick paste . the density of the paste was controlled by an isaka rx - 10 densiometer ( japan ). this hydroxyapatite paste was used as a cementing and restorative material for teeth ; it was applied with an aesculap 1057 condenser - moulder instrument ( germany ), by layers , each layer being approximately 1 mm thick . during the application thereof , the hydroxyapatite was subjected to irradiation with a dcr - 2 nd : yag laboratory laser system from quanta - ray ( united kingdom ). moreover , each layer of hydroxyapatite was fused to the preparation walls , dentin and / or dental enamel with the same laser . density : 28 j / mm 2 . frequency : 5 khz . pulse energy : 8 mj / pulse . spot size : 3 mm . exposure time : 5 s . peak power : 72 kw . pulse width : 120 ns . average energy : 40 w . total energy per application : 200 j . a siemens lgk 7672 helium - neon laser ( meinchen , germany ) was used to visualise and locate the laser beam in the treated area . they were performed with a matsuzawa mth - 1 hardness meter ( japan ), using a diamond tip under a 10 - g load . the kdn hardness numbers were calculated by developing the following equation : where l is the length of each depression ( entry ) of the diamond in microns and f is applied force in grams . a knoop diamond under a 50 - g load in a matsuzawa mth - 1 microhardness meter ( japan ) was used . 20 depressions were made at 150μ , separated at regular space intervals ( equidistant ) on the hydroxyapatite plateau in each tooth . the microhardness measurements on the cementing and restorative material , in this case mineral hydroxyapatite , and on the adjacent dental enamel , were performed by the same operator in order to minimize the experimental error . all the solutions for the permselectivity measurements were prepared using reagent - grade salts and distilled water . they were buffered with sodium phosphate at ph = 7 . 02 and the influence of the buffer ions on the electromagnetic field ( e . m . f .) was discarded . the bases for the calculation is the teorell - meyer - sievers theory ( tms ), which describes the transport of ions through a charged porous membrane the faces of which are in equilibrium with a solution of the same electrolyte . where r is the gas constant , f is the faraday constant , u =( d − 1 ÷ d + 1 ), a and x are the membrane charge , x and d are determined by applying an interactive minimum adjustment method . after being treated with the biomaterial and the nd : yag laser , the teeth in the sample were widely studied by the scanning electron microscope analyzer . the teeth in the sample were processed in accordance with the conventional method and coated with gold , using a bio - rad metalliser , model sc 5000 ( netherlands ). moreover , these teeth were subsequently examined with a philips 515 sem ( netherlands ) at 20 kv . the degree of roughness of the surface of the cementing and restorative mineral hydroxyapatite was measured with a mituyo suftest 201 roughness and surface roughness meter ( japan ). a cut - off value ( lambda c ) of 0 . 25 mm and an evaluation length ( 5 × lambda c ) of 1 . 25 mm were used . the ra and pc roughness parameters were used . the most significant were ra ( lower arithmetic deviation of the roughness profiles ) and pc ( peak count ); defined as follows : ra is the lower arithmetic of the absolute values of the profiles deviated from the central line with the evaluation of length lm . the roughness profiles are given as y = f ( x ), with the “ x ” axis for the centre of the line , and the “ y ” axis in the direction of the magnification of the vertical line . pc is the number of peak profiles ( maxima ) per unit of length . in order to determine the peak count , two parallel lines are drawn at a given level , below and above the central line over the longitudinal evaluation . a peak profile is defined as the proportion of the projecting profile that produces above the upper line , at the two points adjacent to the intersection between the profile and the lower line . in this work , we have used a level of 1 . 3 mμ to determine the peak count . in order to study the teeth , a zeiss polarised - light optical microscope ( germany ) was also used . mineral hydroxyapatite , fused with a nd : yag laser and used as a cementing and restorative material , presented a completely amorphous structure , without a dense , compact crystallographic distribution ( fig2 and 26 ). the microfusion of mineral hydroxyapatite was not accompanied by the formation of cracks ( fig2 , 28 and 29 ). the hardness of mineral hydroxyapatite , measured in kdn in accordance with the khn equation , is similar of that of healthy dental enamel . the knoop microhardness values of mineral hydroxyapatite obtained range between 335 and 380 , and are within the range of microhardness values for healthy enamel , that is , between 340 and 388 , the values published by other authors ([ 37 ], [ 38 ], [ 39 ], [ 40 ] and [ 41 ]). the roughness measurement produced the parameters ra = 1 . 4 to 1 . 8 mμ and pc = 2 to 5 cm − 1 , which , compared to those of healthy enamel , are equivalent and very similar . a typical roughness measurement for healthy enamel is that obtained on the labial surface of a healthy human premolar tooth , which has the parameters : ra = 1 . 6 ± 0 . 1 mμ , and pc = 0 cm − 1 . this indicates that the absorption of energy was sufficient to produce the microfusion of mineral hydroxyapatite without the need to use absorbent colouring substances ( fig3 and 31 ). no residues of the excipient ( gelatine ) of the hydroxyapatite paste were found following the microsufion , which shows that , although it is the necessary carrier to obtain a pasta consistency , when it is applied on the cavity , said excipient is volatilised by the laser radiation , and the fused mineral hydroxyapatite remains fully compact ( fig3 and 33 ). the junction of the dentin and dental enamel with the mineral hydroxyapatite takes place by the fusion of both parts ( fig3 , 35 , 36 and 37 ), which confers a very high resistance , much higher than that of mechanical - retentive ( amalgams ) and adhesive ( glass ionomers and composites ) retentions . the application of the laser radiation takes place with maximum energy , in a very short period of time ; consequently , it does not cause thermal damage in soft tissues of in the dental pulp . fig1 . scanning electron microscope ( sem ) view : normal appearance of human dental enamel . structural distribution in the form of prisms perpendicular to the outer surface . fig2 . sem : normal appearance of human dental enamel . the distribution of the hydroxyapatite prisms is perpendicular to the outer enamel surface , giving the tooth considerable mechanical resistance . fig3 . tooth ( incisor ) impregnated with colouring agent in order to increase the laser absorption energy . the colouring agent that was applied on this tooth was indian ink . fig4 . tooth with absorbent colouring agent ( indian ink ) prepared on epoxy resin . fig5 . unaesthetic appearance of the enamel after being laser irradiated . residues of colouring agent trapped in the adamantine structure of the dental enamel . fig6 . sem : superimposed impacts of enamel fused with laser in the form of slices . appearance of the cracks produced . fig7 . sem : appearance of the enamel crack following laser irradiation . fig8 . sem : appearance of the fused , impacted enamel in slices and formation of cracks following laser irradiation . fig9 . sem : appearance of the crack formed in the enamel following application of the laser . fig1 . sem : appearance of the fused enamel and crack produced instantaneously with the application of the laser . fig1 . sem : appearance of the normal enamel surface after preparing the dental sample . fig1 . tooth ( canine ) completely covered with acid - resistant wax and with two windows in the enamel , a control window and a window for the application of the nd : yag laser . fig1 . dental crown ( molar ) previously cut to separate it from the root and completely coated with acid - resistant wax and the two windows in the enamel , a control window and a window for the application of the nd : yag laser . fig1 . sem : the loss of the enamel surface structural characteristics on the upper area treated with laser ( microfused enamel ), and the structural preservation in the untreated lower area may be observed . no cracks formed following application of the laser . fig1 . sem : appearance of the loss of the enamel surface structural characteristics in the upper area , treated with laser ( microfused enamel ), and structural preservation in the untreated lower area . no cracks formed following laser irradiation . fig1 . sem : appearance of the enamel microfusion in the lower area , treated with laser . it was not accompanied by the formation of cracks . fig1 . sem : normal structural distribution of dental enamel , represented by the perikymata , forming small waves . fig1 . sem : normal structural distribution of dental enamel , represented by the perikymata , forming small waves . fig1 . sem : normal structural distribution of dental enamel , represented by the perikymata , forming small waves . fig2 . sem : normal structural distribution of dental enamel , represented by the perikymata , forming small waves . fig2 . tooth ( molar ) in epoxy resin for the roughness measurement . fig2 . sem : surface microfusion of the enamel prisms produced by the laser and loss of roughness and surface roughness . fig2 . sem : loss of the surface structure of the enamel prisms due to the microfusion thereof produced by the treatment with nd : yag laser . there is a loss of roughness and surface roughness . fig2 . graph of the roughness profiles of dental samples ( a ), ( b ) and ( c ). fig2 . sem : amorphous , dense , compact structure of mineral hydroxyapatite fused by laser and used as a dental cementing and restorative material . fig2 . sem : the left - side area shows the mineral hydroxyapatite fused by the laser and its junction to the dental enamel of the untreated right - hand area , with the normal surface characteristics thereof . there is a total absence of cracks in the treated area . fig2 . sem : the lower area shows the mineral hydroxyapatite fused by the laser and its junction to the dental enamel in the untreated upper area , with the normal surface characteristics thereof . there is a total absence of cracks in the treated area . fig2 . sem : mineral hydroxyapatite fused by the laser with its amorphous surface appearance . fig2 . sem : absence of cracks in the upper area , treated with laser ; we may observe the junction by fusion of mineral hydroxyapatite with the normal dental enamel of the lower area . fig3 . zeiss polarised - light optical microscope ( germany ), for the study of teeth at lower magnifications . fig3 . optical microscope ( o / m ): we may observe the microfusion junction area ( arrows ) of fused mineral hydroxyapatite and the dental structure ( dentin and enamel ) in two cements ( one of them identified with a blue gel ). fig3 . 0 / m : we may observe the microfusion junction areas ( arrows ) of fused mineral hydroxyapatite and the dental structure ( dentin and enamel ) in a cement . no gelatin residues from the paste are observed . fig3 . o / m : we may observe the mircrofusion junction areas ( arrows ) of fused mineral hydroxyapatite and the dental structure ( dentin and enamel ) in a cement . no gelatine residues from the paste are observed . fig3 . o / m : we may observe the microfusion junction areas ( arrows ) of fused mineral hydroxyapatite and the dental structure ( dentin and enamel ) in a cement . fig3 . o / m : we may observe the microfusion junction areas ( arrows ) of fused mineral hydroxyapatite and the dental structure ( dentin and enamel ) in a cement . fig3 . o / m : we may observe the microfusion junction areas ( arrows ) of fused mineral hydroxyapatite ( h ) and the dental structure ( dentin and enamel ) in a restoration . fig3 . o / m : we may observe the microfusion junction areas ( arrows ) of fused mineral hydroxyapatite ( h ) and the dental structure ( dentin and enamel ) in a restoration . zhang x z , anderson p , dowker s e , elliott j c . optical profilometric study of changes in surface roughness of enamel during in vitro demineralization . caries res . 2000 march - april ; 34 ( 2 ) : 164 - 74 . kawasaki k , tanaka y , takagi o . crystallographic analysis of demineralized human enamel treated by laser - irradiation or remineralization . arch oral biol . 2000 september ; 45 ( 9 ) : 797 - 804 . margolis h c , zhang y p , lee c y , kent r l jr , moreno e c . kinetics of enamel demineralization in vitro . j dent res . 1999 july ; 78 ( 7 ) : 1326 - 35 . brookes s j , shore r c , robinson c , wood s r , kirkham j . copper ions inhibit the demineralisation of human enamel . arch oral biol . 2003 january ; 48 ( 1 ) : 25 - 30 . kuhar m , cevc p , schara m , funduk n . in vitro permeability and scanning electron microscopy study of acid - etched and ground enamel surfaces protected with dental adhesive coating . j oral rehabil . 1999 september ; 26 ( 9 ) : 722 - 30 . turssi c p , schiavoni r j , serra m c , froner i c permeability of enamel following light - activated power bleaching . gen dent . 2006 september - october ; 54 ( 5 ) : 323 - 6 . zanet c g , arana - chavez v e , fava m . scanning electron microscopy evaluation of the effect of etching agents on human enamel surface . j clin pediatr dent . 2006 spring ; 30 ( 3 ) : 247 - 50 . pick r m . lasers in dentistry : where we are today . dent today . 2000 september ; 19 ( 9 ) : 50 - 3 . cernavin i , hogan s p . the effects of the nd : yag laser on amalgam dental restorative material . aust dent j . 1999 june ; 44 ( 2 ) : 98 - 102 . neev j , nelson j s , critelli m , mccullough j l , cheung e , carrasco w a , et al . ablation of human nail by pulsed lasers . lasers surg med . 1997 ; 21 ( 2 ) : 186 - 92 . [ 11 ] yamada m k , uo m , ohkawa s , akasaka t , watari f . three - dimensional topographic scanning electrón microscope and raman spectroscopic analyses of the irradiation effect on teeth by nd : yag , er : yag , and co ( 2 ) lasers . j biomed mater res b appl biomater . 2004 oct . 15 ; 71 ( 1 ): 7 - 15 . mccormack s m , fried d , featherstone j d , glena r e , seka w . scanning electron microscope observations of co2 laser effects on dental enamel . j dent res . 1995 october ; 74 ( 10 ) : 1702 - 8 . [ 13 ] anic i , segovic s , katanec d , prskalo k , naj zar - fleger d . scanning electrón microscopic study of dentin lased with argon , co2 , and nd : yag láser . j endod . 1998 february ; 24 ( 2 ) : 77 - 81 . [ 14 ] mcdavid v g , cobb c m , rapley j w , glaros a g , spencer p . láser irradiation of bone : iii . long - term healing following treatment by co2 and nd : yag lasers . j periodontol . 2001 february ; 72 ( 2 ) : 174 - 82 . [ 15 ] westerman g h , hicks m j , flaitz c m , powell g l , blankenau r j . surface morphology of sound enamel after argon laser irradiation : an in vitro scanning electron microscopy study . j clin pediatr dent . 1996 fall ; 21 ( 1 ): 55 - 9 . [ 16 ] hsu c y , jordán t h , dederich d n , wefel j s . effects of low - energy c02 laser irradiation and the organic matrix on inhibition of enamel demineralization . j dent res . 2000 september ; 79 ( 9 ): 1725 - 30 . [ 17 ] aminzadeh a , shahabi s , walsh l j . raman spectroscopic studies of c02 laser - irradiated human dental enamel . spectrochim acta a mol biomol spectrosc . 1999 june ; 55a ( 6 ) : 1303 - 8 . [ 18 ] bahar a , tagomori s . the effect of normal pulsed nd - yag laser irradiation on pits and fissures in human teeth . caries res . 1994 ; 28 ( 6 ): 460 - 7 . [ 19 ] gelskey s c , white j m , gelskey d e , kremers w . vapor emissions resulting from nd : yag laser interaction with tooth structure . dent mater . 1998 november ; 14 ( 6 ): 453 - 7 . [ 20 ] myaki s i , watanabe i s , eduardo cde p , issao m . nd : yag laser effects on the occlusal surface of premolars . am j dent . 1998 june ; 11 ( 3 ): 103 - 5 . [ 21 ] harris d m , white j m , goodis h , arcoria c j , simon j , carpenter w m , et al . selective ablation of surface enamel caries with a pulsed nd : yag dental laser . lasers surg med . 2002 ; 30 ( 5 ) : 342 - 50 . [ 22 ] yamada y , hossain m , kawanaka t , kinoshita j , matsumoto k . removal effects of the nd : yag láser and carisolv on carious dentin . j clin laser med surg . 2000 october ; 18 ( 5 ) : 241 - 5 . [ 23 ] depraet f j , de bruyne m a , de moor r j . the sealing ability of an epoxy resin root canal sealer after nd : yag laser irradiation of the root canal . int endod j . 2005 may ; 38 ( 5 ): 302 - 9 . [ 24 ] pick r m . lasers in dentistry : where we are today . dent today . 2000 september ; 19 ( 9 ): 50 - 3 . no abstract available . [ 25 ] ferro d , barinov s m , rau j v , teghil r , latini a . calcium phosphate and fluorinated calcium phosphate coatings on titanium deposited by nd : yag laser at a high fluence . biomaterials . 2005 march ; 26 ( 7 ): 805 - 12 . [ 26 ] kobayashi c a , fujishima a , miyazaki t , kimura y , matsumoto k , osada t , et al . effect of nd : yag laser irradiation on shear bond strength of glass - ionomer luting cement to dentin surface . int j prosthodont . 2003 september - october ; 16 ( 5 ) : 493 - 8 . [ 27 ] pioch t , moller d , staehle h j , hoppe w . solubility of enamel and synthetic hydroxyl apatite on irradiation . dtsch zahnarztl z . 1991 june ; 46 ( 6 ): 413 - 5 . german . [ 28 ] quintana e , márquez f , roca i , torres v , salgado j . some morphologic changes induced by nd : yag laser on the noncoated enamel surface : a scanning electron microscopy study . lasers surg med . 1992 ; 12 ( 2 ): 131 - 6 . [ 29 ] swift e j jr , edwards g s , perdigao j , thompson j y , nunes m f , ruddell d e , et al . free - electron laser etching of dental enamel . j dent . 2001 july ; 29 ( 5 ): 347 - 53 . [ 30 ] sazak h , turkmen c , gunday m . effects of nd : yag laser , air - abrasion and acid - etching on human enamel and dentin . oper dent . 2001 september - october ; 26 ( 5 ): 476 - 81 . [ 31 ] zentner a , duschner h . structural changes of acid etched enamel examined under confocal laser scanning microscope . j orofac orthop . 1996 august ; 57 ( 4 ): 202 - 9 . english , german . [ 32 ] korytnicki d , mayer m p , daronch m , singer jda m , grande r h . effects of nd : yag laser on enamel microhardness and dental plaque composition : an in situ study . photomed laser surg . 2006 february ; 24 ( 1 ): 59 - 63 . [ 33 ] kuramoto júnior m , matson e , turbino m l , marques r a . microhardness of nd : yag laser irradiated enamel surfaces . braz dent j . 2001 ; 12 ( 1 ): 31 - 3 . [ 34 ] kielbassa a m , wrbas k t , schulte - monting j , hellwig e . correlation of transversal microradiography and microhardness on in situ - induced demineralization in irradiated and nonirradiated human dental enamel . aren oral biol . 1999 march ; 44 ( 3 ): 243 - 51 . [ 35 ] salama s n , kinawi n a . x - ray study and microhardness data of some dental enamel species . biomaterials . 1989 april ; 10 ( 3 ): 209 - 12 . [ 36 ] fosse g , rosengren b , skaale s , leknes k , wulff l . an in vivo method for microhardness measurements on human teeth . scand j dent res . 1986 february 94 ( 1 ): 27 - 37 . [ 37 ] demetriades a , koulourides t . experimental studies of dental caries . measurements of enamel microhardness . stomatologia ( athenai ). 1969 mar .- apr . 26 ( 2 ): 69 - 78 . greek , modern . [ 38 ] marquez f , quintana e , roca i , salgado j . physical - mechanical effects of nd : yag laser on the surface of sound dental enamel . biomaterials . 1993 ; 14 ( 4 ): 313 - 6 . [ 39 ] danilina t f , bagmutov v p , slayskii lul . the microhardness of dental tissues as an index of their normal functional stability and in pathological states . stomatologiia ( mosk ). 1998 ; 77 ( 3 ): 9 - 11 . russian . [ 40 ] klinger h g , wiedemann w , docos e . mechanical properties and acid solubility of the dental surface . i . microhardness . dtsch zahnarztl z . 1980 august ; 35 ( 8 ) : 823 - 7 . german . [ 41 ] florin r , herrmann c , bernhardt w . measuring microhardness of laser exposed tooth surface . stomatol ddr . 1990 february 40 ( 2 ): 49 - 51 . german .

the object of this invention relates to a procedure for treatment , both preventive and corrective , of dental cavities . said procedure consists fundamentally in irradiation of the dental surface to be treated with a neodymium yag laser in conformity with specific parameters and conditions , signifying an advance in respect of the state of the art in this field . in the case of the treatment of cavities for corrective purposes it is also necessary , among other stages , to apply a dental cementing and restorative biomaterial on the surface of the dental enamel or on the dentin in such a manner that irradiation by the laser produces microfusion between both thereof . the present invention also relates to the biomaterial used in the procedure described herein , preferentially based on hydroxyapatite , together with the use of the procedure and of the biomaterial in the treatment of dental cavities .

fig2 shows an incontinence sling 30 according to the invention . sling 30 comprises an elongated flexible tube 32 having opposite end portions 34 and 36 . an intermediate portion 38 is positioned between end portions 34 and 36 . the intermediate portion 38 is bendable to form a substantially u - shaped cradle 40 positionable adjacent to the urethra 16 as shown in fig4 and 5 . end portions 34 and 36 are positionable so as to extend through the abdomen 12 away from the vagina 14 . the end portions 34 and 36 anchor the sling 30 in position within the abdomen as described in detail below . end portions 34 and 36 are substantially inextensible lengthwise , especially in comparison with center portion 38 , which is lengthwise elastically extensible . by varying the longitudinal stiffness as a function of position along the sling 30 it is possible to achieve better control over the transverse compressive force applied to the urethra and thereby avoid the aforementioned problems associated with too little or too much sling tension . furthermore , because they are substantially inextensible , the end portions 34 and 36 , which anchor the sling 30 within the abdomen , are less susceptible to the effects of “ sling recoil ” as described in detail below . in a preferred embodiment , sling 30 is formed from warp knitted polypropylene monofilaments . polypropylene is preferred because it is bio - compatible , provokes a healing response from living tissue and has a history of success as a material implantable within the human body . other polymers such as nylon , polyester and polytetrafluoroethylene are also feasible as are bio - absorbable materials such as polyglycolic acid , polylactic acid , pea , peur , peg and plla . warp knitting is preferred because it provides a filamentary mesh structure that yields a substantially lengthwise inextensible tube 32 , advantageous for reasons discussed in detail below . the axial stiffness that governs the lengthwise extensibility of the various portions may be controlled by increasing or decreasing the number of warp yarns in a portion , by introducing warp yarns having greater or lesser diameter , by making the warp yarns from materials having greater or lesser moduli of elasticity , or by a combination of any of these techniques . the substantially inextensible end portions 34 and 36 preferably have an extensibility between about 10 % to about 20 % per unit load , with about 15 % extensibility per unit load being most preferred . tube 32 may also be woven , the leno weave being preferred for woven embodiments because it too produces an axially inextensible structure . braiding is also feasible , with the triaxial braid providing the desired control over lengthwise elongation of the tube . the tube may also be a substantially continuous membrane , preferably formed of expanded polytetrafluoroethylene . the tube 32 preferably has a round cross - section with a diameter of about 7 mm . other cross - sectional shapes , such as oval , ellipsoidal or polygonal are of course feasible . the width of tube 32 is about 10 mm when flattened in contact with the abdominal tissue as shown in fig5 . the tube 32 is about 12 inches long before implanting . implanting of sling 30 is described with reference to fig3 - 5 . as shown in fig3 , curved tunneling needles 42 are attached to end portions 34 and 36 of tube 32 . tunneling needles 42 are used to penetrate the abdominal tissue and draw the sling 30 through the abdomen 12 on opposite sided of the urethra 16 as shown in fig4 . as shown in detail in fig5 , an incision 44 is made in the vagina 14 adjacent to the urethra 16 . needles 42 are inserted through the incision 44 to pass on opposite sides of the urethra 16 . the needles 42 are forced through the abdomen tissue 46 and exit through the abdominal anterior surface where they are drawn out of - the patient , thereby drawing the sling 30 through the incision 44 , around the urethra 16 and through the abdominal tissue 46 . the appropriate tension is placed on the sling and the end portions 34 and 36 are trimmed so that they remain beneath the surface of the skin of the abdomen . sling 30 is anchored in position by end portions 34 and 36 . anchoring may be effected in various ways , for example , by the intergrowth of abdominal tissue 46 through the end portions 34 and 36 . for such anchoring , it advantageous to provide end portions 34 and 36 with appropriate material properties , surface texture and porosity that favors tissue ingrowth so that a strong anchoring of the sling is quickly achieved . materials such as polypropylene are used in the end portions because polypropylene is known to provoke an aggressive healing response in living tissue . the surface texture of the end portions may be enhanced by the addition of a knap or by annealing the surface by the application of heat , or by using a particular stitch or multifilament yarn which gives a desired roughness . furthermore , the porosity of the end portions 34 and 36 may be tailored to have interstitial spaces sized to promote tissue ingrowth . porosity may be controlled by weave or stitch density as well as by varying the size of the filaments and their type , i . e ., multifilaments , monofilaments and texturized filaments may be combined to yield a desired effect . the healing response may also be encouraged by the use of coatings on the end portions 34 and 36 such as thrombin and collagen . it is advantageous that cradle 40 have a smooth , soft surface that helps to mitigate erosion . to that end , the intermediate portion 38 may have different characteristics from the end portions 34 and 36 , for example , the density of the weave , knit or braid may be greater to better distribute the forces applied to the urethra 16 . alternately , it may be advantageous to form intermediate portion 38 from a lower density material with a correspondingly softer surface . two advantages of the sling 30 according to the invention may be explained with reference to fig1 and 5 . the first advantage is how the sling 30 mitigates or eliminates the detrimental effect of erosion . as explained above ( see fig1 ), erosion occurs as a result of normal body movement and describes a condition whereby the edge 48 of the u - shaped portion 18 of prior art incontinence sling 10 cuts through the abdominal tissue 46 and enters the urethra 16 . this happens largely because prior art slings are flat strips with two opposite edges that are relatively stiff and sharp as compared with the tissue in which they reside . if the strip forming the prior art sling is twisted when it is implanted , the risk of erosion is greatly increased . however , as shown in fig5 , sling 30 according to the invention is a tube and not a flat strip , and therefore cannot present an edge to any portion of the tissue between the vagina 14 and the urethra 16 regardless of its orientation or if it is twisted . tubular slings 30 according to the invention are far less likely to cause erosion than prior art flat strip slings because they have no sharp edge . the second advantage of the sling 30 is provided by the manner of interlacing the filamentary members comprising the tube 32 which emphasizes control over the axial stiffness of the tube . as explained above for the sling 30 according to the invention , the particular knit , weave or braid is chosen to produce a substantially lengthwise inextensible tube ( i . e ., little to no stretch under tensile load ). the advantage of an inextensible tube is that , once set during implantation , the pressure exerted on the urethra 16 by the sling will not change significantly due to “ recoil ” of the sling . recoil occurs most acutely with prior art slings 10 , shown in fig1 , that have significant axial flexibility . as the sling 10 is drawn through the abdominal tissue during implantation , it encounters significant resistance in the form of surface drag . the drag applies a tensile load to the sling , notably the extension portions 20 , which , if flexible , will stretch lengthwise , placing the sling in a state of elastic tension within the abdominal tissue . further tension ( and stretching ) may be applied to the extension portions 20 as the sling 10 is adjusted to apply pressure to the urethra 16 . because the extension portions 20 have stretched , they are under tension and therefore they constantly try to shrink back to their nominal length and relieve the tension . this shrinkage occurs during the healing process before the extension portions are anchored and the result is an increase in the force applied to the urethra as the u - shaped portion 18 is drawn toward the extension portions 20 . the increased force on the urethra 16 caused by the recoil of the sling may mean that too much pressure is exerted by the sling 10 , making it difficult to impossible to urinate by exerting muscle pressure on the bladder . sling 30 , being substantially lengthwise 20 inextensible , avoids the problems associated with sling recoil . as they are drawn through the abdominal tissue 46 , the end portions 34 and 36 of sling 30 do not stretch significantly and thus will not recoil and change the pressure on the urethra after implanting of the sling . furthermore , because there is so little elastic tension within the end portions 34 and 36 as compared with the center portion 38 where the elasticity is concentrated , the pressure on the urethra may be established more precisely and reliably , as it is not necessary to account for the elasticity of the entire sling , only the more limited central portion 38 . thus , by concentrating the elasticity of the sling in the center portion 38 ( and not in the end portions 34 and 36 ) the problem of changing sling tension due to recoil is substantially reduced or eliminated . an alternate embodiment of a sling 50 allowing for adjustability of the pressure on the urethra is shown in fig6 . sling 50 is formed from a tube 52 having end portions 54 and 56 and an intermediate portion 58 as described above . a pouch 60 is positioned in the intermediate portion 58 . pouch 60 may be formed in any number of ways and preferably by sealing the tube closed at two points 62 and 64 in spaced apart relation to one another . sealing may be by heat fusion , sewing , interknitting , interweaving or interbraiding of the tube . once the sling 50 is implanted , as shown in fig7 , pouch 60 is filled with a compound such as silicone that is bio - compatible . the silicone body 66 is injected through a needle 68 in liquid form and then cures to form an elastic solid . while body 66 is curing a gas is injected into it to form a chamber 70 within the body 66 . after the body 66 is cured , the gas is replaced by a liquid . the body 66 with chamber 70 then forms an expandable and contractible body like a balloon within pouch 60 within which a fluid is maintained . if it becomes necessary to later change the pressure exerted by the sling 50 on the urethra 16 , this may be accomplished by inserting a needle into the chamber 70 and pumping in or removing fluid to increase or decrease the volume of the body 66 . fig8 illustrates another embodiment of a sling 72 according to the invention . sling 72 has a tubular intermediate portion 74 . from each end of intermediate portion 74 straps 76 and 78 extend . this sling embodiment is formed so as to be lengthwise inextensible so as to mitigate sling recoil . straps 76 and 78 are relatively thin so as to better promote tissue ingrowth and anchoring during healing . the intermediate portion 74 has the tubular configuration so as to avoid erosion . fig9 shows another embodiment of a sling 80 according to the invention . sling 80 is similar to sling 30 but has openings 82 positioned between the end portions 84 and 86 and the intermediate portion 88 . the openings 82 allow tunneling needles 90 to be positioned within the end portions for implantation into the abdominal tissue . tunneling needles 90 are attached to a tool 92 which facilitates manual manipulation of the needles and also allows for the deployment of mechanical anchors 94 as shown in fig1 - 12 . the needles 90 are inserted into the vaginal incision as described previously and through the abdominal tissue . the mechanical anchors 94 , in the form of a type of staple having deformable legs 96 , are attached to the end portions 84 and 86 but are deployable into engagement with the abdominal tissue by a mechanism ( not shown ) associated with the tools 92 . after the sling 80 is positioned as desired ( fig1 ) the legs 96 of the anchors 94 are deployed ( fig1 ) to engage the abdominal tissue and anchor the sling 80 in position . tunneling needles 90 are then removed ( fig1 ) and the sling 80 remains anchored in place by the engagement between legs 96 and the abdominal tissue . all of the sling embodiments according to the invention may have radiopaque markers installed to render the sling visible by fluoroscope techniques and thereby facilitate sling positioning within the abdomen . the markers may , for example , be positioned at point locations to indicate boundaries and orientation of the sling , and / or the markers may comprise filamentary members coated with radiopaque material and interlaced with the filamentary members comprising the sling to render the length of the sling visible during implanting . slings according to the invention provide numerous advantages over prior art slings including the mitigation or elimination of erosion , the elimination or reduction of recoil effects on urethral pressure as well as providing a sling wherein the pressure on the urethra may be adjusted without the need for invasive surgery . furthermore , the sling itself , being a tube , provides a guide for the disposition of anchoring systems or other accessories in that the tube interior defines a path through the abdominal tissue .

a sling for controlling urinary incontinence is disclosed . the sling is formed from a tube having substantially lengthwise inextensible end portions and an elastically lengthwise extensible intermediate portion between the end portions . the intermediate portion has a u - shape which cradles the urethra . the end portions extend through the abdominal tissue to anchor the intermediate portion in position . the sling places the urethra under a transverse compressive load to hold it closed and prevent inadvertent urination . the tube is formed from interlaced filamentary members . interlacing may be by warp knitting , weaving using a leno weave or braiding using a tri - axial braid structure . the end portions have a rough texture to facilitate anchoring in the tissue of the abdominal wall . the intermediate portion is smooth and soft to prevent tissue erosion .

the header 10 shown in fig1 has a crop cutter or knife 12 arranged close the ground . the knife comprises a stationary blade and a reciprocating blade which together act as shears which cut the crop near the ground . a reel 14 having tines 16 rotates about a horizontal axis next to the knife 12 to gather the cut crop and feed it into the processing machinery of the harvester ( not shown ). at one end only of the header , there is provided a wobble box 80 ( shown in fig8 ), which reciprocates the movable blade of the knife 12 . the wobble box 80 is driven by means of a drive belt 82 and a drive pulley 84 , which are shielded by means of a guard 18 . this serves to prevent crop from becoming entangled in the drive train of the wobble box 80 and also avoids the risk of injury to a person standing nearby . to allow access to the wobble box 80 and its drive train for servicing , the guard 18 is designed as a door which can be hinged open at its rear end and is kept closed by a catch at its front end . the header shown in fig1 has a fixed knife . there are other headers , however , in which the knife 12 can be moved forwards and backwards to each side of a central position , through a distance of as much as , for example , 40 cms . in such a header 10 , the guard 18 , as shown in fig1 , is not sufficiently large enough to shield the wobble box 80 and its drive train when the knife 12 is in its forward position . the preferred embodiment of the invention , which will now be described by reference to fig2 - 15 , mitigates the above problem by providing a guard 18 having a variable geometry , to be effective in all positions of the knife 12 . as illustrated in the left side view ( relative to a forward direction of travel t of the harvester ) of fig2 - 3 , the guard 18 is formed of a first part 20 , which is mounted on a stationary component of the header ( i . e . header frame ) by means of a hinge 24 . the guard 18 also comprises a second part 22 , which is slidably carried on the first part 20 by means of two supports 30 & amp ; 36 , which will be described below in greater detail . a catch 40 , which is shown in more detail in fig2 and 7 - 15 , releasably connects the front end of the second part 22 of the guard 18 for movement with the knife 12 . in this way , as the knife 12 moves forwards and backwards , it causes the second part 22 of the guard 18 to slide relative to the first part 20 so that the wobble box 80 and its drive train ( fig8 ) always remain shielded . as can be seen from the section view of fig5 , the lower support 30 for the second part 22 of the guard 18 preferably comprises rollers 32 secured to the second part 22 , which are held captive within , and slide along , a lower rail 34 , such as a runner or track , affixed to the first part 20 . rollers and runners are of course commonly used in many applications , for example to mount drawers in furniture , and it is not therefore deemed necessary to describe them in detail . their use provides a smooth and silent sliding action . furthermore , because the rollers 32 are held captive in the runner 34 , they prevent relative movement between the two parts 20 , 22 in the vertical plane . if one of the two supports 30 is formed by rollers 32 guided in runners 34 , the second 36 need only be designed more simply , as shown in the section view of fig4 , as two l - shaped brackets 38 & amp ; 39 having limbs which engage one behind the other . such engagement prevents the two parts 20 , 22 from being separated from one another but does not serve to support the weight of the second part 22 . aside from reducing cost , such a construction makes parallel alignment of the two supports 20 , 22 less critical . turning now to fig6 , it is preferred that the runner or track 34 of the first part 20 of the guard 18 contains a device 50 to prevent the first part 20 and the second part 22 of the guards 18 from separating at both ends . preferably , this device 50 could be an upright rod 52 mounted at the front and rear ends of the lower runner or track 34 . in reference to the rear end of the lower runner or track 34 , the support of the rearmost roller wheels 32 can include a u - shaped safety lock 54 , preferably made of spring steel , which receives the rearmost upright rod 52 by an interference fit . this safety lock 54 will catch over the rod 52 on the first part 20 of the guard 18 and release when sufficient force is applied . the aim of this lock 50 is that , when the guard 18 is opened , the operator can slide the second part 22 fully backwards so the safety lock 54 catches , and the second part 22 of the guard 18 will not slide forward or backward on its own . pulling the second part 22 of the guard 18 forward with enough force will release the safety lock 54 and allow the guard 18 to be closed on the header 10 again . turning now to fig7 - 15 , the catch 40 is intended to serve two purposes . first , it couples the second part 22 of the guard 18 to the front section of the header frame 10 for movement with the knife 12 . second , it supports the weight of the guard 18 because , when the guard 18 is extended to its maximum length , it can place undue stress on the hinge 24 . thus the catch 40 prevents movement of the front end of the guard 18 in two mutually perpendicular planes . to ensure that the second part 22 of the guard 18 moves horizontally with the knife 12 , a u - shaped locking stirrup 42 is bolted to a plate 44 attached to the front section of the header frame 10 so that it moves with the knife 12 . the free ends of limbs of the locking stirrup 42 are preferably threaded and are secured to the plate 44 by means of nuts 45 . this method of fixing enables the amount that the stirrup 42 projects from the plate 44 to be adjusted . however , it should be realized that other suitable methods of affixing the locking stirrup 42 to the plate 44 are also contemplated . to support the weight of the free end of the guard 18 and prevent it from moving vertically , the header frame also includes a locking aperture 43 formed in the base plate 44 of the stirrup 42 . the locking aperture 43 includes a bushing , which is mounted thereto . the bushing preferably is made out of plastic material , such as polyamide . the interior of the second part 22 of the guard 18 includes a locking pin 46 having a preferably conical point , two dampers 47 , which may be formed of rubber or any other dampening material , and a latch mechanism 48 , which has an access knob 49 accessible to the exterior of the second part 22 of the guard 18 . the latch mechanism 48 may be constructed in a manner similar to latch mechanisms used on motor vehicles to hold down the hood or the lid of a trunk . in operation , such as when it is desired to close the guard 18 from an open position , the first part 20 of the guard 18 is hinged towards a closed position and when nearly closed the second part 22 is slid to the extent necessary to align the locking pin 46 with the bushing of the locking aperture 43 in the plate 44 . the locking pin 46 fits within the bushing and locking aperture 43 , such that the header frame bears the loads generated by sliding both parts 20 , 22 of the guard 18 relative to each other . the second part 22 of the guard 18 is then pushed shut so that the latching mechanism 48 engages with the locking stirrup 42 . in addition to the above , the two rubber dampers 47 , which are preferably mounted at an angle to each other ( i . e . in a v - shape ), touch a corresponding surface on the front section of the header frame 10 when the second part 22 of the guard 18 is closed . these dampers 47 are adjusted in such a way that they are slightly compressed when the guard 18 is closed . this arrangement provides additional vibration suppression ( the reciprocating movement of the header knife 12 creates vibrations , which tend to propagate through the header 10 and can lead to premature failures and excessive noise generated by the plates of the guard 18 ). once the catch 40 is engaged , the wobble box 80 and its drive train 82 , 84 will automatically remain adequately shielded in all positions of the knife 12 . when access to the wobble box 80 is required for servicing , the guard 18 can be opened in the same way as the guard 18 in fig1 . in particular , the latch mechanism 48 must first be released . release of the latch mechanism 48 can occur at a single access point , a luxury not afforded by the prior art . it is contemplated that the present invention may employ a variety of latch mechanisms 48 , such as those that may be released remotely either electrically or mechanically , for example using a bowden cable . additionally , and as shown in fig1 and 15 , the latch mechanism can be released mechanically through “ an action ”, that is , through the turning of a knob 49 from the exterior of the second part 22 of the guard 18 . preferably , this knob 49 has a hexagonal or other distinctive shape , which requires a specific tool to actuate it , such that it cannot be opened by inadvertent by - passers . thus , to open the guard 18 , the operator can simply turn the knob 49 on the lock to any pre - set , desired range , such as about 45 degrees , and pull the shield 18 toward him , thereby disengaging the locking stirrup 42 from the latching mechanism 48 . alternatively , the latch mechanism 48 may simply be a spring latch designed to release the locking stirrup 42 when the guard 18 is released from its closed position . in reference to fig3 , after the catch 40 is released through actuation of the latch mechanism 48 , the operator can then slide the second part 22 of the shield 18 backwards until the safety lock 50 at the back catches and then the two parts 20 , 22 of the guard 18 can be swung open about the hinge 24 .

in a header having a movably mounted knife and a guard for shielding the moving and rotating components operating the knife , the guard preferably comprising two interconnected parts of which the first part is mounted on the header so as not to move with the knife and the second part is coupled for movement with the knife . in this way , the area shielded by the guard automatically expands and contracts with movement of the knife .

ames therapy is preferably practiced with use of a joint - ranging device that rotates the joint of a patient with concomitant vibration of lengthening muscles associated with the joint while the patient attempts to assist the joint rotation with voluntary contraction of corresponding muscles associated with the joint . a preferred joint - ranging device is an ames rehabilitation device described in u . s . pat . no . 6 , 878 , 122 . fig1 shows a patient 10 sitting in a chair 12 supporting a wrist joint - ranging device 14 affixed to the patient &# 39 ; s right forearm . wrist joint - ranging device 14 is powered to rotate the wrist joint alternately in flexion and to extension directions . two vibrators 16 ( only one shown in fig1 ) apply during wrist joint rotation concomitant vibration ( e . g ., 40 hz - 80 hz ) of lengthening muscles associated with the wrist joint while patient 10 attempts to assist the wrist joint rotation with voluntary contraction of corresponding shortening muscles associated with the wrist joint . fig1 also shows patient 10 with her right lower leg secured in a foot joint - ranging device 20 affixed to the patient &# 39 ; s shoe and to the calf just below the knee . foot joint - ranging device 20 is powered to rotate the ankle joint alternately in flexion and to extension directions . two vibrators 26 apply during ankle joint rotation concomitant vibration of lengthening muscles associated with the ankle joint while patient 10 attempts to assist the ankle joint rotation with voluntary contraction of corresponding shortening muscles associated with the ankle joint . for operation of either wrist joint - ranging device 14 or foot joint - ranging device 20 , an emg signal is typically acquired ( i . e ., recorded ) from a patient &# 39 ; s muscle or muscles to which pairs of electrodes 24 are attached . the emg signal represents the differential voltage between electrodes 24 of an electrode pair , referenced to a neutral voltage obtained from an inactive location of the patient &# 39 ; s body . each electrode 24 may be composed of a rounded metal protuberance , typically 0 . 5 cm - 0 . 7 cm in diameter and depressing the skin 1 mm - 3 mm . electrodes 24 may be embedded within an enclosure for the arm or leg , such as in an ames rehabilitation device . alternatively , emg signals may be picked up by pairs of disposable electrodes 24 adhered to the patient &# 39 ; s skin over the muscle or muscles of interest . typically , pairs of emg electrodes 24 are oriented parallel to the long dimension of a muscle and / or collinear to the orientation of muscle fibers within the muscle or muscles of interest . the emg signals provide to patient 10 feedback information representing emg activity of the lengthening and shortening muscles of interest . the feedback information identifies the degree to which patient 10 is able to assist joint rotation imparted by either wrist joint - ranging device 14 or foot joint - ranging device 20 . the emg signal , typically 10 μv - 2000 μv in amplitude , is delivered to an emg instrument 28 for amplification prior to visualization or other usage . amplification is typically carried out in two stages to minimize electrical noise , near the pick - up site ( e . g ., × 100 ) and near the usage site ( e . g ., × 20 -× 50 ), resulting in an amplified signal in the region of 1 v . at this stage of processing , the signal is termed “ raw ” emg , is both positive - and negative - going , and has a spiky appearance ( e . g ., fig2 , line a ). to better utilize the raw emg signal , further processing is usually carried out . typically , the raw signal is rectified ( i . e ., the negative - going components are vertically flipped about 0 v to become positive - going ) ( e . g ., fig2 , line b ), and the rectified signal is then low - pass filtered to smooth it ( e . g ., fig2 , line c ). this rectified , smoothed emg signal can then be used to move a needle on a dial ( not shown ); to increment a number on a read - out ( not shown ); to move a graphic object 34 on a display screen 30 of a visual display monitor 32 ( e . g ., fig3 ); or to modulate the intensity or frequency of a sound audible from a loudspeaker 36 in display monitor 32 ( e . g ., fig1 ). commercially available emg instrumentation amplifier equipment suitable for practicing the above - described process is a myosystem 2000 , manufactured by noraxon usa , inc ., scottsdale , ariz . the electrodes are conventional ecg stick - on electrodes . in a first preferred embodiment , the rectified , low - pass filtered emg signal is used to move graphics object 34 ( e . g ., fig3 ) on display screen 30 of display monitor 32 . in the example shown in fig3 , the height of a bar 34 represents the instantaneous amplitude of the processed emg signal ( fig2 , line c ). in a second preferred embodiment , the rectified , low - pass filtered emg signal is used to control the intensity , frequency , or both , of a tone or a recorded message played over loudspeaker 36 or headphones ( not shown ). in a third preferred embodiment , the rectified , low - pass filtered emg signal is used to control both visual feedback and auditory feedback , which are simultaneously presented in a goal - directed virtual - reality ( i . e ., video ) game displayed on display screen 30 . a 34 year - old female , 4 years post - stroke , with severe paresis and joint rigidity in her right wrist and fingers , was treated in accordance with the standard ames therapy using joint torque feedback . her wrist and fingers were paretic and spastic in the flexion direction and clinically plegic in the extensor direction . after 11 weeks of the standard ames therapy , her flexion strength increased by 600 %. in contrast , her extension strength changed from zero to negative values , that is , when she attempted to extend , she flexed . closer examination with emg recording revealed that her wrist and finger extensor muscles were active when she attempted to extend , but that inadvertent activation of the recently strengthened wrist and finger flexor muscles overpowered the extensor muscles . the patient was then provided emg feedback for a total of 8 hours of therapy , after which she was better able to differentially activate the flexors and extensors of the wrist and fingers . she then returned to the standard ames therapy using joint torque feedback . three months later , her extensor torque had reversed from negative to positive and equaled the torque in her flexor muscles . a 44 year - old male , 3 years post - stroke , with severe paresis in his left wrist and fingers , was treated in accordance with the standard ames therapy using joint torque feedback . his wrist and fingers were paretic in the flexion direction and clinically plegic in the extensor direction . closer examination revealed a low level of emg activity in the extensor muscles during attempted extension , but the activity was too weak to produce overt movement of the wrist and fingers . prior to using the standard ames device with joint torque feedback , the patient was provided emg feedback for a total of 6 hours of therapy , after which he was able to generate extension torque and movement of the wrist and fingers . the feedback he received during ames therapy was then changed from emg to torque , and he began partial recovery of upper limb use . it will be obvious to those having skill in the art that many changes may be made to the details of the above - described embodiments without departing from the underlying principles of the invention . the scope of the present invention should , therefore , be determined only by the following claims .

a method of rehabilitating a patient suffering partial or total loss of motor control of an appendicular joint caused by injury or neurological disorder but exhibiting clinically plegic muscles and retaining minimal ability to weakly contract the muscles develops overt movement at a joint and ultimately leads to improved functionality . the method entails use of feedback in which the patient views and / or hears a signal related to the intensity of electromyographic activity the patient produces in the appropriate muscles while attempting to move the paretic or plegic joint . the method is intended as an alternative form of feedback for highly disabled patients while they receive therapy using an assisted movement with enhanced sensation device providing joint torque feedback .

fig1 shows six children 12 secured together by restraining apparatus 10 . the apparatus 10 has two elongate spine members 14 , 16 . each node 18 , 20 , 22 has two lateral arms 24 , 26 , 28 , 30 , and 32 , 34 . the spine members 14 , 16 are optionally axially compressible and / or extensible and / or laterally flexible in the horizontal plane of the apparatus in use , to allow the apparatus to bend . this allows the children 12 to approach each other ( fig2 ) and turn corners ( fig3 ). however , the spine members 14 , 16 are normally inextensible , or at least only very slightly axially resilient , so that the distance between the children cannot increase to any great extent . also , the spine members are typically comparatively more rigid in the vertical plane than in the horizontal plane , so that the spine does not sag between nodes . different sizes of apparatus 10 are envisaged , depending on the number of children to be secured . to make a larger version of apparatus 10 , additional spine members and nodes can simply be attached to the apparatus 10 . fig4 shows a harness 36 that is used to attach the children 12 to the apparatus 10 . the harness 36 has a shoulder strap 38 and a belt 40 . the belt 40 is fastened by a simple buckle 42 . the belt 40 also has two sockets 44 for engagement with an arm of the apparatus 10 . sockets 44 can optionally slide on rails 46 provided in the belt , so that the child can turn sideways with respect to the spine 14 , 16 . the sockets 44 can typically be switched between a first configuration where they are fixed immovably to the rails 46 , and a second configuration in which they can slide relative to the rails 46 . fig5 shows two different - sized children 12 secured to node 22 by arms 32 , 34 . each user 12 is wearing a harness 36 , and a socket 44 in each harness 36 is engaged with an arm 32 , 34 of the node 22 . the arms 32 , 34 are pivotable with respect to the node 22 , to allow the different - sized children 12 to be connected to the apparatus 10 without twisting the apparatus 10 . the arms 32 , 34 can also be axially and laterally resilient so as to resist the transfer of forces between the children connected to the node 22 . fig6 shows an embodiment of apparatus 10 , having spine members 60 connected to each other by single pivot nodes 54 . the spine members typically comprise an elongate strip covered with a non - pvc rubber . the spine members 60 can typically comprise thin sheets of plastic , metal or composite material ( such as grp or carbon fibre ), orientated so that in use the sheets lie in the vertical plane . this allows lateral but not vertical flexibility of the spine members . in this embodiment , each node 54 comprises a ring 56 and a rod 58 , which passes through the centre of the ring 56 in a direction parallel to the axis of the spine members 60 . each pair of arms 62 , 64 is typically formed as a single piece , having a central bore arranged parallel to the axis of the spine members 60 and shaped to accommodate the rod 58 , which passes through the bore . each pair of arms 62 , 64 is pivotal around the rod 58 and is thus pivotable with respect to the spine members 60 , but the arms 62 , 64 are not pivotable with respect to each other . the ends of arms 62 , 64 have elongate tabs 65 to engage in the sockets of the harness . spine members 60 optionally have reflectors 68 , which help the children 12 to be seen in the dark . fig7 shows an embodiment very similar to that of fig6 , except that the rings 56 of each node 54 are closed or covered , typically by a rubber or plastics gaiter . this could help prevent fingers from becoming trapped in the nodes 54 . in this embodiment the arms 62 , 64 could be pivotable independently of one another . fig8 shows an alternative embodiment of apparatus 110 , having a number of spine members 160 , each of which includes a portion of corrugated plastic tubing . the corrugated tubing allows the spine members 160 to bend laterally and to be compressed and stretched axially . the other major difference from the previous embodiment is that the arms 162 , 164 are pivotable relative to each other , as well as relative to nodes 154 . the arms 162 , 164 are also typically resilient and can be formed from a rubber material . these arms could of course be used with the earlier embodiments . fig9 and 10 show views of arm 62 engaged in socket 44 . inside socket 44 is a grip device 90 , which includes two plates 92 , 94 , each having an aperture to receive opposite ends of elongate tab 65 on the end of the arm 62 . the plates 92 , 94 are pivotable about respective pivot points 96 , 98 and a coil spring 93 held in compression between the plates on one side of the pivot points 96 , 98 at the end furthest from the socket mouth urges the other ends of the plates together to capture the tab 65 in the apertures . dual buttons 95 , 97 are connected to the plate ends above and below the spring 93 . simpler connectors are possible , along the lines of buckles or clips conventionally used with backpacks and webbing straps , and any connector to secure the child to the arm can be used . fig1 to 14 show details of possible connections between nodes 54 and spine members 60 . fig1 is an exploded view showing spine members 60 , the ends of which terminate in rods that can slide into vertical slots 72 in nodes 54 and are secured therein by bolts 74 or pins . bolts 74 fit through a first aperture 76 in one side of ring 56 , a corresponding aperture 70 in the end of each spine member 60 and through a second aperture 76 in ring 56 . fig1 is a non - exploded view of fig1 . fig1 shows an alternative connection between nodes 54 and spine members 60 . ring 54 has two end lobes 80 , which each have a cylindrical lateral protrusion 82 in one side . the protrusions 82 are shaped to engage sockets 84 in the ends of spine members 60 . securing caps 86 attach to the protrusions 82 once they are engaged in sockets 84 . the caps 86 are typically screwed to the protrusions by engaging interior screw threads of the cap 86 with exterior screw threads on the protrusion 82 , but other engagement means could also be used . fig1 is a non - exploded view of fig1 . to secure a child to the restraining apparatus 10 , the child 12 puts on a harness 36 and fastens the belt buckle 42 . one of the sockets 44 of the harness 36 is then connected to an arm 24 of the apparatus 10 . this is done by simultaneously pushing socket buttons 95 , 97 . this compresses the spring 93 and pivots the plates 92 , 94 so the ends of the plates 92 , 94 at the socket opening move away from each other . this widens the socket entrance enough to allow the elongate tab 65 to be inserted . once the tab 65 is aligned with the apertures in the plates 92 , 94 , the buttons 95 , 97 are released , which moves the plate ends over the tab 65 , leaving the ends of the tab 65 projecting through the apertures in the plates 92 , 94 . thus , the elongate tab 65 is trapped in the socket 44 and the child 12 is secured to apparatus 10 . the procedure is repeated to secure all the children required to respective arms of the apparatus 10 . to disengage a child 12 from the apparatus 10 , the socket buttons 95 , 97 , are simultaneously compressed and held down . this compresses spring 93 , and pivots the plates 92 , 94 to widen the socket opening as before . this releases the tab 65 from the apertures in the plates 92 , 94 and the arm 62 is then pulled out of the socket 44 . the buttons 95 , 97 are now released and the child takes off the harness 36 . this procedure is repeated to release all children 12 from the apparatus 10 . modifications and improvements can be incorporated without departing from the scope of the invention . for example , the position of the tabs and sockets could be reversed , i . e . each arm could have a socket and the harness could have a tab to engage the socket . the arm and socket do not have to engage by apertures in plates engaging the arms ; any way of attaching the arm to the socket would be adequate , e . g . the arm could screw into the socket . the socket could be replaced by a lock mechanism , requiring a special tool to release the arm , so that a child secured to the apparatus could not release itself . two sets of apparatus could be used parallel to each other , with a central column of children attached to both apparatus . fig1 shows a number of different schematic combinations of children 12 , spines 100 and arms 110 . not all of the nodes need to be provided with arms at each side , nor do all the nodes or arms need to be occupied by children . embodiments of the invention could be created using a single spine instead of separate spine members ( thereby removing the need for nodes ) where the arms extend out through apertures in the spine . the harnesses could be permanently attached to the apparatus ( instead of releasably attached by the arm and socket connection ).

restraining apparatus for coupling together two or more users such as children while walking as a group . the apparatus comprises a spine member with lateral attachment arms for coupling the users to the spine member . the spine member is laterally flexible to allow the spine to bend from side to side when corners are being negotiated in use , but has sufficient stiffness in the vertical plane to resist sagging between the users .

the following examples set forth preferred embodiments of the present invention . it is to be understood , however , that these examples are provided by way of illustration and nothing therein should be taken as a limitation upon the overall scope of the invention . this example describes a passage method of attenuating viruses which maximizes attenuation efficiency by ensuring that the virus is preferably in a logarithmic phase of replication . virus was passed ( i . e . an aliquot of nutrient medium including the virus , unattached cells , and cell debris from a virus - infected cell culture was added to the nutrient medium of a noninfected culture ) at daily intervals . different amounts of virus were added at each interval by using multiple cultures . for example , at the beginning , 200 μl was transferred to one noninfected culture , 20 μl was added to a second noninfected culture , and 2 μl to a third noninfected culture . the goal was to have a sufficient amount of susceptible cells so that the replication cycles could continue until the next transfer . the procedure was deemed successful if the cells eventually showed cpe . however , because prrsv - induced cpe do not appear until sometime after the logarithmic growth phase , passages were made before it was known whether or not they would be ultimately successful (“ blind passages ”). passages that resulted in virus induced cpe were said to have resulted in a “ take ”. if a passage did not result in a take , the passage was restarted using the highest dilution from the last passage which did result in a take . as more and more passages were made , the virus became more adapted to replicate in the cell line and less able to produce disease symptoms in its original host . these changes occur through random mutations that occur during replication . using this method , the following procedures were used to passage an exemplary virus in accordance with the present invention , msv , ja - 142 . this strain was passaged in marc - 145 cell cultures at daily intervals . twenty - four - well plates were used for the process to minimize the amount of cells and nutrient medium required , and to simplify the multiple - aliquot passage technique . cells and nutrient medium were added to each well and the cells were allowed to form , or nearly form ( greater than about 70 %), a confluent monolayer . the nutrient medium comprised approximately 90 % earle &# 39 ; s balanced salt solution minimal essential medium ( mem ), 10 % fetal calf serum and 0 . 05 mgm / ml of gentamicin sulfate . the volume of nutrient medium used was approximately 1 ml . usually , three wells of a column were used for each amount of virus that was transferred . an aliquot of nutrient medium from the previous passage was transferred to the first well in the column at 48 or 72 hours , after the cell cultures had been prepared , nutrient medium from the first well was transferred to the second well of the same column at 72 or 96 hours and the third well of the same column at 96 or 120 hours . plates were usually set up twice a week so sometimes the fourth well of the column was used and sometimes it was not used . passaging conditions were maintained at 37 ° c . in a moist atmosphere containing 5 % co 2 . different sized aliquots ( having different amounts of virus ) for each passage were tested to determine if the amount of virus was sufficient to induce cpe . for example , a separate series of aliquot transfers ( passages ) of 200 μl , 20 μl , and 2 μl , respectively , was used until the smaller aliquots consistently exhibited cpe with the goal being to transfer the smallest aliquot that produced cpe . when the smallest aliquot ( e . g . 2 μl ) of the group of aliquots being tested consistently resulted in cpe , smaller amounts were tested ( e . g . 0 . 2 μl and 0 . 02 μl ). when a certain dilution did not exhibit cpe , that series of cultures was restarted with the next lower amount which did result in cpe at that passage ( i . e . if the 2 μl transfer was unsuccessful at producing cpe in the 25th passage but the 20 μl transfer in the 25th passage was successful , the 2 μl transfer was repeated using 20 μl with 2 μl transfers resuming for the 26th passage .) using this method , the smallest amount of virus necessary to transfer to obtain cpe was determined . virus was passed successfully at daily intervals using the following amounts of virus - infected nutrient medium ( which reflect the highest dilution [ i . e ., smallest aliquot ] which resulted in cpe keeping in mind that other dilutions would also work ): the passaging of the virus using the above method resulted in an attenuated prrsv , ja - 142 . as is apparent , the virus became more adapted to replicate in the cell culture and therefore required a smaller amount of virus - infected nutrient medium to be transferred as passaging continued . for transfers using a very small amount of virus - infected nutrient medium ( e . g . 0 . 2 μl or 0 . 02 μl ), a separate dilution was required . this dilution was accomplished by adding a small amount of virus - infected nutrient medium to a larger amount of nutrient medium . for example , to obtain a transfer of 0 . 2 μl , 2 μl of virus infected nutrient medium was added to 20 μl of nutrient medium and 2 μl of this dilution was added to the next culture in the series . using this approach , the highest dilution which resulted in cpe was used and the time necessary for passaging the virus was minimized . passaging at daily intervals ensured that the virus was always in a logarithmic phase of replication . daily transferring also ensured that there was an adequate number of cells for virus replication . because the mutations ( which are probably cumulative ) that are likely to result in attenuation only occur during replication , there is no advantage to having substantially all cells infected and replication either proceeding at a slower rate or stopping before the next transfer . based on previous studies of prrsv , it was known that the replication cycle is about 8 hours , therefore , transferring a minimal amount of virus from virus - infected nutrient medium to uninfected nutrient medium at daily intervals results in the virus always having plenty of cells within which to replicate . as can be readily appreciated , passaging using this method results in a savings of time that was heretofore thought impossible ( i . e . each passage required less time ). this is especially important when a high number of passages are required for adequate virus attenuation . if each passage , using old methods , was performed at a 3 day interval , a procedure requiring 200 passages would take 400 fewer days using the method of the present invention . this example determined if passage 200 of prrs virus , ja - 142 , would revert in virulence when passed in the host animal six times . this study consisted of six groups . five pigs from group 1 ( principle group ) were inoculated intra - nasally with prrs msv , ja - 142 passage 200 , while three pigs from group 1a , ( control group ) were inoculated intra - nasally with sterile diluent . the animals were provided commercial feed and water ad libitum throughout the study . pigs of both treatment groups were monitored daily for clinical signs ( appearance , respiratory , feces , etc .). after six days , the animals were weighed , bled and sacrificed . after scoring the lungs for lesions , lung lavages were collected from each animal . the lung lavages were frozen and thawed one time , and a pool was prepared using 2 . 0 ml of serum and 2 . 0 ml of lung lavage from each animal within a group to prepare backpassage 1 and 1a , respectively . this pool was used to challenge ( intra - nasally ) the animals in group 2 and group 2a , respectively . this process was repeated for groups 3 and 3a through 6 and 6a . animals in each group were housed in separate but identical conditions . following inoculation , blood samples were collected and body temperatures were monitored . rectal temperatures were measured for each animal periodically from − 1 dpe ( days post exposure ) to 6 dpe and averaged together with other animal temperatures from the same group . the health status of each animal was monitored daily for the duration of the study . results were compiled and scored on a daily observation form . the scoring parameters are as follows : animals were also weighed prior to inoculation and at necropsy . average weight gains for each group were calculated for comparison . prrs enzyme linked immuno - absorbent assays ( elisa ) and serum neutralization ( sn ) assays were performed following the exposures of the animals with test and control articles . attempts to isolate prrsv from serum samples were performed on ma - 104 cells . prior to and following vaccination , total white blood cell counts were determined using coulter counter model z 1 , coulter corp ., miami , fla . at necropsy , the lungs of each animal were scored . lung scoring was done by separating the lung into 7 sections and determining the percentage of lung involvement ( the percentage of the lung area affected as shown by lesions or redness for each section and multiplying by the approximate area of the whole lung ) that percentage of total lung area that the section encompasses . parameters for lung scoring are as follows : each group of pigs was monitored for six days following vaccination . clinical scores were low in all groups . clinical score results are given in table 1 . serologically , elisa s / p ratios and sn titers were negative throughout each group &# 39 ; s trial period . virus isolation was attempted on all serum samples and lung lavages . by day 6 , 60 - 100 % of the serum samples from the groups given ja - 142 , passage 200 , and subsequent back passes were positive . the groups given saline were negative . in the first three passes , virus was recovered in the lung lavages from only 20 - 40 % of the pigs , but by the last three passes , the virus was recovered from 50 - 80 % of the pigs . based on this data , ja - 142 passage 200 did not revert to virulence when passed through pigs six times . this example demonstrated that the level of attenuation of safety of msv , ja - 142 , passage 200 did not change significantly during six backpassages in the host animal . evaluation of level of attenuation or safety was performed using the pregnant sow model and monitoring the effect on reproductive performance . this model is the most sensitive test system and does not rely upon subjective factors for virulence testing . this example consisted of four groups ( a , b , c & amp ; d ) having seven sows per group . group a was inoculated intra - nasally with prrs msv , ja - 142 passage 200 . group b was inoculated intra - nasally with ja - 142 , passage 200 , backpassage 6 . group c was inoculated intra - nasally with sterile diluent , to act as normal controls . group d was inoculated intra - nasally with prrsv ja - 142 , passage 4 . the test articles ( challenge with ja - 142 , passage 4 ) were given at about 93 days gestation . body temperatures of the sows were monitored for the first seven days following vaccination . blood samples were collected from the sows once a week and at time of farrowing . blood samples were collected and weights were recorded from piglets at birth , 7 , and 14 days of age . the health status of each animal was monitored daily for the duration of the study up to and following farrowing for 14 days . the farrowing performance was evaluated by observing the health status of the piglets born . prrs elisa assays were performed following the exposures of the sows with the test article . prrs elisa assays were also performed on the piglet sera weekly following farrowing . following exposure to the test article , attempts to isolate prrsv from serum samples were performed on ma - 104 cells . rectal temperatures were measured periodically from 0 days post vaccination ( dpv ) to 7 dpv and the average temperature of each group was determined . prior to and after inoculation , total white blood cell counts were determined as in example 1 . clinical observations of the sows , as in example 2 , were made from − 1 dpv through farrowing . clinical observations of the piglets were made from farrowing until 14 days of age . finally , at necropsy , the lungs of each piglet were scored for percent lung involvement . the elisa results indicate that the animals used in this study were naive to prrsv . those animals that received virus inocula , groups a , b , and d , sero - converted at 14 days post treatment . three sows of group b remained negative at 14 days post treatment . at the time of farrowing , the negative sows of group b tested positive for antibody to prrsv . the pigs &# 39 ; elisa results indicated that the majority of the piglets born to sows of group a and group b were sampled after they had nursed . those pigs that were negative at zero days post farrowing ( 0 dpf ) tested positive at 7 dpf . all pigs born to sows of group c tested sero - negative throughout the study . only a few pigs were tested from group d , since the majority were either stillborn or mummies . half of those pigs that were tested were sero - positive . this indicated that the sero - negative pigs were sampled prior to nursing or they were not capable of nursing . all piglets born to sows of group d died before 7 dpf . isolations of prrsv from the sows of groups a and b were sporadic . although the results of the elisa test indicated that these sows were successfully inoculated with the viral test articles , many remained negative for virus isolation from serum . the majority of pigs born to sows from groups a and b tested positive for virus isolation during the performance of the study . the litter born to one sow of group a never tested positive and the litter born to one sow of group b had only two of eight piglets test positive for virus isolation . no virus was recovered from the piglets born to sows from group c . virus was recovered from the majority ( 71 %) of piglets born from sows of group d . post treatment rectal temperatures were unremarkable . the groups that were treated with either msv , backpassage 6 or sterile diluent experienced no measurements exceeding 101 . 7 ° f . group d , treated with ja - 142 , passage 4 , had four ( out of seven ) sows that experienced temperatures that exceeded 102 ° f . with one sow reaching 103 . 4 ° f . for one of the days . the weight gain performance of the piglets born to sows of groups a ( treated with msv ) and b ( treated with msv , backpassage 6 ) was greater than that of the pigs born to the control sows of group c . the average weight gain for the 14 day observation period was 7 . 9 lbs . for group a , it was 7 . 7 lbs ; for group b and group c it was 6 . 9 lbs . the difference in the weight gain was not related to the size of the litter remaining at 14 days . the average litter sizes at 14 days post farrowing ( dpf ) were 9 for group a , 7 for group b , and 10 for group c . no pig born to the sows of group d survived beyond 3 dpf . the white blood cell ( wbc ) counts for the sows of groups a , b , and c remained relatively constant . the average percentages of the pre - challenge values were equal to or greater than 92 % for the duration of the observation period . three sows of group d experienced wbc counts that were lower than the expected normal range ( 7 - 20 × 10 6 / ml ). the post inoculation clinical scores were unremarkable for the sows of groups a and b . several sows of group c were observed to experience clinical signs over a period of several days . the majority of the clinical symptoms observed were in the category of decreased appetite , respiratory symptoms , and depression . one sow of group c died on trial day 31 of chronic bacterial pneumonia . six of the seven sows of group d were observed to have clinical signs , primarily of varying degrees in severity , of lost appetite , ranging from decreased to anorexic . results of the clinical scoring for the sows are given in table 2 . clinical observations of the piglets fell into two major categories , death and reduced appetite . there were no significant differences between groups a , b and c in the area of average deaths per litter ( dpl ). group a had an average of 1 . 3 dpl , group b had an average of 2 . 4 dpl , group c had an average of 2 . 0 dpl , and no pigs from group d survived beyond three days post farrowing . clinical scores for the piglets are given in table 3 . the farrowing performance results provided the most dramatic differences and similarities between the various treatment groups . since the treatments would not have an effect on the size of the litters , the most appropriate way to compare the farrowing results would be by using percentage values . group a had an average percentage of live / born of 85 % ( sd +/− 9 . 6 ). group b had an average percentage of live / born of 89 % ( sd +/− 11 . 6 ). the control group ( group c ) had an average percentage of live / born of 83 . 4 % ( sd +/− 7 . 9 ). the average percentages for stillborns for groups a , b and c were 8 . 8 ( sd +/− 9 . 66 ), 6 . 6 ( sd +/− 9 . 7 ), and 14 ( sd +/− 11 . 39 ), respectively . the average percentages of mummies born to sows of groups a , b , and c were 6 . 1 ( sd +/− 6 . 01 ), 3 . 9 ( sd +/− 4 . 45 ), and 2 . 6 ( sd +/− 4 . 01 ), respectively . the average percentages of live / born , stillborn and mummies born to the sows of group d were 8 . 7 ( sd +/− 8 . 92 ), 10 . 7 ( sd +/− 11 . 39 ), and 81 . 9 ( sd +/− 17 . 18 ), respectively . the results of this example demonstrated the stability of the msv , ja - 142 , passage 200 after being passed in the host animal six times . there were no significant differences between the group of sows treated with the msv ( group a ) and those sows that were exposed to the backpassage 6 virus ( group b ) in the categories of farrowing performance , leukopenia , rectal temperatures , and the clinical observations of either the sows or the piglets . in addition , the results in these same categories for the groups a and b were comparable to those achieved by group c that had been treated with sterile diluent . finally , the performance of the sows that had been exposed to the virulent parent virus of msv , ja - 142 , passage 4 , clearly illustrated the level of attenuation of the msv and the lack of reversion to virulence by the backpassage 6 , ja - 142 virus . this example evaluated the safety and level of attenuation of administering a 10 × concentration of msv , ja - 142 , passage 201 . the study was performed on the pregnant sow model and monitored the effect of this dosage on reproductive performance . the study consisted of three groups , a , c , and d . group a was inoculated intra - nasally with prrs msv , ja - 142 , passage 200 . group c was inoculated intra - nasally with sterile diluent , to act as a normal control group . group d was inoculated intra - nasally with l ox ja - 142 , passage 201 . all inoculations were given at about 93 days gestation . body temperatures of the sows were monitored for the first seven days following inoculation ( vaccination ). blood samples were collected from the sows once a week and at time of farrowing . prior to and following inoculation , total white blood cell counts were determined as in example 2 . the health status of each animal was monitored daily for the duration of the study up to and following farrowing for 14 days . clinical observations of the sows were made from − 1 dpv through farrowing . the farrowing performance was evaluated by observing the health status of the piglets born . prrsv elisa assays were preformed following the exposures of the sows with the test article . attempts to isolate prrsv from serum samples were performed on ma - 104 cells following exposure to the test article . clinical observations of the piglets were made from farrowing until 14 days of age . blood samples were collected from the piglets at birth , 7 and 14 days of age . prrsv elisa assays were performed on the piglet sera weekly following farrowing . piglets were also weighed at birth , day 7 post farrowing , and at necropsy . at necropsy , the lungs of each piglet were scored for percent lung involvement . there were no significant differences between groups given a 10 × dose of msv , ja - 142 , passage 201 , groups given a regular dose of msv , ja - 142 , passage 200 , and groups given sterile diluent . therefore , based on the safety and attenuation of msv , ja - 142 , passage 200 and the lack of any significant difference in the results comparing these groups , a 10 × dose of msv , ja - 142 , passage 201 was shown to be safe , attenuated and effective in inducing antibodies against prrsv . this example demonstrated that a minimal vaccine dose of prrsv , ja - 142 , passage 205 , representing msv + 5 , is efficacious in an experimental respiratory challenge model in feeder pigs . pigs were divided into three groups . group 1 was inoculated intramuscularly with prrs msv , ja - 142 , passage 205 at a titer of 2 . 0 logs / dose . group 2 was inoculated intramuscularly with sterile diluent . group 3 acted as normal controls . pigs from groups 1 and 2 were challenged with a prrsv isolate with an rflp pattern of 144 on day 28 post vaccination . body temperatures of the pigs were monitored for the first seven days following vaccination and daily following challenge . each animal was weighed at vaccination , challenge , weekly throughout the study , and necropsy . blood samples were collected weekly following vaccination and every two days following challenge . the health status of each animal was monitored daily for the duration of the study . at necropsy , each animal was sacrificed and the lungs were scored for percent lung involvement as in example 2 . prrsv elisa assays were performed following the exposures of the pigs with the test articles and challenge . following exposure to the test articles , attempts to isolate prrsv from serum samples were performed on ma - 104 cells . virus isolation and elisa results were analyzed using a chi - square analysis which tests whether the percentage of positive animals is the same in each group . white blood cell counts were performed as in example 2 . pigs from group 1 ( vaccinated pigs ) fared better in all aspects of this example than did the pigs from group 2 ( pigs given sterile diluent ). clinical scores , rectal temperatures , and percent lung involvement were all higher for the pigs given sterile diluent . weight gain and white blood cell counts were lower for the pigs receiving the sterile diluent . there was also a significant reduction in viremia beginning on day 4 post - challenge in the group given vaccine . on days 10 and 11 post - challenge , the number of animals positive for viremia decreased further in the vaccinated group , but remained the same in the group receiving sterile diluent . an elisa was used to monitor anti - prrsv serological status prior to and following vaccination and challenge . all pigs were negative ( s / p ratio & lt ; 0 . 4 ) at the time of vaccination . all pigs including the vaccinates were negative at 7 dpv ( days post vaccination ). seven days later , 21 of 22 vaccinated pigs were tested as positive for antibody to prrsv . two pigs of group 1 remained negative during the pre - challenge period and serological converted at 8 days post challenge ( 8 dpc ). all of the pigs in group 2 were negative at trial day 0 and remained negative throughout the pre - challenge period . on trial day 39 ( 8 dpc ) 17 of the 22 non - vaccinated challenged pigs ( group 2 ) tested as sero positive . all of the pigs in group 3 ( normal controls ) remained sero - negative throughout the study . virus isolations from sera were performed before and after vaccination . of the 22 vaccinated pigs , 17 were positive by 2 dpv , 18 were positive by 4 dpv and 19 were positive by 7 dpv . following vaccination , vaccine virus was not recovered at all from one pig and not until 0 dpc for another . these results correspond to the sero - negative status of these pigs during the post vaccination observation period . at the time of challenge , 55 % of the vaccinated pigs were viremic positive . following challenge , this percentage rose to 82 % ( at 2 dpc ) and gradually decreased to 9 % on 11 dpc . all pigs in group 2 were negative at 0 dpc and increased to 82 % positive at 2 dpc and 91 % at 4 dpc . on 6 and 10 dpc , group 2 was approximately 82 % virus positive and 73 % ofthis group was positive on 11 dpc . the normal controls , group 3 , remained negative for the duration of the study . rectal temperature monitoring showed an overall group increase experienced by group 2 . one - half of the pigs in this group experienced a rise of 1 ° f . over the pre - challenge average for 2 or more days during the 11 day observation period . in comparison , only four of the 22 pigs in the vaccinated group experienced temperatures of 1 ° f . over their pre - challenge average . the average duration of those animals experiencing elevated temperatures for two or more days was 2 . 2 days for group 1 and 4 days for group 2 . none of the pigs in group 3 experienced increases of 1 ° f . over their pre - challenge average for two days or longer . weight gain was monitored over the 11 day observation period . pigs in group 3 gained an average of 1 . 06 pounds / day , pigs in group 2 gained an average of 0 . 94 pounds / day and pigs in group 1 gained an average of 0 . 53 pounds / day . therefore , non - vaccinated challenged pigs gained only about 57 % as much weight as did vaccinated challenged pigs and only 50 % as much weight as the control group . leukopenia ( white blood cell counts ) were monitored during the post challenge observation period . group 3 experienced a 5 % reduction in the group average on trial day 33 ( 2 dpc ) when compared to the pre - challenge average . for group 2 , white blood cell counts dropped an average of 41 % and did not return to pre - challenge levels until 11 dpc . the vaccinated group experienced a group average drop of 12 % on trial day 34 ( 3 dpc ). the counts returned to pre - challenge level on the next day and remained equal to the pre - challenge level for the duration of the observation period . daily clinical observations were made from trial day 28 (− 4 dpc ) through trial day 42 ( 11 dpc ). all pigs were free of any observable clinical signs during the pre - challenge period . group 3 remained free of any clinical signs for the duration of the post challenge period . five of the pigs in group 2 were observed to have post challenge clinical signs . these signs became evident at 6 dpc and were not considered to be severe . the vaccinated pigs had only 1 clinical sign observed during the 11 day post challenge observation period . at the termination of the study , lungs were evaluated for observable lung lesions . group 3 had normal lungs and a group average score of 0 . 02 . the individual pig scores for group 2 ranged from a low of 33 to a high of 98 for a group average of 78 . 33 . the scores of the vaccinated group ranged from 30 to a high of 90 with a group average of 53 . 20 . the data in this example demonstrated the efficacy of a modified live atypical prrs viral vaccine . the vaccine was administered at a minimal dose of 2 . 0 logs per dose containing the fifth passage beyond the msv ( ja - 142 , passage 205 ). efficacy of the vaccine was demonstrated by significantly reducing the extent of lung lesions , the severity of post challenge leukopenia , and post challenge fever . additionally , a normal growth rate was maintained in vaccinated / challenged pigs compared to that achieved by the normal control pigs and significantly better than that achieved by non - vaccinated / challenged pigs . this example compared four groups , groups 1 , 2 , and 3 having twenty pigs each , and group 4 having 10 pigs . group 1 was inoculated intramuscularly ( im ) with prrs msv , ja - 142 , passage 205 , at a titer of about 2 , 5 logs / dose . group 2 was inoculated intra - nasally with prrs msv , ja - 142 , passage 205 , at a titer of about 5 . 0 logs / dose . group 3 was inoculated im with sterile diluent . group 4 acted as strict controls . pigs were challenged with a prrsv isolate from south dakota state university ( sdsu ) with an rflp pattern of 144 on day 28 post - vaccination . body temperatures of the pigs were monitored daily following challenge . each animal was weighed at vaccination , challenge , weekly for the duration of the study , and necropsy . blood samples were collected weekly following vaccination and every two days following challenge . the health status of each animal was monitored daily for the duration of the study . at the termination of the study , animals were sacrificed and their lungs scored for percent lung involvement . pprsv elisa assays were performed following the exposures of the pigs with the test articles and challenge . attempts to isolate prrsv from serum samples were also performed on ma - 104 cells following exposure to the test articles . wbc counts and clinical observations were determined post inoculation as in example 2 . at zero days post vaccination ( dpv ), all pigs in this example were serologically negative to prrsv as indicated by having a s / p ratio & lt ; 0 . 4 . at 14 dpv , 70 % of the pigs in group 1 and 95 % of the pigs in group 2 tested positive for the presence of anti - prrsv antibody . only one vaccinated pig of group 1 , remained sero - negative throughout the pre - challenge period . this pig became sero - positive at seven days post challenge ( dpc ). all of the pigs in groups 3 and 4 remained negative throughout the pre - challenge period . at nine dpc , all of the pigs in group 3 , the sterile diluent treated group , tested positive by elisa for prrsv antibody . the normal controls , group 4 , remained negative for the duration of the study . the virus isolation results correlated well with serological results . only one pig remained negative for virus isolation from serum and this corresponded to the sero - negative status during the post vaccination period . these results indicate a relationship between post vaccination viremia and serological conversion with vaccine dosage . group 2 was 100 % sero - positive at 14 dpv as compared to 70 % for group 1 . the high dose group ( group 2 ) was 85 % and 90 % viremia positive at 14 and 21 dpv , respectively . in comparison , the low dose group ( group 1 ) was 55 % and 85 % positive for the same test days . following challenge , 89 % of the animals in group 3 experienced temperatures that were one degree f or greater than the pre - challenge values for two or more days . in group 1 , 75 % of the animals experienced temperatures of one degree or greater for two or more days . while only 45 % of the animals of group 2 experienced elevated temperatures . in comparison , 30 % of the animals in the normal control group ( group 4 ) experienced elevated temperatures for two or more days during the 11 day observation period . treatment with either the high vaccine dose or the low vaccine dose appeared to have no detrimental effect on the growth performance during the post - vaccination period (− 3 dpv to 28 dpv ). the average daily weight gain for groups 1 and 2 was 0 . 77 lbs ./ day and 0 . 76 lbs ./ day , respectively . for comparison , groups 3 and 4 had average daily weight gains of 0 . 77 lbs . and 0 . 78 lbs ., respectively . following challenge , the vaccinated groups outperformed the sterile diluent group by 0 . 05 lbs ./ day ( group 1 ) and 0 . 15 lbs ./ day ( group 2 ). the normal controls outgained the vaccinates during the same time period by an average of 0 . 4 to 0 . 5 lbs ./ day . eighty - four percent ( 16 of 19 ) of group 3 , the sterile diluent treatment group , experienced a 25 % or greater drop in their wbc count for one or more days after challenge . the normal controls had 3 of 10 ( 30 %) that had experienced similar decreases . following challenge , the vaccinated groups , the low dose ( group1 ) and the high dose ( group2 ) had 11 of 20 ( 55 %) and 3 of 20 ( 15 %) experiencing leukopenia of 25 % for one or more days . the clinical observations made prior to the challenge indicated that the pigs were of good health status . following challenge , the level of health status did not significantly change for those pigs that were challenged ( groups 1 , 2 , & amp ; 3 ). lethargy , respiratory signs , and lost appetite were the clinical signs observed and these were described as mild in severity . the clinical signs reported for one pig in group 2 could be attributed to the bacterial pneumonia ( see discussion below on lung lesions ) that it was experiencing . the normal control group ( group 4 ) was free of any observable clinical signs during the 11 day observation period . at the termination of the study , pigs were sacrificed and the lungs were observed for prrs - like lesions to score the extent of lung involvement . the percent of involvement was scored for each lobe then multiplied by the percent the lung represented for the total lung capacity . for example , 50 % lung involvement for a diaphragmatic lobe was then multiplied by 25 % to equal 12 . 5 % of the total lung capacity . the maximum score that could be obtained was 100 . the group average lung score for the normal controls ( group 4 ) was zero . the group average score for the sterile diluent treatment group ( group 3 ) was 70 . 08 . the vaccinated treatment groups average scores were 48 . 83 for the low dose ( group 1 ) and 17 . 76 for the high dose ( group 2 ). one pig was observed to have a lung score of 62 . 5 , the highest score within group 2 . the lesions noted on this pig &# 39 ; s lungs were described to be associated with bacterial pneumonia . from the results of this study , both dosage levels of the atypical prrs msv vaccine reduced the severity of the clinical signs associated with the respiratory disease caused by the prrsv . a full field dose outperformed the minimal dose as indicated by the significant reduction in lung lesion scores . this example determined the sequence of the attenuated msv , ja - 142 from the 201st passage as well as the sequence of passage 3 of the field isolate virus , ja - 142 . the attenuated virus isolate was obtained from the master seed stock representing the 201st passage in ma - 104 simian cells of a prrsv isolated from swine affected with prrs . the virus was grown on 2621 cells , a monkey kidney cell line , also referred to as ma - 104 and as usu - 104 ( gravell et al ., 181 proc . soc . exp . biol . med . 112 - 119 ( 1986 ), collins et al ., isolation of swine infertility and respiratory syndrome virus ( isolate atcc vr - 2332 ) innorth america and experimental reproduction of the disease in gnotobiotic pigs , 4 j . vet . diagn . invest . 117 - 126 ( 1992 )) ( the teachings of which are hereby incorporated by reference ). cells were cultured in 50 ml dulbecco modified eagle &# 39 ; s mem medium ( life technologies , inc ., gaithersburg , md . ), supplemented with 10 % fetal calf serum and 50 μg / ml gentamicin ( sigma chemical co ., st . louis , mo .) in a 5 % humidified co 2 atmosphere at 37 ° c . in 75 cm 2 plastic tissue culture flasks . cells were maintained by passage at 5 - 7 day intervals . cells were dislodged from the surface with trypsin - versene and split 1 : 4 . to infect cells , media was decanted and 1 ml of cell supernatant containing virus at a titer of approximately 10 − 5 - 10 6 tissue culture infective doses ( tcid 50 ) was added for 30 min . thirty ml fresh media containing 4 % fetal calf serum was added . cells were incubated as described above for 5 days , at which time cytopathic effect was evident in the culture . culture medium containing virus was centrifuged at 2000 rpm in a beckman tj6 centrifuge to pellet cellular debris . viral genomic rna was purified by adding 1120 μl of prepared buffer avl ( qiaamp viral rna isolation kit , qiagen )( qiagen , inc . valencia , calif . )/ carrier rna to a 280 μl sample of virus - containing culture medium . the mixture was vortexed and incubated at room temperature for 10 min . 1120 μl ethanol was added and the mixture was inverted several times . rna was absorbed to the matrix of a qiaamp spin column by repeated centrifugation of 630 μl aliquots at 6 , 000 × g for 1 min . the column was washed with 500 μl buffer aw and centrifuged to remove all traces of wash solution . rna was eluted from the column with 60 μl of diethylpyrocarbonate - treated water at room temperature . purified rna was stored at − 70 ° c . or used immediately for synthesis of cdna . for cdna synthesis , viral rna was heated at 67 ° c . for 7 min , primed with random hexamers or prrsv - specific primers , and reverse transcribed with superscript ii rnase h - reverse transcriptase ( rt ) ( life technologies , inc .). reactions contained 5 mm mgcl 2 , 1 × standard buffer ii ( perkin elmer corp . wellesley , mass . ), 1 mm each of datp , dctp , dgtp and dttp , 1 unit / μl of rnase inhibitor , 2 units of rt , and 1 × l of rna in a 40 μl reaction . reaction mixtures were incubated for 15 min at 42 ° c ., for 5 min at 99 ° c . and for 5 min at 5 ° c . polymerase chain reaction ( pcr ) was performed to obtained dna fragments for sequencing as follows : 10 μl portions of cdna reaction mixture were combined with the following reagents , resulting in a 25 μl reaction containing 2 mm mgcl 2 , 1 × standard buffer ii ( perkin elmer ), 0 . 2 mm each of datp , dctp , dgtp and dttp , 0 . 3 μm of 5 ′- and 3 ′- prrsv - specific primer , and 0 . 375 units amplitaq taq polymerase ( perkin elmer ). reactions were prepared by heating for 4 min at 93 ° c . in athermal cycler , then 35 cycles consisting of 50 - 59 ° c . for 30 sec , 72 ° c . for 30 - 60 sec , and 94 ° c . for 30 sec . specific times and temperatures varied depending on the annealing temperatures of the primers in each reaction and the predicted length of the amplification product . a final incubation was performed for 10 min at 72 ° c . and reactions were placed at 4 ° c . pcr products were purified with a microcon 100 kit ( amicon , bedford , mass .). rapid amplification of cdna ends ( race ) pcr was performed to obtain the extreme 5 ′- end sequence of the genomic rna , based on the method of frohman , mass ., on beyond classic race ( rapid amplification of cdna ends ), 4 pcr methods and applications s40 - s58 ( 1994 ) ( the teachings of which are hereby incorporated by reference ). viral rna was isolated and converted to cdna as described above , with random hexamers as primers . reaction products were purified on a microcon 100 column ( amicon ). a poly ( da ) tail was added to the 3 ′- end by incubating 10 μl of cdna in a 20 μl volume containing 1 × buffer 4 ( new england biolabs , beverly , mass . ), 2 . 5 mm cocl 2 , 0 . 5 mm datp and 2 units terminal transferase ( new england biolabs ), for 15 min at 37 ° c . the reaction was stopped by heating for 5 min at 65 ° c . and then was diluted to 200 μl with water . pcr was performed using the expanda long template pcr system ( boehringer mannheim , mannheim , germany ) in a 50 μl reaction volume containing 10 μl of diluted , poly ( da )- tailed cdna , 1 × buffer 3 , 0 . 35 mm each of datp , dctp , dgtp and dttp , 0 . 625 mm mgcl 2 , 0 . 04 μm q t primer ( frohman , 1994 ), 0 . 3 μm q o primer ( frohman , 1994 ), 0 . 3 μm 5 ′- cgccctaattgaataggtgac - 3 ′ and 0 . 75 μl of enzyme mix . reactions were heated at 93 ° c . for 2 min in a thermal cycler and cycled 25 times with each cycle consisting of 93 ° c . for 10 sec , 63 ° c . for 30 sec . and 68 ° c . for 12 min . after 25 cycles , the reaction was incubated at 68 ° c . for 7 min and held at 4 ° c . an aliquot of the reaction was diluted 100 - fold and 5 μl of diluted product was added to a second pcr reaction containing , in 50 μl , 1 × buffer 1 , 0 . 35 mm each of datp , dctp , dgtp and dttp , 0 . 3 μm primer qi ( frohman , 1994 ), 0 . 3 μm 5 ′- ccttcggcaggcggggagtagtgtttgaggtgctcagc - 3 ′, and 0 . 75 μl enzyme mix . reactions were heated at 93 ° c . for 2 min in a thermal cycler and cycled 25 times with each cycle consisting of 93 ° c . for 10 sec , 63 ° c . for 30 sec , and 68 ° c . for 4 min . after 25 cycles , the reaction was incubated at 68 ° c . for 7 min and held at 4 ° c . reaction products were electrophoresed on a 1 % agarose gel and the band of approximately 1500 bp was purified using the qiagen qxii gel purification kit . eluted dna was cloned into the pgem - t vector ( promega , madison , wis .) using standard procedures . individual clones were isolated and grown for isolation of plasmid dna using qiagen plasmid isolation kits . pcr products and plasmid dna were combined with appropriate primers based on related prrsv sequences in genbank or derived from known sequences , and subjected to automated sequencing reactions with taq dyedeoxy terminator cycle sequencing kits ( applied biosystems , foster city , calif .) and a pr 2400 thermocycler ( perkin elmer ) at the university of minnesota advanced genetic analysis center . reactions were electrophoresed on an applied biosystems 3700 dna sequencer . sequence base calling and proofreading were performed primarily with the phred program ( university of washington genome center ) and fragment assembly was performed primarily with the phrap program ( university of washington genome center ). additional computer software including the lasergene package ( dnastar inc ., madison , wis . ), wisconsin package version 9 . 1 ( genetics computer group , madison , wis . ), and eugene ( molecular biology information resource , houston , tex .) was used to analyze the sequence . the final viral genomic sequence was assembled from approximately 100 pcr reactions and 428 dna sequencing reactions . the results of example 7 are given as seq id nos . 1 and 2 wherein seq id no . 1 represents the sequence of the 201st passage of the master seed virus , ja 142 and seq id no . 2 represents the sequence of the field - isolated virulent virus , ja 142 after three passages .

substantially avirulent forms of atypical porcine reproductive and respiratory syndrome virus and corresponding vaccines are provided which result from cell culture passaging of virulent forms of prrs . the resultant avirulent atypical prrs virus is useful as a vaccine in that prrs specific antibody response is elicited by inoculation of host animals , thereby conferring effective immunity against both previously known strains of prrs virus and newly isolated atypical prrs virus strains . the preferred passaging technique ensures that the virus remains in a logarithmic growth phase substantially throughout the process , which minimizes the time required to achieve attenuation .

the following discussion of the preferred embodiments of the present invention is merely exemplary in nature . accordingly , this discussion is in no way intended to limit the scope of the invention . an exemplary drug - delivery tool which embodies various features of the invention is shown in fig1 through 4 . as will become apparent , the illustrated drug - delivery tool is particularly well suited for percutaneous introduction into a subject for intravascular delivery of a selected agent into temporary cavities formed in a desired layer of a selected tissue . with initial reference to fig1 a catheter assembly ( which may be disposable , in whole or in part ), indicated generally by the reference numeral 12 , includes a control structure ( hand unit ) 14 attached to a steerable catheter accessing device 16 having a controllably deflectable distal - end member . steering of the catheter assembly can be accomplished in a variety of ways . for example , the catheter assembly can include steering components like those disclosed in u . s . pat . no . 5 , 876 , 373 , entitled “ steerable catheter ,” to giba et al . ; and / or in co - pending u . s . provisional patent application ser . no . 09 / 080 , 175 filed may 16 , 1998 , entitled , “ drug delivery module ,” to glines et al . ; and / or in published european patent application no . ep 0 908 194 a2 , each of which is expressly incorporated herein by reference . briefly , in the illustrated embodiment , a pull wire 18 , having an enlarged head member 18 a at its distal end , extends from the tip of catheter accessing device 16 , through a wire - guide channel 19 extending through catheter accessing device 16 , to control structure ( hand unit ) 14 , whereat the wire &# 39 ; s proximal end is coupled to a deflection or steering actuator assembly . rotation of a deflection knob 20 , which is threadedly mounted along a forward end of the hand unit , causes the pull wire to be pulled backward , or the catheter accessing device to be pushed forward , relative to one another , thereby inducing deflection of the distal end of the steerable catheter accessing device . rather than running the pull wire through a channel extending through the catheter accessing device , another embodiment provides the pull wire extending longitudinally along the interior wall of the catheter accessing device ( fig3 ). other steering mechanisms and arrangements , suitable for use herein , will be apparent to those skilled in the art . in yet another preferred embodiment , the catheter is further guided by a coaxial second catheter as described in co - pending application u . s . ser . no . 09 / 052 , 971 and pct publication wo 9949773a2 titled “ delivery catheter system for heart chamber ” by payne , filed mar . 31 , 1998 , both herein incorporated in their entireties by reference . catheter accessing device 16 is dimensioned to be placed in the vasculature of a subject and steered therethrough until the tip is disposed adjacent a selected region of tissue , for example , a surface or wall within a heart chamber ( such as against the endocardial wall within the heart &# 39 ; s left ventricle ). visualization enhancement aids , including but not limited to radiopaque markers , tantalum and / or platinum bands , foils , and / or strips can be placed on the various components of drug - delivery tool - catheter assembly 12 , including on the deflectable end member of catheter accessing device 16 . in one embodiment , for example , a radio - opaque marker ( not shown ) made of platinum or other suitable radio - opaque material is disposed adjacent the tip for visualization via fluoroscopy or other methods . in addition , or as an alternative , one or more ultra - sonic transducers can be mounted on the catheter accessing device at or near its tip to assist in determining its location and / or placement ( for example , degree of perpendicularity ) with respect to a selected tissue in a subject , as well as to sense wall contact with , and / or wall thickness of , the tissue . ultra - sonic transducer assemblies , and methods of using the same , are disclosed , for example , in published canadian patent application no . 2 , 236 , 958 , entitled , “ ultrasound tool for axial ranging ,” to zanelli et al ., and in co - pending u . s . patent application ser . no . 08 / 852 , 977 , filed may 7 , 1997 , entitled , “ ultrasound tool for axial ranging ,” to zanelli et al ., each of which is expressly incorporated herein by reference . in one embodiment of the present invention , depicted in fig2 two transducers , denoted as 26 and 28 , are angle mounted at the tip of catheter accessing device 16 in the axis of pull - wire deflection . this construction permits an operator to determine , by comparing signal strength , whether the catheter tip region is perpendicular to a selected tissue surface or wall . additionally , this two - transducer arrangement provides an operator with information useful for determining an appropriate adjustment direction for improving perpendicularity , as compared to single - transducer arrangements that , while capable of indicating perpendicularity by signal strength amplitude , are generally incapable of indicating a suitable direction in which to move the tip to improve perpendicularity . in a related embodiment , third and fourth transducers ( not shown ) are added , off of the deflection axis , to aid an operator with rotational movement and rotational perpendicularity in the non - deflecting plane of the subject tissue surface . each of the above ultrasound transducers may preferably be substituted with force contact transducers described in co - pending u . s . patent application ser . no . 60 / 191 , 610 by c . tom titled “ apparatus and method for affecting a body tissue at its surface ”, filed mar . 23 , 2000 , [ attorney docket 5756 - 0011 ] herein incorporated by reference . an additional benefit of using a force contact transducer is that the contact force and incident angle are know to the user enabling the user to achieve a seal between the distal end of the accessing device and a tissue such that a seal is formed between the two preventing administered drug from seeping out of a formed cavity . in some preferred embodiments , one or more elongate lumens may extend between the proximal and distal ends of the catheter accessing device , with ( i ) at least one lumen being dimensioned to accommodate a cavity forming implement for axial movement along a region of the assembly &# 39 ; s distal end , and ( ii ) at least one lumen being configured to permit passage of one or more selected therapeutic and / or diagnostic agents from an agent - supply region ( for example , a reservoir in the hand unit ) to , and out of , a terminal orifice at the assembly &# 39 ; s distal end . the just - described items ( i ) and ( ii ) can be achieved using a single lumen , or multiple lumens . in one embodiment , for example , catheter accessing device 16 , as depicted in fig1 is preferably formed with an outer diameter of between about 2 . 25 to 2 . 75 mm ( preferably 7 french ), and an inner diameter , defining a primary lumen 22 , of about 1 mm . at its distal end , lumen 22 terminates at an orifice 24 . a tissue - penetrating implement 48 ( described below ) is adapted for movement within a distal - end region of lumen 22 . a selected agent can be passed through the main lumen directly , i . e ., in contact with the main lumen &# 39 ; s interior walls , and / or indirectly , for example , using one or more additional lumens ( for example , sub - lumens ) extending coextensively and / or coaxially with the main lumen . an embodiment of the latter construction is also illustrated , in part , in fig3 and 4 . for example , fig1 , and 4 each depict different aspects of an elongate , flexible agent - delivery conduit 30 is disposed substantially coaxially within catheter accessing device 16 , extending from control structure ( hand unit ) 14 to a distal region of lumen 22 . conduit 30 can be formed , for example , of a substantially inert polymeric material that resists collapse during bending or twisting , such as braided polyimide , braided pebax , or the like . conduit 30 defines a hollow , axial lumen or passage 32 , having a diameter within a range of from about 0 . 25 mm to about 1 mm ( for example , about 0 . 5 mm ), or from about 0 . 010 ″ to about 0 . 040 ″ ( for example , about 0 . 020 ″), that communicates at its proximal end with an agent - supply reservoir disposed in control structure ( hand unit ) 14 , and terminates at its distal end at an exit or infusion port 34 , through which a selected therapeutic and / or diagnostic agent can pass . as described below , conduit 30 is adapted for reciprocal sliding movement within catheter accessing device 16 and , thus , is provided with an outer diameter less than the inner diameter of catheter accessing device 16 , for example , about 1 mm or less in certain constructions . at this point , certain details of the hand unit relating to agent storage and dispensing will be described , bearing in mind that additional details are set forth in co - pending u . s . provisional patent application ser . no . 09 / 080 , 175 filed may 16 , 1998 , entitled , “ drug delivery module ,” to glines et al ., incorporated herein by reference . in one preferred embodiment depicted in fig1 control structure ( hand unit ) 14 is provided with a fixed drug - delivery reservoir for holding a supply of a selected agent to be dispensed . in this embodiment , a supply vessel , such as syringe 36 , can communicate with the drug - delivery reservoir via a connector provided in the unit &# 39 ; s outer housing 38 . the connector is preferably a substantially sterile connector , such as a standard luer - type fitting or other known standard or proprietary connector . in another embodiment , the supply reservoir comprises a syringe , pre - loaded with a selected agent , that can be removably fit into a holding area inside the housing . in both such embodiments , a dosage volume adjustment thumbscrew 40 can be mounted in the housing 38 so as to be externally accessible for accurate , local and rapid dosage volume adjustment . also , a dosage volume scale or indicator , as at 42 , can be provided in the housing 38 . upon depressing a trigger mechanism 44 along one side of control structure ( hand unit ) 14 , manually or otherwise , the agent stored in the drug - delivery reservoir moves into conduit 30 . it should also be noted that trigger mechanism 44 is coupled to the proximal end of conduit 30 such that , upon being depressed , the conduit is pushed forward ( advanced ) within catheter accessing device 16 from a normal , retracted condition , depicted in fig1 to a dispensing condition , shown in fig4 whereat conduit orifice 34 can be positioned closely adjacent a selected tissue , such as 46 , against which catheter - accessing device orifice 24 has been placed . upon releasing the trigger mechanism , conduit 30 shifts back to its normal condition . the distance traversed by conduit 30 , in each direction , is from about 2 to about 10 mm , and preferably about 5 mm . a tissue - penetrating implement , indicated generally as 48 , is also longitudinally movable within catheter accessing device 16 , between a retracted condition , within a distal region of lumen 22 ( fig1 ), and an extended ( advanced ) condition , passed through and extending out of orifice 24 ( fig4 ), over a stroke of about 4 - 6 mm , and preferably about 5 mm . movement of implement 48 is effected by way of an elongate actuation line 50 , depicted in cross - section in fig3 operatively coupled at one end to trigger mechanism 44 ( fig1 ) and extending axially through conduit 30 from control structure ( hand unit ) 14 to a proximal end of implement 48 . preferred materials for forming the actuation line are laterally flexible , permitting movement through tortuous pathways , and sufficiently incompressible along the longitudinal direction to provide for the efficient transmission of motion from the proximal end to the distal end . suitable materials include , for example , stainless steel or a braided composite . in operation , upon the depressing trigger mechanism , implement 48 is shifted from its normal , retracted condition to its extended condition , and upon release of the trigger mechanism , implement 48 returns to its retracted condition . for reasons that will become apparent below , it should be noted that the above - described advancement of both conduit 30 and cutting implement 48 takes place substantially simultaneously ( i . e ., these motions are coupled ) with a single depression of trigger mechanism 44 . in addition , optionally , with the same trigger depression , an agent held in a reservoir in the hand unit is dispensed from conduit 30 . preferably , such dispensing is effected immediately after ( not before ) the conduit and cutting implement have reached their respective extended conditions . for example , the initial depression can actuate axial movement of the conduit and cutting implement , and the latter member of the depression can effect dispensing . similarly , both conduit 30 and cutting implement 48 are retracted together with release of the trigger mechanism , and the dispensing of the selected agent is stopped . with further regard to the tissue - penetrating implement 48 , its distal end includes a cutting or slicing tip , denoted as 52 . in the illustrated arrangement , tip 52 takes the form of a narrow , three - sided pyramid - like structure that tapers to a sharp point . alternatively , tip 52 could taper to a two - sided knife edge or blade , or any other suitable cutting or slicing structure . preferred cutting or slicing structures are configured to substantially avoid the removal of tissue beyond the cellular injury inherent in cutting . implement 48 further includes an expandable member , proximal of tip 52 , comprised of one or more resiliently flexible expandable elements or expandable members , three of which are visible ( out of a total of four ) at 54 in the embodiment of fig1 and 4 . the expandable members are arranged at spaced positions about the implement &# 39 ; s longitudinal axis , and configured to flex outwardly , away from such axis , to collectively form a three dimensional support skeleton or cage . the expandable members can be , for example , narrow , elongate wires , filaments or ribbons , formed of a substantially inert , resiliently flexible material , such as a metal or metal alloy ( for example , stainless steel , nickel - titanium , or similar material ) or from an injection molded plastic . the distal end of each expander is turned inward and attached to the proximal side of tip 52 . when the expandable member is disposed at its retracted condition ( fig1 ), the expandable members are compressed toward the implement &# 39 ; s longitudinal axis ; and when advanced to its extended condition ( fig4 ), the expandable members are allowed to flex outward , so that , overall , the expandable member achieves a maximum diameter of about 1 - 3 mm , and preferably from about 1 . 75 mm to about 2 mm . according to one preferred construction of the expandable member , between about 3 - 10 nickel - titanium ( for example , as available commercially under the name “ nintinol ”) filaments , each between about 4 - 5 mm in length and from about 0 . 003 ″ to about 0 . 005 ″ in diameter are employed as expandable members . the particular number , dimensions , and material composition of the expandable members are not critical , provided only that the expandable members are capable of forming a cavity when inserted into a selected tissue ( i . e ., they have sufficient strength and spring capabilities ), and , when in the expanded condition , a drug or other agent delivered into the region within the expandable members can move outwardly into the tissue about the cavity , with very little interference presented by the expandable members themselves , as shown in fig4 with agent 58 in cavity 60 . regarding the latter , the expandable members preferably occupy no more than about 10 %, and more preferably less than about 3 %, of the region defining the boundary between the cavity and the target tissue thereabout . in this way , the vast majority of the tissue boarding a cavity can be directly exposed to an agent delivered into the cavity . an exemplary method of using the above catheter assembly will now be described , wherein the catheter assembly is used for intra - myocardial delivery of a selected therapeutic and / or diagnostic agent . initially , catheter accessing device 16 is percutaneously introduced via femoral or radial artery access . this can be accomplished , for example , by way of the seldinger technique ( acta radiologica , 38 , [ 1953 ], 368 - 376 ; incorporated herein by reference ), a variation thereof , or other conventional technique . optionally , a conventional guiding or shielding catheter ( not shown ) can be employed to assist in tracking the catheter tool through the patient &# 39 ; s vasculature and into targeted regions of the heart . once arterial access is established , the catheter accessing device 16 is slid across the aortic valve and into the left ventricle chamber . the distal end of the catheter accessing device 16 is maneuvered so as to be substantially perpendicular to the endocardial wall 46 ( fig4 ), using fluoroscopic visualization and / or ultrasound guidance , and pressed thereagainst . trigger mechanism 44 is next depressed , causing cutting tip 52 to advance into the myocardial tissue , in the direction of arrow 64 , to a pre - set or adjustable depth . expandable members 54 follow cutting tip 52 into the myocardium and expand radially ( for example , in the direction of arrows 66 ), creating a cavity about the axis of penetration ( i . e ., the axis of cutting or slicing ). once the cavity has been created , the expandable members serve to maintain the cavity by resisting heart contractile forces . the same trigger depression serves to deliver a selected agent through conduit 30 into the cavity 60 . after allowing the agent to enter into the surrounding tissue for appropriate period of time , for example , typically less than about 2 minutes , the tissue - penetrating implement is withdrawn , at which point the cavity can close . healthy myocardial tissue is illustrated in fig5 a . as shown , healthy tissue contains capillaries 70 , interstitial tissue 72 , and heart muscle cells 74 ( see , for example , “ gray &# 39 ; s anatomy ” ( 1959 ) at page 597 ). fig5 b shows how a temporary cavity 60 can be created to directly access , for example , along the direction of arrows 68 , more capillaries 70 , more heart muscle cells 74 , and tissue surface area 76 . it should be appreciated that the creation of temporary cavities , as taught therein , provides direct access to a greater number of capillaries than has been possible by the prior techniques . as a result , the performance of the infusate tool is greatly enhanced . it is believed that abrasion to the wall of the cavities may aid in absorption of the agent . accordingly , it may be desirable to configure the cutting tip and / or cavity expandable members of the invention so as to allow selective abrasion . this can also be accomplished , for example , by rf , thermal , acidic and / or ultrasonic means acting on the cutting tip and / or cavity expandable members . it is noted that the above - described method is exemplary in nature . those skilled in the art will appreciate that the present invention provides for the delivery of selected agents to a wide variety of body organs and regions . another embodiment of the drug - delivery tool of the present invention is shown in fig6 wherein the tool is embodied in an endoscope - type tool , shown generally at 80 . as described next , the drug - delivery tool of this embodiment is configured for intraoperative use , to be introduced thoracoscopically or through a thoracotomy , to form temporary cavities in a selected tissue . the tool includes a proximal handpiece 82 ( similar to the previously - described control structure ( hand unit ) 14 ) adapted to accommodate an drug - delivery reservoir syringe 84 , and a depressible trigger mechanism 86 . this particular surgical tool incorporates a reusable 5 mm thoracoscopic camera 88 axially mounted to provide an operator with a field of view 90 through lens 92 . this allows the operator to work through a common trocar access port 94 placed , for example , through a patient &# 39 ; s chest wall 96 . in an exemplary use , upon traversing the epicardial surface 98 of the heart , a tissue - penetrating implement 48 , substantially as described above , can create a temporary cavity for receiving a selected agent . as with the catheter assembly , the tool is adapted to permit a user to both extend the tissue - penetrating implement and dispense a drug or other agent , with a single depression of the trigger mechanism 86 . additional details of the handpiece are presented in co - pending u . s . provisional patent application ser . no . 09 / 080 , 175 filed may 16 , 1998 , entitled , “ drug delivery module ,” to glines et al ., incorporated herein by reference . one skilled in the art would recognize that the above mentioned endoscopic embodiment may further be adapted for use without an endoscopic port , for example , such as in open surgery . such an embodiment may be guided with or without visualization aids such as an optical endoscope or other optical enhancement device . it should be noted that , especially when used in open surgery , the tissue - penetrating implement need not retract . thus , movement of the implement between its retracted and advanced conditions , in such cases , need only involve movement of the implement move from its retracted to its advanced condition . in another embodiment of the present invention , a selected therapeutic and / or diagnostic agent comprising a charged species ( for example , dna ) is held within the distal - end region of an accessing device and delivered into a cavity formed by in a selected tissue via an electrical field . an exemplary cavity - forming and delivery implement , which can be incorporated in a catheter - type tool or an endoscope - type , such as previously described , is shown in fig7 a - 7 c . here , the implement includes drug - delivery reservoir or storage vessel 114 which opens into the region between a plurality of expandable members 116 via short passage 118 through a neck member 120 . first and second lead wires , denoted as 122 and 124 respectively , extend through a flexible actuation accessing device 126 and terminate at respective terminals , or electrodes , fixed in the implement . the first terminal , indicated as 123 , being placed at a rearward ( proximal ) region of the vessel 114 , and the second terminal , denoted as 125 , being placed at a forward ( distal ) region of the implement &# 39 ; s cutting / slicing tip 128 . in an exemplary operation , whereby dna , indicated as 130 , is delivered into myocardial tissue 132 of a subject , the catheter accessing device 134 is introduced into a subject body and placed against an endocardial or epicardial wall 136 of the heart &# 39 ; s left ventricle ( fig7 a ). during such introduction and placement , the vessel terminal 123 is made positive (+) and the tip terminal 125 is made negative (−), thereby establishing an electrical field that maintains the negatively charged dna in the vessel 114 . it should be noted that the lead wires 122 , 124 and regions about the terminals 123 , 125 are shielded , using conventional materials , to limit the field &# 39 ; s reach into the surrounding heart tissue . such shielding about the forward ( distal ) region of the implement is indicated by back - hatching in the drawings . after placement of the catheter , actuation accessing device 126 is advanced , via a remote shifting mechanism ( such as previously described ), to push the slicing tip 128 through the wall 136 and into a region of myocardium 132 , with the expandable members 116 following the tip therein . once a cavity has been formed in the myocardium , the polarity is reversed , so that the tip terminal 128 is positive (+) and the vessel terminal 123 is negative (−) ( fig7 b ), thereby establishing an electrical field effective to draw the negatively charged dna 130 toward the tip 128 . after a short time , with at least a substantial member of the dna drawn out of the vessel 114 , the electrical field is discontinued ( fig7 c ), so that the dna can move outwardly into the surrounding tissue and capillaries of the myocardium . in another embodiment , a selected therapeutic and / or diagnostic agent is held within the distal - end region of an accessing device and placed in a cavity formed in a selected tissue . an exemplary cavity - forming and placement implement , which can be incorporated in a catheter - type tool or an endoscope - type , such as previously described , is shown in fig8 a - 8 c . here , the implement includes a plurality of expandable members 142 attached at their rearward ( proximal ) ends to a flexible actuation accessing device 144 , and at their forward ( distal ) ends to a cutting / slicing tip 146 . the expandable members 142 are arranged to serve as a cage or skeleton for containing a selected agent 148 , in solid or semi - solid form , as the catheter accessing device 150 is placed against a selected organ wall , as at 152 ( fig8 a ). actuation accessing device 144 is then advanced , via a remote shifting mechanism , to push the slicing tip 146 of the implement through the wall 152 and into a selected layer of tissue 154 , with the expandable members 142 following the tip 146 therein ( fig8 b ). once a cavity has been formed in this manner , the agent 148 is allowed to move outward into the surrounding tissue and capillaries ( fig8 b - 8 c ). the agent can be configured to for controlled release after placement , for example , via swelling and sloughing over a period of several minutes . in one embodiment , wherein the agent is dna , controlled - release preparations are formulated through the use of polymers to complex or absorb the selected gene sequence ( with or without an associated carrier , for example , liposomes , etc .). the agents can be formulated according to known methods to prepare pharmaceutically useful compositions , whereby these materials , or their functional derivatives , are combined in admixture with a pharmaceutically acceptable carrier vehicle . suitable vehicles and their formulation , are described , for example , in nicolau , c . et al . ( crit . rev . ther . drug carrier syst 6 : 239 - 271 ( 1989 )), which is incorporated herein by reference . in order to form a pharmaceutically acceptable composition suitable for effective administration , such compositions will contain an effective amount of the desired gene sequence together with a suitable amount of carrier vehicle . [ 0068 ] fig9 a depicts a preferred embodiment of the invention where accessing device 900 further comprises force contact transducer 902 mounted on distal end 904 of accessing device 900 . as accessing device 900 is urged toward tissue 906 , as shown in fig9 b , force contact transducer 902 contacts tissue 906 causing detectable contact pressure to develop between force contact transducer 902 and tissue 906 . such detectable pressure , detected by force contact transducer 902 is communicated back to the end user who then can further manipulate accessing device 900 to achieve perpendicularity between the thrust axis of accessing device 900 and tissue 906 . upon achieving perpendicularity and contact force , tissue - penetrating implement 908 , with cutting tip 908 a , may be advanced to an extended condition , from a retracted position , thus causing the formation of cavity 910 in tissue 906 . because accessing device 900 is urged against tissue 906 in a perpendicular manner , distal end 904 of accessing device 900 develops a seal for sealing in later delivered drug into cavity 910 . fig9 c depicts accessing device 900 without force contact transducer 902 . fig9 c suggests how a non - perpendicular orientation of accessing device 900 with respect to tissue 906 could result in seepage of delivered drug 912 from cavity 910 . fig9 d further depicts accessing device 900 without force contact transducer 902 urged against tissue 900 . tissue 900 is further depicted in two states , diastolic state tissue 906 a and systolic state tissue 906 b correlating to the movement of myocardial tissue in a beating heart . as shown in fig9 d , diastolic position tissue 906 a provides a seal between tissue 906 and accessing device 900 . however , upon systolic movement , tissue 906 moves away from accessing device 900 unless sufficient contact force exists between accessing device 900 and tissue 906 . force contact transducer 902 provides information to the user to enable the user to apply sufficient and perpendicular force to the accessing device to create a seal between accessing device 900 and tissue 906 during the movements of beating heart between tissue 900 a and 900 b states . moreover , fig9 d depicts how delivered drug 912 may be further ejected or pumped out of cavity 910 by the contractile actions between heart tissue 900 a and 900 b states . [ 0069 ] fig1 depicts another embodiment of the invention utilizing corkscrew shaped tissue - penetrating implement 1000 . accessing device 1002 houses tissue - penetrating implement 1000 that may be rotated within accessing device in either a retracted condition or an extended condition . fig1 a depicts tissue - penetrating implement 1000 secured into tissue 1004 by screwing . as tissue - penetrating implement 1000 is withdrawn back towards a retracted condition , tissue 1004 is likewise pulled into lumen 1006 of accessing device 1002 thus creating seal 1006 between accessing device 1002 and tissue 1004 . such pulling further creates cavity 1008 at distal end 1010 of tissue - penetrating implement 1000 . cavity 1008 may then be filled with delivered - drug , not shown , delivered through lumen orifice 1012 to treat the walls of cavity 1008 with such drug . [ 0070 ] fig1 depicts another embodiment of the invention where the expandable members comprise a balloon structure with drug - delivery lumen orifices distributed along the surface of the expandable members . fig1 a and 11 b depicts a tissue - penetrating implement 1101 comprising four radially distributed expandable members 1100 defining lumens 1102 with exit ports 1104 outwardly situated on balloon 1106 . penetrating tip 1108 is situated on the end of the balloon distal from accessing device 1110 , not shown . as balloon 1106 is inflated , expandable members 1100 are urged outward against the tissue of a cavity , not shown . fig1 c further shows yet another embodiment using a balloon as an expandable member and drug - delivery channel . accessing tool 1110 is urged against tissue 1112 , whereby tissue - penetrating implement 1101 comprises a balloon expandable member 1106 with distally situated exit ports 1104 and penetrating or cutting tip 1108 . [ 0071 ] fig1 depicts a preferred embodiment of the invention where tissue penetrating implement 1200 comprises at least one first expandable member 1202 made from a shape memory material composition having a first remembered arc shape and a second , stress induced , straight shape . first expandable member 1202 assumes a stress induced straight shape when housed within lumen 1204 of accessing tool 1206 , but returns to its remembered shape upon extension beyond lumen 1204 . as first expandable member 1202 extends from lumen 1202 , it cuts an arc shaped path through tissue 1210 as first expandable member 1202 regains its remembered shape . tissue - penetrating implement 1200 has cutting tip 1208 situated distal to accessing tool 1206 for cutting tissue 1210 as tissue - penetrating implement 1200 is advanced into tissue 1210 when advanced from a retracted condition to an extended condition out of lumen 1204 . second expandable member 1211 extends from lumen 1204 coaxial to first expandable member 1202 . adjacent tissue - penetration implement &# 39 ; s distal end , first and second expandable members are positioned together either fixedly or slidably . when fixedly positioned , both expandable members 1202 and 1211 extend together , but expand longitudinally from one another to form cavity 1212 . when first and second expandable members 1202 and 1211 are slidably positioned , the user may either extend one expandable member , preferably the first expandable member 1202 having cutting tip 1208 , and then extend second expandable member 1211 to follow along cut path 1216 created by previously extended first expandable member 1202 , expanding longitudinally away from first expandable member 1202 to create cavity 1212 where a drug may be infused from a drug - delivery reservoir , not shown , in fluid communication through a conduit with the distal region of accessing device 1222 . fig1 b depicts a variation where second expandable member further comprises construction from shape memory tube 1218 , such as nitinol or niti tubing , defining a longitudinal lumen in fluid communication with a drug - delivery reservoir , not shown , and terminating with exit ports 1220 adjacent to the distal end of second expandable member . during or after the formation of cavity 1212 , drug may be delivered from the drug - delivery reservoir , not shown , to the cavity 1212 through the lumen and exit ports 1220 of second expandable member 1211 . fig1 c depicts a variation where first and second expandable members 1202 and 1211 are spaced - apart from one another by , for example , having two lumens , not shown , defined within accessing device 1222 . force contact transducer 1224 is located on the distal end of accessing device 1222 to assist a user in achieving the sufficient and perpendicular contact force with respect to tissue 1210 to create a seal between tissue 1210 and the distal end of accessing device 1222 . one skilled in the art would readily recognize the benefits of the above mentioned embodiment . in particular , the presence of second expandable member 1211 made from a shape memory material that assumes a stress induced straight shape when housed within lumen 1204 of accessing tool 1206 , but returns to its remembered shape upon extension beyond lumen 1204 , when configured as shown in fig1 , provides the ability to shepherd first expandable member 1202 further in its arc shape cutting path by applying lateral force to cutting tip 1208 as it cuts through tissue 1210 . this further prevents cutting tip from accidentally cutting too deep through a wall like tissue and thus perforating the wall and turning a cavity into a passage . additional pharmaceutical methods may be employed to control the duration of action . controlled delivery may be exercised by selecting appropriate macromolecules ( for example polyesters , polyamino acids , polyvinyl , pyrrolidone , ethylenevinylacetate , methylcellulose , carboxymethylcellulose , or protamine , sulfate ) and the concentration of macromolecules as well as the methods of incorporation in order to control release . another method to control the duration of action by controlled release preparations is to incorporate the agent into particles of a polymeric material such as polyesters , polyamino acids , hydrogels , poly ( lactic acid ) or ethylene vinyl acetate copolymers . alternatively , instead of incorporating these agents into polymeric particles , it is possible to entrap these materials in microcapsules prepared , for example , by coacervation techniques or by interfacial polymerization , for example , hydroxymethylcellulose or gelatin microcapsules and poly ( methylmethacylate ) microcapsules , respectively , or in colloidal drug delivery systems , for example , liposomes , albumin microspheres , microemulsions , nanoparticles , and nanocapsules or in macroemulsions . the drug - delivery tool and method of the present invention may employ a wide variety of agents , for example , ranging from active compounds to markers to gene therapy compounds . exemplary agents , contemplated for use herein , are set forth in u . s . pat . nos . 5 , 840 , 059 ; 5 , 861 , 397 ; 5 , 846 , 946 ; 5 , 703 , 055 ; 5 , 693 , 622 ; 5 , 589 , 466 ; and 5 , 580 , 859 , each expressly incorporated herein by reference . in one embodiment , for example , the invention is employed to deliver one or more genes ( for example , as so - called “ naked dna ”) into cavities formed in the myocardium of a subject . in appropriate situations , the agent can be delivered in a form that keeps the agent associated with the target tissue for a useful period of time , such as with a viscosity - enhancer to produce a thixotropic gel . in certain embodiments , the therapeutic or diagnostic agent is mixed with a viscous biocompatible polyol to maintain prolonged , high concentration of the agent in the channels and affect the kinetics of the agent - target region interaction . alternatively , a catheter could be employed to deliver an agent incorporated in a biocompatible polymer matrix . suitable polymeric materials are known in the art , for example , as set forth in u . s . pat . no . 5 , 840 , 059 , incorporated herein by reference . for example , non - biodegradable polymers can be employed as hollow reservoirs or other structures . additionally , conventional pharmacologically inert fillers may be employed to tailor the time release characteristics of the agent . certain embodiments contemplate the use of biodegradable polymers , such as collagen , polylactic - polyglycolic acid , and polyanhydride . for example , the agent can be dispersed in a polymer which is configured to degrade over a useful period of time , releasing the agent . in one embodiment , the agent is released by swelling and sloughing of the biodegradable polymer . various means for employing polymer compounds to secure a therapeutic agent are disclosed , for example , in levy et al ., wo 94 / 21237 and in u . s . application ser . no . 08 / 033 , 307 , filed mar . 15 , 1993 , which is hereby incorporated by reference . in still other embodiments , a biocompatible material is delivered to seal and retain the agent within the cavity . for example , a delivery lumen could be employed to deliver a sealing agent after delivery of the agent . those skilled in the art can now appreciate from the foregoing description that the broad teachings of the present invention can be implemented in a variety of forms . therefore , while this invention has been described in connection with particular embodiments and examples thereof , the true scope of the invention should not be so limited . various changes and modification may be made without departing from the scope of the invention , as defined by the appended claims . for example , the expandable members of the tissue - penetrating implement can be configured not to expand , but rather to maintain a substantially constant configuration as it is moved between its retracted and advanced conditions . by this construction , the cage or skeleton structure defined by the expandable members can serve , when inserted into a tissue , to help form a temporary cavity , and maintain the cavity as one or more selected agents are delivered and / or drawn therein . thus , while an expandable member ( as described above ) is advantageous for many purposes , a non - expandable cage or skeleton in place of the previously described expandable member can provide useful advantages , as well .

the present invention provides an drug - delivery tool and method for delivering a selected diagnostic or therapeutic agent to a target site within a selected body tissue , such as the myocardium of the heart . in one embodiment , the drug - delivery tool is configured to be introduced percutaneously for intravascular delivery into temporary cavities formed in the myocardium from the epicardial surface . in another embodiment , the drug - delivery tool is configured for intraoperative use , to be introduced thoracoscopically or through a thoracotomy , to form temporary cavities in the myocardium from the epicardial surface . the drug - delivery tool generally comprises an accessing device having a tissue - penetrating implement in its distal - end region , and means for delivering a selected agent in a cavity formed by the implement . in an exemplary use , wherein a patient &# 39 ; s heart is treated with an agent for transferring genetic information to the heart tissue , the distal end of the accessing device is conditioned adjacent a selected region of the heart wall , and the tissue - penetrating implement is advanced to form a temporary channel in the myocardium . the gene - therapy agent is introduced into the cavity by the delivery means and retained therein by means overcoming the intra - myocardial pressures . in one embodiment , the treated tissue is stunned , ischemic or hibernating organ tissue that has at least partially lost its normal capillary ability at natural vasomotion .

the present invention is directed to the use of core - shell nanoparticles having semiconductor cores of substantially uniform diameter to block selected wavelengths of electromagnetic radiation . the size of the semiconductor cores determines which radiation wavelengths are blocked , while the shell thickness and composition establish the size and surface characteristics of the overall particle . the independent nature of the semiconductor core and the shell allows a particle to be designed to meet specific needs . in one embodiment , a core - shell particle 10 includes a semiconductor core 12 encapsulated by a shell 14 , as shown in fig1 . in another embodiment , a multicore - shell particle 20 includes a plurality of semiconductor core particles 22 encapsulated by a shell 24 , as shown in fig2 . the semiconductor core particles 12 and 22 each have a diameter substantially equal to d , and are composed of silicon , germanium or any other material or combination of materials suitable for blocking transmission of electromagnetic radiation . suitable materials for the semiconductor core 12 or 22 include materials that exhibit the quantum size effect , can be made into core particles of the appropriate size , and block the transmission of radiation of the desired wavelengths . one method of blocking transmission of electromagnetic radiation is by absorption . a suitable material for the semiconductor core 12 or 22 may be tuned to efficiently absorb light below a specified radiation wavelength by adjusting core size or by doping , which is the addition of other materials . the shells 14 and 24 each have an outer diameter d , and are composed of silicon dioxide , silicon nitride , aluminum oxide , titanium oxide or any other suitable material or combination of materials . suitable materials for the shell 14 or 24 include materials that allow at least partial transmission of radiation wavelengths that are absorbed by the cores 12 or 22 ; are inert to air , skin and oils ; prevent or reduce oxygen diffusion into the semiconductor core ; or impart other desirable characteristics in the core - shell particle 10 or 20 . in the multicore - shell particle 20 , each semiconductor core 22 has a protective layer 26 to prevent the semiconductor cores 22 from fusing together to create larger particles . this change in particle size would affect the absorbance spectrum of the particle . the protective layer 26 may be the same material as the exterior shell 24 or other suitable material . suitable materials for the protective layer 26 include materials that prevent the bare surfaces of the semiconductor cores 22 from fusing and allow for agglomeration of the semiconductor cores into clusters . the absorption edge for a single particle is the wavelength of electromagnetic radiation at which absorption by the particle sharply increases . typically a material absorbs all wavelengths of radiation shorter than the critical wavelength defined by the absorption edge . an ideal sunscreen would be one that blocks all harmful uv wavelengths but does not block any visible light . if the sunscreen blocks visible light , the color of the skin can change according to the wavelengths of visible light affected by the sunscreen . therefore , the absorbance spectrum 30 of an ideal sunscreen would resemble a step function , as represented in fig3 . the absorbance spectrum 30 shows complete absorbance of radiation wavelengths corresponding to uvb and uva regions 32 . absorbance edge 34 shows a sharp decline in absorbance around 400 nm , the upper bound of the uva region . the absorbance spectrum 30 shows no absorbance in the visible light region 36 . as set forth below , at small particle sizes , the absorption edge is a function of semiconductor core particle size due to the quantum size effect . if the bulk of the core particles was of substantially uniform size , small amounts of differently - sized particles would not significantly change the absorbance spectrum . however , a sunscreen containing a large distribution of semiconductor core particle sizes has a corresponding distribution of individual absorption edges . this results in an overall spectrum 40 with a gradual decrease in absorbance 42 as radiation wavelength increases , as shown in fig4 . in order to get full protection from uv wavelengths 44 in a sunscreen containing a large distribution of semiconductor core particle sizes , the sunscreen would have to be designed to block out some visible light 46 . such a sunscreen would be cosmetically unacceptable because it would change the color of the skin . for example , if the sunblock absorbed violet and blue light , the skin would appear have a yellowish tint because the absorbed light wavelengths would not be available for reflection by the skin . if the sunblock absorbed all visible light , the skin would appear black . to address this issue , one embodiment of the present invention is a sunscreen comprised of semiconductor core particles of substantially uniform size . when in a dispersed phase , these similarly - sized particles can be referred to as “ monodisperse .” this monodisperse product retains the desired sharp absorption edge of a single semiconductor core particle , so only harmful uv rays are blocked and skin color remains unaffected . fig5 shows the absorbance spectra of si / sio x core - shell nanoparticles grown from a silane / ar reaction in an inductively - coupled plasma . the shell oxide was formed by spontaneous oxidation in ambient conditions . spectra 50 , 52 and 54 show absorbance of radiation by particles deposited on a quartz substrate for 120 , 60 and 30 minutes , respectively . the spectra 50 and 52 show fairly sharp declines in absorbance 56 and 58 , respectively , around 400 nm . the spectra 50 , 52 and 54 all show very little absorption in the visible light region 59 . by selecting a semiconductor core material that both exhibits a quantum size effect and can be made into nanoparticles of uniform size , the core - shell product may have a tunable absorbance spectrum with a sharp cutoff . this is a desirable property for a sunscreen because it completely blocks harmful uv rays without affecting skin color . one advantage of this method over current sunscreen formulations is that in one embodiment only one active ingredient is required to block the entire spectrum of harmful rays . in an embodiment of the invention , the semiconductor core 12 or 22 of the particle 10 or 20 is made of silicon . silicon is the second most abundant element in the earth &# 39 ; s crust . due to the widespread use of silicon in the electronics industry , the requisite precursors and techniques for making nanoparticles are readily available . silicon is a semiconductor , and like all semiconductors , there is a quantum size effect at small particle sizes wherein a deviation from bulk properties occurs . the energy band gap increases as particle size decreases , and there is a corresponding decrease in the radiation wavelengths absorbed . this means that the absorbance spectrum for a silicon nanoparticle may be tuned by adjusting the size of the particle itself . the size of the particle can be changed in several ways . one method is to increase residence time in the reactor to allow the particle to grow larger . another is to oxidize the surface of the particle to reduce the effective size of the core material . still another method of changing particle size is to allow small particles with bare surfaces to cluster together and fuse into a larger particle . a further benefit of using silicon is that any particles released into the environment naturally degrade into silicon dioxide , or sand . the timescale for degradation depends on the thickness and composition of the shell , but oxygen diffusion through any shell will eventually occur . in one embodiment using silicon , the size of the semiconductor core 12 or 22 required to put the absorption edge 34 around the uv - visible light spectrum is a dimension chosen from the approximate range 1 - 5 nm . the preferred semiconductor core size range is between 2 - 4 mm or more specifically , 2 . 5 - 3 . 5 nm . the semiconductor core diameter may be chosen from a range , but all of the semiconductor cores must be substantially uniform in diameter . substantially uniform means that the majority of particles will deviate from the mean diameter by no more than a specified percentage . that percentage ranges from 5 - 25 %. particles of this small length scale may be able to penetrate the skin to cause subcutaneous damage . although silicon itself is inert , the effects of any particles of such small scale are not yet well understood . further , silicon is readily oxidized to silicon dioxide in the presence of oxygen at ambient conditions , so it is impossible to expose skin to bare silicon . the formation of an oxide layer also decreases the effective size of the semiconductor core , thus affecting the absorption edge . to protect the integrity of the semiconductor core 12 or 22 and to increase the size of the overall core - shell particle 10 or 20 to prevent subcutaneous penetration , a shell 14 or 24 is grown to encapsulate the semiconductor core 12 or 22 . in one embodiment , the shell 14 or 24 can be a silicon oxide . silicon oxides are biologically inert and do not trigger skin sensitivity or allergies . also known as silica , it is the principal component of glass and sand , and is even used in food applications as a flow agent for powders . silicon oxides form easily on silicon surfaces . the prevalence of silicon oxide use in the electronics industry has led to the vast availability of both raw materials and techniques for its precise manufacture . in one embodiment , the silicon dioxide shell 14 , 24 or 26 may be grown as large as desired and may be designed to become more or less hydrophilic . it is naturally hydrophilic , which makes it more difficult to penetrate the skin . the surface of the shell 14 or 24 may also be altered by chemical or physical means to provide other desired characteristics . it is therefore possible to make a core - shell particle 10 or 20 with a semiconductor core 12 or 22 of particular size for selective radiation absorption , yet independently change other characteristics of the core - shell particle 10 or 20 by tuning the size and composition of the shell 14 or 24 . the shell 14 or 24 can be of any thickness . in one embodiment , the minimum thickness of a silicon dioxide shell 14 or 24 on a silicon core 12 or 22 is about 5 nm . this is the size at which oxygen diffusion through the silicon dioxide shell 14 or 24 is slow enough that the silicon core 12 or 22 is effectively protected from further oxidation and will therefore remain constant in size over the lifetime of the product . in another embodiment , the shell 14 or 24 is sized such that the core - shell particle 10 or 20 is too large for subcutaneous absorption . the preferred size of core - shell particle 10 or 20 would be between about 40 nm , the size at which particles can no longer be subcutaneously absorbed , and 100 nm , the size at which the particle begins to scatter visible light and create a white or chalky film on the skin . in one embodiment , the core - shell particle 10 or multicore - shell particle 20 may be of a size and surface characteristic such that the core - shell particles 10 or multicore - shell particles 20 spontaneously aggregate in suspension to create core - shell or multicore - shell particle bunches that are large enough to prevent subcutaneous penetration . in such cases , the individual core - shell particles 10 or multicore - shell particles 20 may be as small as 10 nanometers . in one embodiment , the multicore - shell particle 20 may be composed of several semiconductor cores 22 encased within a single shell 24 . this increases the absorption capacity of each multicore - shell particle 20 since there are more radiation - absorbing semiconductor cores 22 per unit volume . however , the effective size of each semiconductor core 22 may remain the same , so the sharp absorption edge 34 is unaffected . one method of making the multicore - shell particles 20 is to make the semiconductor cores 22 , grow a protective layer 26 on each , aggregate the semiconductor cores 22 into small clusters , then finally grow another shell 24 to encapsulate the entire cluster . a protective layer 26 is grown on each semiconductor core 22 to prevent them from fusing to form larger particles , which would affect the absorption characteristics . the size of the overall multicore - shell particle 20 , established by the size of the cluster and the thickness of the final shell 24 , determines whether it can be subcutaneously absorbed or form a chalky residue on the skin . the number of semiconductor cores 22 in the multicore - shell particle 20 is limited by the number of semiconductors 22 that can physically fit within the specified size of the multicore - shell particle 20 . there may be as few as two semiconductor cores 22 within the shell 24 to create a multicore - shell particle 20 . the final shell 24 may be adjusted to impart different surface characteristics in the overall multicore - shell particle 20 . one embodiment of the invention is a process for creating silicon core particles 12 or 22 with a narrow size distribution . one method for producing silicon core particles 12 or 22 of substantially uniform size is in a plasma reactor using silane gas ( sih 4 ) in an aerosol reaction . in one embodiment of this invention , the reactor consists of a quartz tube 1 ″ in diameter and 6 ″ in length , wrapped with an inductive coil and mechanically pumped down to a pressure of 100 mtorr . the coil is used to deliver 100 w of power through a matched network to an inductively coupled plasma formed inside the tube . 20 ppm of silane in argon serves as the precursor to particle formation and is passed through the tube . alternate reaction parameters include increasing the quartz tube up to 4 ″ in diameter , increasing the operating pressure up to 10 torr , increasing power inputs ranging up to 2000 w , and increasing precursor concentration up to 4 % silane in argon . there are several ways to grow an encapsulating layer 14 , 24 or 26 , such as an oxide layer on a semiconductor material . the choice of method may affect the properties of the oxide . one method for silicon is natural oxidation . silicon is highly reactive with oxygen at ambient conditions , and an oxide layer up to about 5 nm thick will spontaneously form on a silicon surface . the rate of oxidation increases exponentially with temperature according to kinetic rate laws and . increasing oxygen concentration also increases the oxidation rate . oxygen diffuses through each subsequently formed silicon dioxide layer to react with the silicon beneath . however , this native oxide layer 14 or 26 is formed out of the silicon base itself , and therefore reduces the size of the silicon core 12 or 22 . one could design this into the process by starting with a semiconductor core 12 or 22 slightly larger than the size required for the desired absorption edge , such that subsequent conversion of semiconductor into an oxide would reduce the semiconductor core 12 or 22 to the intended size . but a remaining disadvantage of this process is that the native oxide layer 14 or 26 cannot be greater than about 5 nm thick . diffusion of oxygen through an oxide layer of that thickness is slow enough that it would be impractical to grow a thicker layer by this method . in order to grow a silicon oxide layer thicker than 5 nm , one must employ a different technique . shell 14 , 24 or 26 overgrowth may be accomplished in a reactor using either tetraethyl orthosilicate ( teos , si ( och 2 ch 3 ) 4 ) or a mixture of silane and oxygen ( sih 4 + o 2 ). the reactor for either technique may be a quartz tube in a furnace or a plasma gas reactor . jet injection / turbulent mixing of the precursor , either teos or oxygen , will lead to more uniform oxide growth . silicon oxidation may also be carried out with molecular oxygen ( o 2 ). the shell 14 , 24 or 26 produced by this method may be up to 20 nm thick . agglomeration of particles will occur spontaneously because of the small scale . to control to size of the clusters formed , it is crucial to control the residence time in the agglomeration zone of the reactor . residence time will depend upon particle concentration , particle size , particle size distribution , gas pressure and gas temperature . temperature and particle concentration may also be used to control the size of the clusters formed . increasing temperature , particle concentration and particle size distribution leads to faster agglomeration while decreasing gas pressure increases agglomeration for the particle size of interest . as particles emerging from a plasma are usually charged , a corona discharge or charge neutralization source may be necessary in this zone to enable particle agglomeration . in one embodiment of the invention as shown in fig6 , a reactor used to produce core - shell particles 10 includes a ) a short reaction zone for forming monodisperse semiconductor cores 12 and b ) a shell 14 overgrowth zone to accomplish the desired final size . the zones may be either separate regions of a single reactor or separated into distinct reactors . those with ordinary skill in the field will understand that permutations of this scheme are possible and that some characterization , adjustments and calibration are required to get the desired result . in one embodiment of the invention as shown in fig7 , a reactor used to produce multicore - shell particles 20 includes a ) a short reaction zone for forming monodisperse semiconductor cores 22 , b ) a zone for growing a protective layer 26 around each semiconductor core , c ) an adjustable afterglow zone to permit controlled agglomeration of particles into clusters and d ) a shell 24 overgrowth zone to accomplish the desired final size . the zones may be either separate regions of a single reactor or separated into distinct reactors . those with ordinary skill in the field will understand that permutations of this scheme are possible and that some characterization , adjustments and calibration are required to get the desired result .

a plurality of particles for blocking electromagnetic radiation wherein each particle includes at least one semiconductor core encased within a shell , the semiconductor cores being of substantially uniform diameter , which diameter is selected according to the quantum size effect such that radiation incident on the particles is absorbed below a preselected radiation wavelength . in particular embodiments , the diameter may not vary between cores by more than a preselected percentage , and the diameter may fall within the range of approximately one to approximately five nanometers . each particle may have a single semiconductor core surrounded by a single shell or a plurality of semiconductor particles surrounded by a single shell . in other embodiments , the particles may be created by forming at least one semiconductor core in a first reaction zone and forming a shell encapsulating the at least one semiconductor core in a second reaction zone . a plurality of semiconductor cores may optionally be agglomerated together before the shell is formed .

in representative embodiments of the invention as disclosed herein , whole grain baked products and related whole grain products are comprised of recombined whole grain flour . representative embodiments of recombined whole grain flour comprise individually milled and recombined portions of endosperm , bran and germ , wherein the bran portion and / or germ portions are milled to have particle sizes within a desired particle size range wherein the desired particle size range has been found to minimize the visual and color impact of the bran and / or germ within the recombined whole grain flour . in some embodiments , the bran and / or germ portions can be milled to have particle sizes from about 0 . 006 inches to about 0 . 017 inches . in another representative embodiment , the bran and / or germ portions can be milled to have particle sizes from about 0 . 007 inches to about 0 . 015 inches . an embodiment of the whole grain baked products and related products can be formulated such that the recombined whole grain flour comprises from about 0 . 1 % to about 100 % of the farinaceous content . in another alternative embodiment , the whole grain baked products and related products can be formulated such that recombined whole grain baked products can comprise a good source of whole grain providing at least 8 grams of whole grain per serving . in another alternative embodiment , the whole grain baked products and related products can be formulated , such that , the recombined whole grain baked products comprise an excellent source of whole grain providing at least 16 grams of whole grain per serving . as illustrated in fig1 , a grain kernel 100 comprises a hard outer shell called bran 102 , a nutrient - rich core called germ 104 and an interior starch portion called endosperm 106 . grain kernel 100 is representative of differing grain varieties , such as , for example , wheat kernels ( including spring and winter wheat , as well as , varieties including red , white , spelt , emmer , faro , einkorn , kamutg , and durum ), amaranth , barley , buckwheat , corn ( including whole cornmeal and popcorn ), millet , oats , quinoa , rice ( including brown and colored rice ), rye , sorghum , teff , triticale and wild rice . when grain kernel 100 comprises a wheat kernel , bran 102 generally comprises about 14 . 5 % by weight of the kernel , germ 104 generally comprises about 2 . 5 % by weight of the kernel and endosperm 106 generally comprises the balance or about 83 % by weight of the kernel . as will be understood by one of skill in the art , the amounts of bran 102 , germ 104 and endosperm 106 will vary according to the grain type . in a conventional milling operation 108 as schematically illustrated in fig2 , grain kernel 100 can be milled to form refined flour 110 . in its most basic form , milling operation 108 can comprise a grain cleaning step 112 , a grain conditioning step 114 , a grain grinding step 116 , a grain sifting step 118 and a grain purifying step 120 . when making refined flour 110 , grain purifying step 120 is followed by a bleaching step 122 and an enrichment step 124 . within grain cleaning step 112 , a variety of processes can be utilized to separate the grain from foreign materials . representative cleaning techniques can comprise the use of magnetic separators , vibratory screens , air aspirators , de - stoning machines , disc separators , scourers , used individually or in suitable combinations . within grain conditioning step 114 , a variety of processes can be utilized to prepare the grain for grinding . representative conditioning processes can include a tempering process and an impact scouring step , applied individually or in combination . within grain grinding step 116 , grain kernel 100 is gradually reduced to a smaller , desired flour size by passing size graded kernels and middlings through rollers adjusted to break the grain kernel 100 into the bran 102 , germ 104 and endosperm 106 . representative roller adjustments can include roller positioning , roller speed and selection of the rolling surface . within grain sifting step 118 , the ground bran 102 , germ 104 and endosperm 106 can be shaken and separated within a series of box - like sifters having screens with openings that get sequentially smaller and smaller . generally , large particles are shaken and removed from a top sifter while the finest particles or flour sift to the bottom . within grain purifying step 120 , the ground bran 102 is lifted and separated from germ 104 and endosperm 106 by a controlled air stream . the remaining germ 104 and endosperm 106 can then be passed through a series of break rolls wherein germ 104 is flattened for easier separation and the endosperm 106 is ground into flour . within bleaching step 122 , the flour consisting essentially of ground endosperm 106 is exposed to a bleaching - maturing agent , such as , for example , chlorine gas or benzoyl peroxide , to both whiten the flour and mature or oxidize the flour to improve the baking characteristics of the flour . within enrichment step 124 , a measured quantity of enrichment components , such as , for example , thiamin , niacin , riboflavin , iron , folic acid , leavening agent , salt and calcium , are added to the whitened / matured flour . in a whole grain milling operation 126 as schematically illustrated in fig3 , grain kernel 100 can be milled to form whole grain flour 128 . whole grain milling operation 126 similarly comprises grain cleaning step 112 , grain conditioning step 114 , grain grinding step 116 , grain sifting step 118 and grain purifying step 120 . following grain purifying step 120 , a reconstituting step 130 blends back the separated portions of the grain kernel 100 , for example , the milled bran , germ and endosperm to form whole grain flour 128 . through the use of reconstituting step 130 , whole grain flour 128 can be stabilized . in addition , whole grain milling operation 126 can comprise one or more heat treating steps so as to further stabilize the bran and / or germ . when milled with whole grain milling operation 126 , whole gain flour 128 includes visual particulate matter that is viewable and distinguishable by an unassisted eye in baked products made with the whole grain flour 128 due to color differences between the bran 102 , germ 104 and endosperm 106 . to the consumer , the presence of visual particulate matter within a final baked product can be less preferred than the generally visually homogenous appearance of baked products made with refined flour 110 . as illustrated in fig4 , a milling recombination process 132 of the invention for milling grain kernel 100 to form a substantially visually homogenous whole grain flour 134 resembles whole grain milling operation 126 with the further inclusion of a particulate grinding step 136 . within particulate grinding step 136 , bran 102 and germ 104 which , generally comprise the visually distinguishable particulate matter in whole grain flour 128 , are ground to a desired particle size that has been surprisingly found to provide a visually indistinguishable homogenous appearance when viewed with the unassisted eyed to baked products made with whole grain flour 134 . more specifically , bran 102 and germ 104 are milled in the particulate grinding step 136 so as to have a selected particle size in a range from about 0 . 006 inches to about 0 . 017 inches , which has been surprisingly found to limit the unassisted eye to distinguish bran 102 and germ 104 from the background of the majority milled endosperm 106 . more preferably , bran 102 and germ 104 can be milled to have particle sizes ranging from about 0 . 007 inches to about 0 . 015 inches . referring to table 1 below , milling recombination process 132 was simulated on a conventional red wheat grain to confirm particle size ranges for bran 102 that provided a grain flour and resulting baked product in which the bran 102 is visually indistinguishable from the majority endosperm 106 background . as illustrated in table 1 , milling recombination process 132 was simulated using 6 different particle ranges for bran 102 , with the resulting flour and baked products being compared against one another in addition to being compared with conventional milled non - whole red wheat brans . each sample was individually evaluated with respect to the color or “ lightness ” of the bread produced with the different bran particle sizes . for many consumers , particularly children , lightness is generally associated with taste and a light or white - like appearance for the internal crumb is generally preferred . the internal crumb color of breads can be objectively measured using standard techniques known to one in the art such as , for example , using a minolta chroma meter available from the minolta corporation of ramsey , n . j ., to measure the reflective color of a surface . using the minolta chroma meter , the appearance of the different bread products were measured using the l * a * b color scale , wherein “ l *” corresponds to a lightness measurement based on a black to white scale , “ a *” corresponds to measurements on a red to green scale and “ b *” corresponds to measurements on a blue to yellow scale . generally , it has been found that bread products having increased “ l *” measurements , reduced “ a *” measurements and increased “ b *” measurements are most preferred as consumers tend to associate such readings with conventional white breads . in addition to measuring crumb color , each of the breads products was visually compared using an unassisted eye to compare the various bran particle size ranges with respect to visibility of the bran particles against the crumb ( milled endosperm and germ ) background . in comparing bran visibility against the crumb background , it was determined that the bread products prepared from recombined flour having bran particles milled to a range of 0 . 006 inches to 0 . 017 inches had the least amount of visible contrast between the bran particles and the crumb without adversely affecting background color . in some embodiments , milling recombination process 132 can further comprise a bran fortification step 138 and / or a germ fortification step 140 as illustrated in fig4 for forming a bran fortified whole grain flour 142 , a germ fortified whole grain flour 144 or a bran and germ fortified whole grain flour 146 . in milling recombination process 132 , bran 102 and / or germ 104 that has been milled to the desired advantageous particle size range can be added to the endosperm 106 in amounts exceeding the typical amounts of bran 102 and / or germ 104 found in the grain kernel 100 , such as , for example , adding bran 102 such that the amount of bran 102 in whole grain flour 134 exceeds 14 . 5 % by weight of a whole wheat flour made according to the milling recombination process 132 . accordingly , germ 104 can be added in amounts such that germ 104 exceeds 2 . 5 % by weight of a whole wheat flour made according to the milling recombination process 132 . whole grain flour 134 can be used within a variety of baked products and related products . for example , whole grain flour 134 can be used in the preparation of whole grain baked products , such as , for example , breads and whole grain biscuits having cross - sectional slices displaying a consistent , homogeneous color and visual appearance . in another example , whole grain flour 134 can be used in baking kits , such as , anhydrous mixes requiring the addition of wet ingredients , such as , for example , water , oil , eggs the like , or in bulk concentrate mixes or premixes requiring additional bulk ingredients prior to baking . whole grain flour 134 can be used in preparing baking dough , such as , frozen dough , refrigerated dough and fresh dough . whole grain flour 134 can also be used in the preparation of partially - baked or “ par - baked ” products that require baking to completion prior to consumption . in addition , whole grain flour 134 can be used in the preparation of “ stiff ” dough for use in crackers and pretzels . while the use of whole grain flour 134 is specifically described , it will be understood that bran fortified whole grain flour 142 , germ fortified whole grain flour 144 and bran and germ fortified whole grain flour 146 can be utilized instead of or in conjunction with whole grain flour 134 . as described throughout the specification , the attainment of certain dough characteristics are more important in some doughs than in others , and depend largely on the intended end use of the dough product . it will be understood that the term dough as used through the present specification applies equally to refrigerated , raw dough products that are formed as either a developed dough or an undeveloped dough . developed dough is that in which a protein or gluten network has been more or less fully formed or created . representative examples of developed doughs can include dough for breads , bagels , croissants or rolls . undeveloped dough is that in which , the gluten network is not fully developed . one representative example of an undeveloped dough is biscuit dough and batters . dough formulations , and the ingredients they contain , can differ depending on the finished product that is obtained from the dough . however , most doughs generally have a number of ingredients in common and examples of some such common ingredients are described and illustrated in more detail below . the dough formulation and products as described herein , generally contain an amount of whole grain flour 134 constituent that contributes to the structure of the dough . the whole grain flour 134 provides the dietary benefits associated with consumption of whole grains . as described herein , whole grain baked products , mixes and dough , as contemplated by the present disclosure comprise at least about 15 % whole grain flour 134 within the flour constituent . in some contemplated embodiments , whole grain baked products , mixes and dough can comprise at least about 30 % whole grain flour 134 within the flour constituent . in some embodiments , whole grain baked products can comprise substantially all , or greater than about 90 %, whole grain flour 134 within the flour constituent . in some embodiments , whole grain flour 134 can be utilized in conjunction with other suitable whole grain flour , such as , for example , durum whole grain flour , or alternatively , with refined flour 110 . whole grain dough compositions comprised of whole grain flour 134 , as described herein , can be caused to expand ( leaven ) by any leavening mechanism , such as , by one or more of the effects of : entrapped gas , such as , entrapped carbon dioxide , entrapped air , or both ; a laminated dough structure ; by action of chemical leavening agents ; or by action of a biological agent , such as , a yeast . thus , a leavening agent may be an entrapped gas , such as , layers or cells ( bubbles ) that contain carbon dioxide , water vapor , or air , etc ., any type of yeast ( e . g ., cake yeast , cream yeast , dry yeast , etc . ); or a chemical leavening system , e . g ., containing a basic chemical leavening agent and an acidic chemical leavening agent that react to form a leavening gas , such as , carbon dioxide . examples of acidic chemical leavening agents are generally known in the dough and baking arts , with examples including sodium aluminum phosphate ( salp ), sodium acid pyrophosphate ( sapp ), monosodium phosphate , monocalcium phosphate monohydrate ( mcp ), anhydrous monocalcium phosphate ( amcp ), dicalcium phosphate dihydrate ( dcpd ), glucono - delta - lactone ( gdl ), as well as , a variety of others . optionally , an acidic chemical leavening agent for use according to the invention , can be encapsulated . examples of basic chemical leavening agents include many that are generally known in the dough and baking arts , such as , soda , i . e ., sodium bicarbonate ( nahco 3 ), potassium bicarbonate ( khco 3 ), ammonium bicarbonate ( nh 4 hco 3 ), etc . a basic chemical leavening agent may also be encapsulated , if desired . the evolution of carbon dioxide essentially follows the stoichiometry of typical acid - base reactions . the amount of leavening base present determines the amount of carbon dioxide evolved , whereas the type of leavening acid affects the speed at which the carbon dioxide is liberated . the amount of leavening base used in combination with the leavening acid can be balanced , such that a minimum of unchanged reactants remain in the finished product . an excess amount of leavening base can impart a bitter flavor to the final product , while excess leavening acid can make the baked product tart . yeast is also utilized for leavening baked goods , and is often preferred because of the desirable flavor it imparts to the dough . baker &# 39 ; s yeast is generally supplied in three forms : yeast cream , a thick suspension with about 17 % solids ; a moist press cake with about 30 % solids ; and an active dry yeast , with about 93 to 98 % solids . generally , active dry yeasts of acceptable quality have been available for some time , and recently instant active dry yeast has also been available for commercial use . the quantity of yeast added to dough is directly related to the time required for fermentation , and the form of the yeast utilized . generally , most bread doughs are made with from about 2 to 3 % fresh compressed yeast , based on the amount of flour . whole grain dough comprising whole grain flour 134 as described herein can also contain additional functional ingredients . some such additional ingredients can be used to modify the texture of the whole grain dough . texture modifying agents can improve many properties of the dough , such as , viscoelastic properties , plasticity , or dough development . examples of texture modifying agents include fats , emulsifiers , enzymes , hydrocolloids , and the like . shortening helps to improve the volume , grain and texture of the final product . shortening also has a tenderizing effect and improves overall palatability and flavor of a baked good . either natural shortenings , animal or vegetable , or synthetic shortenings can be used . generally , shortening is comprised of triglycerides , fats and fatty oils made predominantly of triesters of glycerol with fatty acids . fats and fatty oils useful in producing shortening include cotton seed oil , ground nut oil , soybean oil , sunflower oil , rapeseed oil , sesame oil , olive oil , corn oil , safflower oil , palm oil , palm kernel oil , coconut oil , or combinations thereof . emulsifiers include nonionic , anionic , and / or cationic surfactants that can be used to influence the texture and homogeneity of a dough mixture , increase dough stability , improve eating quality , and prolong palatability . emulsifiers include compounds , such as , lecithin , mono - and diglycerides of fatty acids , propylene glycol mono - and diesters of fatty acids , glyceryl - lacto esters of fatty acids , and ethoxylated mono - and diglycerides . hydrocolloids are added to dough formulations to increase moisture content , and to improve viscoelastic properties of the dough and the crumb texture of the final product . hydrocolloids function both by stabilizing small air cells within the batter and by binding to moisture within the dough . hydrocolloids include compounds , such as , xanthan gum , guar gum , and locust bean gum . dough - developing agents can also be added to the system to increase dough viscosity , texture and plasticity . any number of agents known to those of skill in the art may be used including azodicarbonamide , diacetyl tartaric acid ester of mono - and diglycerides ( datem ) and potassium sorbate . another example of a dough - developing additive is protase ™. protase ™ is a proprietary product containing enzymes and other dough conditioners . protase ™ is generally used to reduce mixing time and improve machinability . a double strength version , protase 2x ™, is commercially obtained from j . r . short milling co . ( chicago , ill .). dough conditioners are also examples of dough additives . one example of a dough conditioner is nubake ™, commercially available from ribus ( st . louis , mo .). another example of a dough conditioner is l - cysteine , commercially available from b . f . goodrich ( cincinnati , ohio ). dough can also frequently contain nutritional supplements , such as , vitamins , minerals and proteins , for example . examples of specific nutritional supplements include thiamin , riboflavin , niacin , iron , calcium , or mixtures thereof . dough can also include flavorings , such as , sweeteners , spices , and specific flavorings , such as , bread or butter flavoring . sweeteners include regular and high fructose corn syrup , sucrose ( cane or beet sugar ), and dextrose , as well a bake stable non - nutritive sweeteners such as sucralose , for example . in addition to flavoring the baked good , sweeteners , such as , sugar can increase the moisture retention of a baked good , thereby increasing its tenderness . dough can also include preservatives and mold inhibitors , such as , sodium salts of propionic or sorbic encapsulated acids , sodium diacetate , vinegar , monocalcium phosphate , lactic acid and mixtures thereof . preparation of whole grain products can be accomplished using traditional mixing methods to form a whole grain dough from whole grain flour 134 . generally , the whole grain flour 134 can be combined with various wet ingredients , such as , for example , water , oil , eggs and milk , using traditional mixers and mixing methods . for example , whole grain flour 134 can be combined with suitable wet ingredients using any standard mixing technology , such as , for example , a standard horizontal bar mixer or a paddle mixer available from the hobart corporation of troy , ohio . whole grain bread dough , as used herein , can comprise a variety of formulations wherein the flour portion of the bread dough can solely comprise a single variety of whole grain flour 134 or can comprise various combinations of whole grain flour 134 , such as , for example , whole grain wheat flour and whole grain durum flour . alternatively , refined flour 110 can also be combined with whole grain flour 134 . in some embodiments , a whole grain bread dough can be classified as a “ good source ,” wherein the whole grain bread dough is formulated so as to provide 8 grams of whole grain per serving ( generally considered 2 slices or 50 grams of bread ). in some embodiments , a whole grain bread dough can be classified as an “ excellent source ,” wherein the whole grain bread dough is formulated so as to provide 16 grams of whole grain per serving . in some embodiments , a whole grain bread dough can be classified as a “ 100 % whole grain ,” wherein the whole grain bread dough is formulated such that the flour portion of the bread dough solely comprises whole grain flour 134 . as the percentage of whole grain flour 134 increases in a bread dough , vital wheat gluten can be added in an effective amount so as to improve the bake qualities of a whole grain bread including increasing the baked specific volume ( bsv ) of the whole grain bread . bsv is a term of art in the industry that defines the inverse of density or fluffiness of a baked good , and is simply the volume of the baked product divided by its weight . for bread products , bsv is frequently used as an objective measurement for non - sliced or artisan breads . generally , a baked good is considered to have an acceptable bsv when the baked good doubles in size during baking from a raw dough to a baked dough product . more specifically , a traditionally accepted bsv for traditional white bread generally exceeds about 3 . 0 cc / g . as such , effective amounts of vital wheat gluten for use with whole grain bread dough will achieve baked whole grain breads having a bsv exceeding about 3 . 0 cc / g . adding vital wheat gluten to a mixture comprising whole grain flour 134 compensates for whole grain baking characteristics , which can inhibit achieving desired baked good characteristics . in addition to formulating whole grain bread dough with an effective amount of vital wheat gluten , effective amounts of vital wheat gluten can be added to baking mixes , either complete mixes or concentrated mixes or premixes , such that a user experiences the same baking performance as traditional mixes or mixtures based upon refined flour 110 . in addition to use in the preparation of whole grain breads , whole grain flour 134 can be similarly employed for use in whole grain baking mixes for preparing whole grain baked products . these whole grain mixes can comprise a complete anhydrous mix requiring the addition of a liquid , such as , for example , water , oil , eggs and / or milk , or a concentrate mix requiring additional bulk ingredients , as well as , liquid ingredients , at a time of preparation . a complete mix is generally considered a mix in which all of the dry ingredients necessary for preparing a dough are present in the mix , including the flour portion . a concentrate mix or premix is generally considered a mix including one or more key functional ingredients but still requiring addition of one or more bulk ingredients . at time of use , bulk ingredients , such as , for example , a bulk whole grain flour portion and / or vital wheat gluten can be added to the concentrate mix or premix . depending upon the application and the end user , representative whole grain baking mixes , including whole grain flour 134 can be provided at varying levels of completeness between the concentrate mix and the complete mix . key functional ingredients can comprise one or more of dough conditioners , hydrocolloids , protein sources , oxidizers , mold inhibitors , salt , and nutrients blended with flour , used to provide specific attributes to a finished baked product . representative dough conditioners can comprise datem , enzymes , sodium stearoyl lactylate and monoglycerides . representative hydrocolloids can comprise guar gum . representative protein sources can comprise vital wheat gluten . representative oxidizers can comprise ascorbic acid and azodicarbonamide . representative mold inhibitors can comprise calcium propionate . representative whole grain baking premixes can comprise effective amounts of functional ingredients , such as , for example , vital wheat gluten , dough conditioners , emulsifiers , preservatives , salt , nutrients and the like , blended with whole grain flour other whole grain ingredients . whole grain bread dough mixes , either complete mixes or concentrated mixes or premixes , can include functional ingredients such that whole grain breads made from the mix and whole grain flour 134 achieve a bsv of at least about 2 . 5 cc / g and / or a slice height of at least about 4 . 0 inches . alternatively , other whole grain products based on whole grain flour 134 and milled whole grain mixes , either complete mixes or concentrated mixes or premixes , can be specifically tailored to provide desirable characteristics to other baked products such as , for example , cookie spread for whole grain cookie mixes , slice height and cell structure for whole grain cake mixes , spread and height for whole grain pancakes . further characteristics that can be tailored can include , for example , appropriate bake performance for other whole grain flour 134 based mixes including pizza crust mixes , brownie mixes , muffin mixes and variety baking mixes such as , for example , bisquick ® mix . six different breads were formulated and prepared for visual comparison by experienced observers . three of the breads were formulated using whole grain flour 134 while the remaining three breads were used as test controls and did not undergo milling recombination process 132 . the bread types used for testing were as listed in table 2 . experienced observers viewed and rated the sample breads based on appearance characteristics including : overall appearance , color and amount of visible particulate flecks . in addition , consumers were asked to consider how each bread sample fit the concept of a visually appealing whole grain bread , whether they were likely to purchase the sample breads and whether or not they felt their children would eat the sample breads . results of the experienced observer consumer rankings are summarized in table 3 . experienced observer responses indicated that the reviewers did perceive visual distinctions among the bread samples . the recombined red whole wheat bread ( sample 1 ) having red wheat milled using milling recombination process 132 was liked best for overall appearance , color and amount of grain fleck liking . for concept fit and purchase intent after visual , the recombined red whole wheat bread received higher ratings than the recombined white whole wheat bread ( sample 2 ) and the recombined durum whole wheat bread ( sample 3 ) and had significantly higher ratings than the remaining bread samples . the white wheat ultra fine bread was liked consistently less than the other whole grain breads . as indicated in the consumer testing , milling recombination process 132 can be used successfully to recombine whole wheat flour having bran and germ milled within a desirable particle size range so as to prepare visually acceptable whole grain baked products . milling bran and germ to a desirable particle size range was more visually acceptable than flour having the bran and germ milled to ultra fine particle sizes . although various embodiments of the present invention have been disclosed here for purposes of illustration , it should be understood that a variety of changes , modifications and substitutions may be incorporated without departing from either the spirit or scope of the present invention .

a recombined whole grain flour for use in preparing whole grain products such that whole grain particulates provide minimal visual impact to the whole grain product . by selectively controlling the particle size of the milled bran and germ constituents used in the recombined whole grain flour , the visual and color impact associated with bran and germ particulates can be substantially eliminated from the whole grain product . in particular , whole grain products such as whole grain breads , dough products , mixes and biscuits can be made with recombined whole grain flour . whole grain products made with recombined whole grain flour are advantageous in that they incorporate the health advantages associated with whole grains while eliminating the characteristic , visual color differences noticeable within a whole grain crumb due to visually identifiable bran and germ particulates found in traditional whole grain products .

the above claimed priority application is hereby incorporated in this application by reference . the device 8 shown in fig1 is a manually - operated weed removal tool . a frame 10 has a central bore 11 formed through the center thereof , thereby defining the frame as a tubular body . the frame 10 is preferably circular in cross section , but can be rectangular , triangular , u - shaped or irregularly shaped . unless described otherwise the frame 10 and all other components are made of steel . of course , aluminum , plastic , fiber - reinforced polymer composite and other suitable materials can be substituted for steel , as will become apparent from the description herein to a person having ordinary skill . a central rod 12 extends slidably through the bore 11 and exits at the top through a narrow opening near a handle 18 as shown in fig2 and 3 . the rod 12 exits at the bottom of the frame 10 through a narrow opening at the base portion 14 as shown in fig4 , and attaches to the disk 20 as described in more detail below . the terms “ top ”, “ bottom ”, “ upper ”, “ lower ” and similar terms are used in relation to the orientation of the device 8 as shown in fig1 . of course , the device 8 can be used in different orientations than that shown in fig1 , and the person of ordinary skill will understand that the terms used herein transfer to the components in those different orientations . as shown in fig2 and 3 , a cap 13 fastens , such as by screwing onto a threaded tip ( not visible ) of the rod 12 . the cap 13 permits a user to readily push and pull on the top end of the rod 12 as needed . multiple substantially v - shaped indentations 30 are formed in one side of the rod 12 near the top end . each of the indentations 30 can receive a distal end of a tab 32 . the tab 32 is formed at the interior edge of a trigger 34 that is preferably spring - loaded toward the rod 12 by a bias , such as the coil spring 36 . the coil spring 36 may be replaced , as will be understood by the person having ordinary skill , by a leaf spring , an elastomeric spring , a pneumatic spring , a magnetic spring or any other equivalent structure that tends to force the tab 32 toward the rod 12 . the trigger 34 is mounted to the frame 10 , such as through a bracket 38 welded to the opposite side of the frame 10 as the handle 18 , to rotate relatively freely about the pivot 35 , which is preferably a hinge . this configuration permits a person grasping the handle 18 to pivot the trigger 34 with one or more fingers toward or away from the rod 12 . the tab 32 can insert into the deepest or lowest region of one of the indentations 30 when the tab and the cooperating indentation 30 are aligned , or the tab 32 can rest against the surface of the rod 12 between the lowest regions of adjacent indentations 30 . regardless of whether the tab 32 and the lowest regions of an indentation are aligned , because of the angle of the tab 32 and the surfaces of the rod &# 39 ; s indentations 30 , the tab 32 preferably presents little to no resistance to upward movement of the rod 12 relative to the frame 10 ( which can likewise be referred to as “ downward movement of the frame 10 relative to the rod 12 ”). this is because the preferred embodiment forms a ratchet mechanism in which the indentations 30 are asymmetrical and define spaces between gear teeth and the tab 32 serves as a pawl . thus , relative movement in one direction is not resisted significantly by the ratchet mechanism . with regard to downward ( opposite ) movement of the rod 12 relative to the frame 10 , when there is not alignment of the tab 32 with the lowest region of an indentation , the tab 32 is biased by the spring 36 against the surface of the rod 12 adjacent the lowest region of one of the indentations 30 , and merely rests against the smooth surface . under these conditions , the tab 32 does not resist downward movement of the rod 12 . downward movement of the rod 12 is permitted until the tab 32 is seated in the lowest region of an indentation 30 . during normal use , upon insertion of the tab 32 into the lowest region of one of the indentations 30 , the rod 12 is prevented from moving downward relative to the frame 10 until the tab 32 is removed from the indentation or the rod 12 is moved upwardly relative to the frame 10 . thus , when the tab 32 is in the lowest region of an indentation , the rod 12 cannot move downwardly relative to the frame 10 , and when the tab 32 is not in the lowest region of an indentation , the rod 12 is able to move downwardly relative to the frame 10 until the lowest region is reached . the coil spring 36 biases the tab 32 toward the rod 12 , but the bias can be overcome by an average human grasping the trigger 34 . the tab 32 may thus be pivoted away from the rod 12 by a finger - graspable portion of the trigger 34 that mounts below the handle 18 as shown in fig2 and 3 . the finger - graspable portion of the trigger 34 is preferably grasped by an operator whose hand is around the handle 18 , and whose finger or fingers extend beneath the trigger 34 . the trigger 34 therefore can be displaced upwardly toward the handle 18 in the manner of a trigger of a typical firearm . when this occurs with sufficient force , the tab 32 withdraws from any indentation 30 in which the tab 32 is positioned , and the rod 12 is able to move downwardly relative to the frame 10 . as shown in fig4 - 5 , an upper end of the foot pedal 16 mounts rigidly to the lower end of the frame 10 , such as by welding . the foot pedal 16 permits a user to press downwardly with substantial force on the device 8 with a foot on the top of the foot pedal 16 . this downward force is typically applied when the base portion 14 rests on the soil around a weed . as shown in fig1 and 4 , a lower disk 20 that can be about two inches in diameter is rigidly mounted to the lower end of the rod 12 , such as by welding . this disk 20 increases the effective surface area of the end of the rod 12 so that upon a user pressing the base portion 14 against the ground , such as when the frame 10 is perpendicular to the surface of the ground , the disk 20 and attached rod 12 do not substantially penetrate the soil , and thus stay at the same point on the ground while the frame 10 and its associated components are driven downwardly relative to the substantially stationary rod 12 . as shown in fig4 - 7 , a coil spring 42 within the bore 11 of the frame 10 surrounds the lower end of the rod 12 . the spring 42 can be a 12 - 15 pound , one - half inch outer diameter coil spring that is approximately four inches long when relaxed . of course , other spring sizes , types and weights can be used under different circumstances . one end of the coil spring 42 seats against a pin 44 closer to the upper end of the rod 12 , and the opposite end of the spring 42 seats against a ferrule 40 ( see fig6 - 7 ) near the lower end of the rod 12 . the pin 44 is rigidly mounted to the frame 10 , and the rod 12 can bypass the pin 44 . the rod 12 slidably extends through an opening between the two ends of the pin 44 . the spring 42 cannot bypass the pin 44 but is compressed against the pin 44 . the ferrule 40 is rigidly mounted to the rod 12 , and seats against the flange 70 when the coil spring 42 is expanded ( see fig6 ). as the rod 12 moves upwardly relative to the frame 10 , the ferrule 40 moves upwardly away from the flange 70 with the rod 12 ( see fig7 ) and causes compression of the spring 42 between the ferrule 40 and the pin 44 . the ferrule 40 provides an opposing surface against which the spring &# 39 ; s 42 lower end abuts and a mechanical stop to prevent the rod 12 from traveling in the downward direction out of the frame 10 when the trigger releases the rod 12 . the preferred spring 42 provides a resistive force against movement of the rod 12 upwardly relative to the frame 10 . upon relative upward movement of the rod 12 by overcoming the spring force ( typically caused by placing the operator &# 39 ; s foot on the pedal 16 ), the spring 42 compresses to store potential energy . upward movement of the rod 12 corresponds to compression of the spring 42 against the lower face of the pin 44 , and downward movement of the rod 12 relative to the frame 10 corresponds to expansion of the spring 42 . because the pin 44 is rigidly affixed to the wall of the frame 10 , the pin 44 provides a rigid base for the force of the spring 42 to push against to move the rod 12 downwardly relative to the frame 10 after the rod 12 is released when the spring 42 is compressed . as shown in fig4 , a preferably l - shaped bracket 48 is rigidly attached to one side of the lower disk 20 . the upper leg of the bracket 48 extends upwardly through a guide slot 51 ( see fig5 ), preferably formed at one end of the upper disk 50 , and into a void formed between the sidewalls of the support 46 for the foot pedal 16 . the bracket 48 is rigidly mounted to the lower disk 20 and is guided by the sidewalls of the support 46 and the slot 51 in the upper disk 50 , which upper disk 50 is rigidly mounted to the frame 10 . because the bracket 48 is so retained , the rod 12 cannot rotate substantially , such as when the rod 12 is moving up or down relative to the frame 10 . the flange 70 ( fig4 ) is substantially the same diameter as the upper disk 50 and is rigidly mounted , such as by welding , to the lower end of the foot pedal 16 . the flange 70 has a central opening through which the lower end of the rod 12 extends freely . the upper disk 50 is fastened to the flange 70 by screws 71 and 72 . multiple downwardly extending spikes 60 are spaced evenly around the rod 12 and are mounted with their heads pivotably mounted in spaces between the upper disk 50 and the flange 70 . the shafts of the spikes 60 extend downwardly through spaced openings in the upper disk 50 , and the pointed tips of the spikes 60 are at the opposite ends from the enlarged heads , extending through holes in the lower disk 20 . the rod 12 is free to travel through a central opening in the upper disk 50 , and extends down to attachment to the lower disk 20 , which has similarly spaced openings as the upper disk 50 that allow the spikes 60 to pass freely through the disk 20 . the openings of the lower disk 20 are spaced slightly closer to the axis of the rod 12 than the openings of the upper disk 50 . thus , when the lower disk 20 moves upwardly with the rod 12 relative to the frame 10 , the spikes 60 are guided by the sidewalls of the openings in the lower disk 20 to pivot inwardly until , when the disk 20 is as high as it can raise and the spring 42 is fully compressed , the tips of the spikes 60 are close to , or touching , one another . this movement inward is illustrated in fig7 , and causes the soil and the roots of a weed positioned between the spikes 60 to be grasped by the spikes 60 . the upper disk 50 and lower disk 20 are mounted directly below the flange 70 , shown in fig4 and 5 . serrated tines ( not shown ) may be rigidly mounted around the flange 70 at evenly spaced intervals . the tines can attach to the flange 70 by screws , welds or any fastener . the tines increase the area to include the broad leaves that extend from the center of the plant as will be described below . in use , the operator locates a weed in the soil , sand or other particulate found in a conventional yard and disposes the pointed tips of the spikes 60 against or close to the ground with the tips of the spikes 60 disposed around , and encircling , the main root of the weed . the frame 10 is oriented approximately vertically by disposing the handle 18 at about waist height , where the operator firmly grasps the handle 18 . the operator places his or her foot on the top surface of the foot pedal 16 , and begins to rest his or her body weight down on the foot pedal 16 . this initial downward force displaces the entire device downwardly until the contacting surface ( the lower disk 20 ) compresses any grass plants surrounding the weed . upon continued downward force , the disk 20 seats against the upper surface of the ground , or more typically the compressed grass plants surrounding the weed , and with further force the frame 10 begins to move downwardly relative to the rod 12 and disk 20 . in order for the frame 10 to move downwardly relative to the rod 12 and disk 20 , the downward force must exceed the force necessary to compress the spring 42 . once this occurs , the tips of the spikes 60 begin to extend downwardly through the disk 20 . the spikes 60 enter the soil and are driven further downwardly ( along with insertion of the tines , if any ). at this time , the disk 20 stays in the same position relative to the top of the ground . further pressure results in further compression of the spring 42 and further insertion of the spikes 60 and tines , if any . as the spikes 60 move downwardly and the disk 20 remains stationary , the spikes 60 pivot inwardly as shown in the illustrations of fig6 to fig7 . simultaneous with the rod 12 being held stationary relative to the ground while the frame 10 moves downwardly , the spring 42 compresses as described above . while the frame 10 moves downwardly relative to the rod 12 , the tab 32 slides without significant resistance over the indentations 30 on the side of the rod 12 facing away from the handle 18 . once the spikes 60 have reached their full insertion into the soil and the spring 42 is fully compressed , the weed &# 39 ; s root and some surrounding soil have been grasped by the spikes 60 as a soil “ plug ”. at this point the tab 32 seats in the lowest region of an indentation 30 , or is between lowest regions of adjacent indentations . if the operator rotates the handle 18 approximately 90 degrees to permit any tines to form a cylindrical cut in the soil , this rotating action will free a larger “ plug ” consisting of soil and weed that might contain more roots and more leaves . the operator then extracts the plug from the ground by lifting the device 8 vertically upwardly . when lifting the device 8 , the operator &# 39 ; s downward force is removed , which may cause the rod 12 to begin to move in the opposite direction as the compressed spring 42 begins to expand . the movement of the rod 12 relative to the upwardly moving frame 10 is arrested by the tab 32 being biased into the lowest region of the closest one of the indentations 30 in the rod 12 by the bias of the spring 36 . thus , the ratchet mechanism allows some , but then prevents further , relative movement of the rod 12 and frame 10 . in this “ locked ” condition , the operator continues lifting the device 8 upwardly to completely remove the plug of soil containing the weed and no relative movement of the rod 12 occurs . whenever he or she chooses , but preferably when the device 8 is raised to between the weed and the operator , the operator squeezes the trigger 34 to release the plug and weed . squeezing the trigger 34 lifts the tab 32 from the lowest region of the respective indentation 30 , thereby freeing the rod 12 to move under the influence of the compressed spring 42 relative to the frame 10 . because the spring 42 is significantly compressed and has a high spring constant , the rod 12 moves rapidly relative to the frame 10 during spring expansion , thereby rapidly displacing the lower disk 20 away from the upper disk 50 . this high speed movement causes the weed and soil plug to be ejected from the device 8 with sufficient force to allow the operator to expel the weed into a container , such as a trash can , brush container or compost container . this permits the operator to avoid bending over to obtain the plug and weed from the tip of the tool , or completely rotating the tool so the distal end is close to the user for removal . the device 8 instead serves as a “ gun ” that “ shoots ” the weed and plug out of the tool into a container or area that can be a few feet , and up to many feet , away . the present invention has improved on the prior art &# 39 ; s attempt to eject the weed . the present invention provides a significant enough force to propel the weed rather than merely release it . the weed is ejected with enough force to reach a container six to eight feet away , thereby eliminating the need to stoop or bend over to collect the weed , which the prior art requires . furthermore , the mechanical “ catch ” formed where the tab 32 positively engages the rod 12 by inserting into the indentation is not subject to failure when the components thereof are wet , dirty or otherwise not encountering ideal conditions . this detailed description in connection with the drawings is intended principally as a description of the presently preferred embodiments of the invention , and is not intended to represent the only form in which the present invention may be constructed or utilized . the description sets forth the designs , functions , means , and methods of implementing the invention in connection with the illustrated embodiments . it is to be understood , however , that the same or equivalent functions and features may be accomplished by different embodiments that are also intended to be encompassed within the spirit and scope of the invention and that various modifications may be adopted without departing from the invention or scope of the following claims .

a weed removal device having a handle and a frame through which a rod extends . the rod has a mechanical lock near one end that connects the rod mechanically to the frame , and a base portion near the opposite end . the base portion includes pins that extend into soil around the weed to grasp the weed , and a foot pedal on which the user rests his weight to drive portions of the device into the soil . a spring is compressed when the pins are driven into the soil and grasp the weed , and upon removal of the weed and a plug of soil the mechanical lock can release the spring to expand and thereby eject the weed and soil with force sufficient to propel the weed many feed into a receptacle .

fig1 illustrates an embodiment of an oximetry system incorporating the present invention . a sensor 10 includes red and infrared leds and a photodetector . these are connected by a cable 12 to a board 14 . led drive current is provided by an led drive interface 16 . the received photocurrent from the sensor is provided to an i - v interface 18 . the ir and red voltages are then provided to a sigma - delta interface 20 incorporating the present invention . the output of sigma - delta interface 20 is provided to a microcontroller 22 . microcontroller 22 includes flash memory for a program , and sram memory for data . the processor also includes a microprocessor chip 24 connected to a flash memory 26 . finally , a clock 28 is used and an interface 30 to a digital calibration in the sensor 10 is provided . a separate host 32 receives the processed information , as well as receiving an analog signal on a line 34 for providing an analog display . fig2 is a block diagram illustrating the location of the filter according to an embodiment of the invention . shown is a sensor 10 that is driven by an led drive circuit 16 . the led drive circuit 16 alternately drives an ir led 40 and a red led 42 . a photodetector 44 provides a signal to a current - to - voltage ( i - v converter 46 ). the voltage signal is provided to high pass and anti - aliasing filter 48 . this block includes the band pass filter according to an embodiment of the invention . the output signal is then provided to a sigma - delta modulator 50 . the output of sigma - delta modulator 50 is provided to a demodulator 52 , which is then provided to filtering and decimating blocks 54 and 56 . fig3 illustrates a band pass filter 60 according to an embodiment of the invention . the filter includes an amplifier 62 and a resistor and capacitor circuit comprising capacitors c 2 , c 110 , c 111 , and c 40 and resistors r 7 , r 111 , r 112 , r 110 , and r 109 . an input to this circuit is provided from i - v converter 46 along a line 64 to a first switch 66 for an offset correction not relevant to the present invention . the signal is then provided to a second switch 68 , which is used for a calibration mode according to the present invention . a cross - talk control signal 70 couples the switch to an led current sense line 72 for calibration mode . in the design and manufacture of the band pass filter of fig3 , the corner frequencies are adjusted by varying the capacitor and resistor values to offset and minimize the cross - talk effect . the corner frequencies are the high pass and low pass ends of the band pass filter , which is in place to filter out ambient interferences . there is a major trade off involved in the design of the band pass filter . it is desirable to have the filter corners as close to the modulation frequency as possible . raising the frequency of the high pass corner makes the filter better able to reject any ac portion of ambient light . typically in the us , fluorescent lights have strong ac component at 120 hz and the harmonics of 120 hz . it is desirable to filter this out of the signal . lowering the cut off frequency of the low pass filter limits the high frequency noise from the i - v converter , and provides some anti - aliasing to keep ambient noise out of the system . however , any filtering spreads out the signal in the time domain , for example some of the ir pulse will leak into the dark pulse following it . this has two drawbacks . the first is cross - talk where the ir signal “ leaks ” into the red signal , and vice versa . the second is an offset resulting from a transient that occurs due to capacitances in the patient cable between the led wires and the detector wires . when this transient is filtered , part of it leaks into the sampled part of the signal causing an offset . both of these effects get worse as the corners of the filters are pulled closer to the modulation frequency . tuning the band pass filter to optimize for cross - talk is done when it is designed by adjusting the high pass filter corner and the low pass corner to force the cross - talk to be zero . the size of the red pulse is measured by comparing the sample p 5 ( see fig4 ) to the samples taken in the dark states p 4 and p 6 . red = p ⁢ ⁢ 5 - p ⁢ ⁢ 4 + p ⁢ ⁢ 6 2 since the signal from the ir pulse is still decaying in the dark2 time period , the p 4 sample will be higher due to the low pass response and the lower due to the high pass response . the effect of the ir pulse on p 4 will affect the size of the measured red signal . this is a cause of cross - talk where the ir signal leaks into the red signal and vice versa . this effect is minimized if the filter is a band pass , with both high pass and low pass effects . the effect of the high pass filtering compensates for the effect of the low pass filtering . thus , the corners are adjusted so that the high pass and low pass signals shown in fig5 are adjusted so that the effect of the high pass filtering compensates for the effect of the low pass filtering to minimize cross - talk . the low pass filter causes a positive cross - talk , and the high pass filter causes an offsetting negative cross - talk . in one embodiment , the band pass filter consists of an rc high pass followed by a salen - key low pass configured as a second order butterworth filter . the impedance of the rc high pass section will have an effect on the transfer function of the salen - key circuit , however this effect is negligible if capacitance c 2 is much larger than c 110 and c 111 . the high pass filter cut off frequency is 32 hz ., and the low pass filter cut off frequency is 12 . 7 khz . in addition to designing the hardware of the band pass filter to reduce cross - talk , a calibration mode allows a further correction for cross - talk using a cross - talk calibration test . a subtle cross - talk effect arises from the filtering in the circuit causing light and dark pulses to spread out into each other in the time domain . fortunately the effects from the band pass filter are linear and measurable , and so can be compensated for in software . since this is the result of the filtering , the magnitude of the effect is known ahead of time . a constant is used to subtract the effects of the ir signal from the red signal and vice versa : fig5 is a circuit diagram of an embodiment of led drive circuit 16 of fig2 . included in the circuit are a connection to the red led on a line 80 , and a connection to the ir led on a line 82 . these are provided through mosfet transistors 84 and 86 to a 1 ohm resistor 88 . in the calibration mode , the led current sense signal on line 72 is taken from the current through this 1 ohm resistor with line 72 of fig5 connected to line 72 of fig3 as an input through switch 68 to the band pass filter . in addition to designing the hardware of the band pass filter to reduce cross - talk , the connection of line 72 in fig5 during a calibration mode allows a further correction for cross - talk using a cross - talk calibration test . while doing the cross - talk test , most of the analog circuits on the board are used and so this is a good test to check the integrity of the analog hardware . this test connects the 1 ω current sense resistor 88 to the input to the band pass filter . this way a fixed led current can inject a signal into the signal acquisition circuits . this allows the operation of the led drive 16 , the band pass filter 60 and the sigma - delta modulator 50 to be verified . in addition , measuring the led current using the 1 ω resistor allows the led &# 39 ; s current sense circuit to be calibrated more accurately than the 10 % tolerance capacitors in the circuit would ordinarily allow . thus , during the calibration mode , current is shunted into the current sense input from the led drive current . the only analog circuitry not being used is the photodetector and the i - v converter . in a preferred embodiment , whenever a sensor is connected , this is detected and the software automatically does the cross - talk calibration test . a 50 % drive signal is applied to the leds during the calibration circuit to give a sufficiently large signal without going to full range and risking too high of a signal being provided . alternately , other percentages of the drive current could be used . 1 ) set ir led to 50 %, red led to 0 ; then measure the 0 red signal ; 2 ) set red led to 50 %, ir led to 0 ; then measure the ) ir signal . subsequently , during actual operation , the red cross - talk effect is determined by multiplying the percentage cross - talk times the red signal , and then it is subtracted from the ir signal . the corresponding action is done for the red signal . as will be understood by those of skill in the art , the present invention could be embodied in other specific forms without departing from the essential characteristic thereof . for example , the drive current could be obtained in a different manner and a different design could be used for the band pass filter . alternately , the band pass filter could be used alone , without the software calibration added . accordingly , the foregoing description is intended to be illustrative , but not limiting , on the scope of the invention which is set forth in the following claims .

a method and apparatus for reducing cross - talk in an oximeter . the oximeter includes a band pass filter . the amount of cross - talk through the band pass filter is estimated . based on this estimate , the corner frequencies of the band pass filter are adjusted when it is designed to minimize the cross - talk . in one embodiment , a calibration mode is performed when a sensor is attached to the oximeter . in the calibration mode , the signals are measured with first only the red led on and then with only the ir led on . any signal measured in the off channel is assumed to be a result of cross - talk from the other channel . the magnitude of the cross - talk is determined as a percentage , and subsequently the percentage is multiplied by the actual signal and subtracted from the other led signal as cross - talk compensation .

the present invention is especially adapted to be affixed to the front end of a windrower or hay swather . in the conversion of a typical combine or hay swather , the cutter bar assemblies are removed and the present invention is installed with either a 2 - point or 4 - point attachment . while it would appear to be somewhat less desirable , the apparatus of the present invention could likewise be mounted on hydraulically - actuated front end loader arms , commonly found on farm tractors . while it would not be the preferred mode of operation , it is equally clear that the apparatus of the present invention could likewise be mounted on any other propulsion device , such as a pickup truck , boat , continuous - track vehicle , etc . the present invention can be generically described as a &# 34 ; seed - harvesting header &# 34 ; and is denoted generally in fig1 by the numeral 10 . the header is comprised of a housing member 20 , a brush 30 , auger 40 and conduit means 50 . generally speaking , as the present invention is moved through a seed source in the direction of arrow 60 , the brush 30 is rotated in the direction of arrow 62 . seed - bearing plants are stripped of their seeds by brush 30 , the seeds being propelled to auger 40 and thence through the conduit means 50 to a seed storage area ( not shown ), which may take the form of a bag , hopper , etc . the operation of the present invention is to be distinguished from conventional combine harvesting of , for instance , wheat , wherein the entire above - ground portion of the plant is severed by a cutter bar and the rotating paddles direct the plant to a deseeding cylinder . after harvesting the seeds from , for instance a grass , the present invention leaves the bulk of the plant standing , affording vegetation for subsequent grazing by wild or domesticated animals , cover for birds , windbreaks for snow ( thereby increasing available water for subsequent years growth ) and decreased wind erosion . more specifically , the housing comprises a pair of end walls 22 and 24 , a top wall 26 , a back wall 28 and a bottom 32 . it is contemplated that the housing will be constructed of a medium gauge steel which can be welded , although any suitable material will suffice , such as sheet metal , fiberglass , wood , etc . the brush 30 is carried on a pair of side brackets 34 which project forwardly from the end walls 22 , 24 . a pair of skids 35 , can be provided at the lowermost portion of each end wall so that as uneven terrain is encountered by the invention , damage to the unit is minimized . the brush 30 is preferably adjustably mounted to the brackets 34 so that it may be adjusted either horizontally or vertically as viewed in fig1 . the brush 30 comprises a plurality of flexible bristle members 36 mounted to an outer shaft 38 . adjustability may be provided by any means available to those skilled in the art . for instance , a plurality of shims 42 provides adjustability vertically , by either adding or removing shims to raise or lower the brush . the shims are provided with a plurality of apertures which permit the journal to be moved horizontally , thereby adjusting the brush horizontally . alternatively , brush 30 may be carried on an adjustable carriage 80 as shown in fig1 . the carriage 80 may be adjustably affixed to bracket 82 which is secured to member wall 22 by bolts 84 . in this manner , the brush may be moved vertically by adjusting bolts 84 and bracket 34 upwardly or downwardly , and may be adjusted horizontally by sliding carriage 80 horizontally to a new location on bracket 34 prior to securement . an auger 40 is provided in a rearward and lowermost portion of housing 20 . the auger 40 directs seeds collected throughout the width of housing 20 to one end of the housing for removal to the seed storage area . the seeds exit housing 20 through an opening covered by screen 48 in back wall 28 . as shown in fig3 a blower or impeller assembly 52 is positioned in conduit 50 to create a vacuum sufficient to pull seeds from the auger 40 through the screen 48 and thence through the pipe 54 to the seed storage area . a cyclone - type separating cleaner 90 can be provided in conduit 50 to remove debris that passes through screen 48 . it has been found that a preferred method of making the brush 30 is to utilize a &# 34 ; rope &# 34 ; having bristles of appropriate length woven therein , with the &# 34 ; rope &# 34 ; thereafter being wound in a helical fashion ( represented by the broken lines 56 of fig2 ) about shaft 38 . in such manner , relatively uniform point density can be obtained throughout the surface of the brush and replacement of the brush is a relatively simple matter . by winding the &# 34 ; flights &# 34 ; of the rope 56 about the shaft 38 in a tighter fashion , the point density of the brush can be increased ; similarly , by winding the rope in more spaced - apart flights , the point density of the brush can be decreased . such feature can be of great significance since the point density will , to some degree , determine the &# 34 ; stiffness &# 34 ; or &# 34 ; flexibility &# 34 ; of the brush . for example , when harvesting a grass species which requires very little force to separate the seed from the stem , a more flexible ( lesser point density ) brush may be utilized , whereas when removing seeds from a woody shrub , a more dense , stiff brush may be needed to penetrate th exterior of the plant and remove a high percentage of the seeds . while a point density of from about 6 points / square inch to about 20 points / square inch is acceptable ( depending upon the length and diameter of the individual bristles ) it has been found that a point density of from about 10 points / square inch to about 12 points / square inch is acceptable for harvesting most native grasses , shrubs , flowers and other crop plants . within housing 20 is an arcuate lower wall portion 58 as shown in fig4 . primary seed removal is accomplished on this arcuate lower wall as the plant is biased between the bristles 36 and wall 58 . as the brush 30 is adjusted by moving it either to a lower or more rearward position , greater frictional engagement between the bristles 36 and wall 58 occurs . as the brush 30 is adjusted either upwardly or forwardly , the frictional engagement therebetween can be either reduced or totally eliminated . this feature permits the operator to select the desired amount of force necessary to remove the particular seeds being harvested without causing undue damage either to the seeds or the remaining vegetative material , or to the brush 30 . as seeds are removed from the plants , they are propelled rearwardly and fall into an auger trough 64 . the auger 40 can be constructed in any conventional manner . for instance , it can be a conventional screw - type auger , or applicant has found that an auger constructed similar to that of the brush 30 can be advantageously employed . in tee latter instance , a rope of bristles 66 can be relatively loosely wound about an auger shaft 68 to provide conventional canted auger flights . depending upon the volume of seeds to be harvested , the housing can be provided with a plurality of augers arranged either one above the other or side - by - side . such arrangement might be necessary when harvesting a large quantity of seeds in a short period of time . as shown in dashed lines in fig4 a portion of the top wall 26 can be hinged to provide a maintenance or observation port . applicant has found that it is advantageous to extend the home end of the auger slightly outside housing 20 , as shown in fig2 . during seed removal , there will inevitably be plant debris ( leaves , seed pods , stems , etc .) entrained with the seeds , which is advantageously removed prior to final collection of seeds . applicant has found that when the seeds are removed through the screen 48 a substantial portion of the plant debris will be retained upon the screen . by positioning the auger 40 such that it sweeps across the screen 48 , the screen is continually cleaned and the debris is carried outside housing 20 by auger 40 and deposited in the field . preferably , the screen is easily removable for cleaning ( if it becomes clogged with debris ) or for changing for a screen having a different aperture size if different size seeds are harvested . many seeds ( especially grass seeds ) naturally occur in agglomerations of two or more , being fused together either external of or within a seed pod or head . additionally , many seeds naturally occur singly within seed pods . such seeds are not suitable for planting , since individual seeds must be provided to a seed drill . conventionally , seeds are harvested in whatever form they occur and thereafter the seed merchant attempts to break apart the agglomerations or pods to provide individual seeds . an important feature of the present invention is that the device combines these heretofore separate steps and provides a method of separating agglomerated seeds and breaking seed pods . the blower / impeller 52 is provided in the form of a conventional fan having a plurality of blades which substantially span the inside diameter of conduit 50 . when operated at high speed in order to create the vacuum necessary to draw seeds through screen 48 , virtually all of the seeds passing through screen 48 will contact one or more of the rotating fan blades 70 . it is important to note that the seeds being sucked from the auger trough through screen 48 are travelling directly into the fan blades : e . g ., they travel in a direction parallel to the axis of shaft 72 about which blades 70 rotate . such arrangement insures that the seeds will contact the fan blades and separate agglomerations or break open seed pods . this material then preferentially enters a cyclone - type separating cleaner , where seed hulls , seed pods , small debris , etc ., are separated , leaving a relatively pure seed stream . while the moveable parts disclosed herein can be actuated by any conventional power source , applicant has found that hydraulic motors are the preferred power source . for instance , a hydraulic motor 74 can be mounted on shaft 76 within shaft 30 to drive the brush 30 . similarly , hydraulic motors can be used to drive auger 40 and blower 52 . five prototype headers substantially as described above were manufactured and affixed to heston model 6555 swather tractor . the headers had approximate dimensions of heighth 431 / 2 &# 34 ;× depth 481 / 2 &# 34 ;× width 14 &# 39 ; 5 &# 34 ;, with the seed harvesting brush being constructed of a bristle rope wound about a 10 &# 34 ; shaft such that the point density was about 10 points / inch square . the auger was likewise constructed of bristle rope wound about a 2 &# 34 ; shaft . the diameter of the seed harvesting brush was 36 &# 34 ;, while the diameter of the auger brush was 12 &# 34 ;. the combines were run through a very thinly vegetated stand of crested wheat grass , representing a minimally adequate seed stock source . the headers were maintained approximately 14 &# 34 ; above the ground surface . the following variables were maintained as closely as possible over the test run : 4 . cyclone cleaner not utilized on these machines -- plant debris expected to be substantially lower with its use . the foregoing description should be considered illustrative of the principles of this invention . it should be readily apparent that those skilled in the art can make modifications or changes to various aspects of the invention without departing from the spirit thereof . it is not necessarily desired to limit the invention to the precise configuration shown and described herein but rather the limits of this invention are to be construed solely in light of the appended claims .

an elongate housing is provided for removable attachment to either a self - propelled windrower or conventional farm tractor . a flexible - bristle brush is adjustably secured to the housing such that when the housing is moved through a field of seed - bearing plants , the rotating brush interacts with the housing to strip seeds from the plants . the seeds are deposited in an auger trough and moved by the auger to one end of the housing . an impeller or blower located outside the housing creates a vacuum such that the seeds are drawn through a screened opening in the housing and conveyed to a seed storage area . in order to break apart agglomerations of seeds or seed bearing pods , the blower / impeller is preferably provided in the form of a fan having blades which rotate about a shaft aligned such that the harvested seeds strike the fan blades , thereby breaking apart the seed agglomerates and seed pods . the flexible bristle brush is adjustable so that varying forces may be applied to varying plants having greater or lesser force required to remove seeds therefrom .

with reference to fig1 and 2 , the operator holding on to handle 11 guides the seeder along a prepared furrow and consequently wheel 12 rotates in the direction of the arrow . wheel 12 and wheel 13 are mounted on chassis 14 and are coupled via belt 15 and pulleys 16 and 17 . the belt and the pulleys are cogged to eliminate slippage . belt 15 is twisted like the figure eight , thus transferring to wheel 13 rotation in the direction of the arrow next to it in fig1 . seed - container 18 is detailed in fig3 . it is constructed of two transparent plastic walls 19 , a sloping bottom 20 and a swivel cover 21 . wheel 13 fits closely in the slot formed by the two walls and the bottom , thus enclosing seeds 22 . a gap larger than a single seed remains between wheel 13 and the edge of cover 21 . funnel 23 which extends through a hole in cover 21 facilitates loading the container with seeds . with reference to fig4 and 5 , the suction bellow 24 , constructed of an elastic element 25 and two rigid disks 26 which are held together by compression rings 27 , is mounted on wheel 13 inside a diamond shaped opening . one rigid disk 26 is attached to wheel 13 by means of screws through holes in bracket 28 and the other disk is made to oscillate back and forth as wheel 13 rotates , by means of a mechanism comprised of connecting rod 29 pivots 30 and 31 and arm 32 . arm 32 is attached to mounting bracket 33 which is riveted to chassis 14 as shown in fig2 . arm 32 extends away from wheel 13 , thus providing enough clearance for bellow 24 as it passes under the arm as shown in fig5 a . a radial hole 34 in wheel 13 is aligned with a hole 35 in disk 26 and an o - ring 36 provides a tight seal . again with reference to fig5 a , bellow 24 is shown in its most compressed position . as wheel 13 rotates , the bellow expands and as hole 34 enters the seed container 18 the rate of suction is sufficient for a single seed to be picked up . the picked up seed is carried upwards as shown in fig5 b . the seed is held in place until the suction stops , i . e . until the bellow is fully expanded as shown in fig5 c . as wheel 13 continues , the bellow contracts and instead of suction it provides an explusive flow of air which pushes the seed away . the seed is then already located inside the bent portion of duct 39 which guides the seed toward the ground as shown in fig1 . the passage of the seed is detected by electronic module 61 which produces an audible beep . duct 39 is made of a square tube and is attached to bracket 33 . the upper portion of the duct is bent and it has a slot in which wheel 13 fits , leaving enough clearance for the passage of the seed . to adapt the tool for different seeds , a replaceable constrictor 37 is inserted at the opening of hole 34 as shown in fig4 . the constrictor has a smaller orifice than the diameter of hole 34 and a flared opening to provide a better grip on the seed . in addition , a replaceable plug 38 , having an orifice through which air leakage is allowed is provided as shown in fig4 . by selecting the correct orifice , the counteracting force exerted by the bellow on the drive mechanism is reduced to the minimum and the incidents of multiple seed pickup due to excessive suction force are also reduced . with reference to fig6 . the operation of the electronic monitor will now be explained . as switch 41 is turned on current from battery 40 flows through resistor 42 and causes light - emitting - diode 43 to emit light which enters via a through - hole in duct 39 and falls on light detector 44 which is a cadmium - sulfide photo resistor . the current through detector 44 is set by resistor 45 and by the intensity of light from the emitting diode . as a seed falls down duct 39 it partially interrupts the light path between the emitter and the detector , causing a small change in the voltage across the detector . this voltage change is amplified by the amplifier circuit composed of capacitor 46 resistors 47 , 48 , 50 and transistor 49 . the amplified voltage swing at the collector of transistor 49 is enough to trigger the monostable flip - flop circuit composed of and - gates 51 , 53 , capacitor 52 and resistor 54 . the monostable flip - flop produces an approximately 0 . 1 second enable signal to the free - running flip - flop composed of and - gates 55 , 56 , resistors 57 , 58 and capacitor 59 . the free - running flip - flop feeds the piezoelectric loudspeaker 60 with a tone signal of approximately 2000 hz . thus , every time a seed is deposited , an audible beep of 0 . 1 second duration is produced , giving the operator the confidence that seeding is taking place . for the new invention to operate smoothly it is required that the ground engaging wheel 12 roll easily over a worked garden soil . therefore , the diameter of this wheel cannot be arbitrarily small . a diameter of approximately 6 inches is the optimum size for wheel 12 . this means that the wheel traverses approximately 18 inches for each complete rotation . since the distance between seeds as required for most seeding operation is much shorter , i . e . 2 to 6 inches , and since the new seeder as described previously deposits a single seed for every turn of wheel 13 , it follows that the coupling ratio between wheel 12 and wheel 13 must be as high as 9 : 1 . if we assume for this discussion that the coupling ratio is 9 : 1 and that a reasonable slowest walking speed for the operator is 1 . 5 feet / second , it follows that wheel 13 will rotate approximately 9 revolutions per seconds . at that speed no seed pickup is possible because of the inertia of the seed . experiments showed that for efficient operation , the rotation speed of wheel 13 with a diameter of approximately 4 inches is limited to 3 revolutions per second . in order to increase the density of deposited seeds , it is possible that the operator will run over the same furrow more than once ; each time with a slight off - set to the starting point . alternatively the seeder can be modified as follows : 1 . with reference to fig7 two or more suction elements 24 can be mounted on the same wheel 13 , coupled by a separate connecting rod 29 to a single pivotal point . each suction element is thus made to contract and expand once every rotation , proportionally increasing the number of seeds deposited per rotation . 2 . with reference to fig8 the suction bellow has two suction ports 37 in close proximity thus picking up and depositing seed in pairs for each rotation of wheel 13 . this method does not offer uniform distribution , but this is not a limitation since most crops are planted at a high density in order to allow thinning after the seedlings emerge . statistically , thinning after planting in pairs also results in adequate uniformity in plant distribution . if modifications ( 1 ) and ( 2 ) above are combined , it gives the operator the flexibility to select a seeding density by enabling only part of the suction ports and plugging the rest and without changing the coupling ratio between wheels 12 and 13 . although in the preferred embodiment the suction element 24 is mounted on wheel 13 , an embodiment in which the suction element is mounted on chassis 14 is within the scope of the new invention . such an embodiment is depicted in fig9 . a tube 62 connects the suction element to the radial hole 34 in wheel 13 by means of a rotary seal bushing 63 . the oscillatory motion to the suction element is conveyed by means of connecting rod 64 mounted on an off - center pivot 65 . also , within the scope of this invention are all the embodiments which employ suction elements that are based on a piston inside a cylinder instead of an elastic bellow , and all the embodiments which employ mechanical gear coupling instead of a cogged belt and pulleys .

a tool for depositing seed uniformly along a prepared furrow . the tool uses the rolling motion of a ground engaging wheel to drive a seed pickup and delivery mechanism . a pickup wheel which is coupled to the ground engaging wheel contacts the seeds via a slot in the seed container . a suction force created by an oscillating bellow is channeled to a pickup aperture in the circumference of the pickup wheel . picked seed is carried by the pickup wheel to a guiding duct to be released and delivered to the soil . the tool also includes an electronic monitor that produces a short audible beep for every deposited seed .

fig1 shows , in side elevation , a preferred embodiment of the hand - held iontophoretic transdermal medicament delivery apparatus of the present invention . the apparatus , indicated generally by the numeral 10 , has an elongate base assembly 11 the major portion of which is preferably formed of plastic and shaped to conform to and comfortably fit within a users hand . an applicator electrode module 12 , containing a unit dose of medicament 23 , is releasably attached to a applicator electrode receptacle 14 on the distal end of the base assembly 11 . the application electrode 12 is preferably a &# 34 ; clip - on &# 34 ; type of electrode similar in configuration to an electrocardiogram electrode . in the drawing presented in fig1 and 2 , electrically conductive elements such as wires and busses are presented as heavy lines . a wire 16 provides electrical connection between the applicator electrode receptacle 14 and wire 1 within the neck 15 of the base assembly 11 . connecting wire 18 , in turn , provides electrical connection between the wire 16 and the current driver unit 19 housed within the base assembly 11 . a conductive tactile electrode 20 forms a portion of the exterior skin - contacting surface of the base assembly 11 preferably circumferentially enclosing a portion of the base housing or it may be interrupted or discontinuous on the outer surface . the tactile electrode 20 is in electrical communication with the cathode 24c of battery 24 by means of a buss 17 and conductive urging spring 25 which secures the battery in position within the base assembly 11 . for the self - administration of medicament a user must have . skin contact with the tactile electrode 20 for the unit to operate . current driver 19 underlies the cathodic ( ground ) tactile electrode 20 and is electrically connected via wire 21 to a voltage multiplier 22 . the voltage multiplier 22 receives low voltage power from the anode 24a of the battery power source 24 and increases the available voltage for presentation to the application electrode 12 . the battery 24 is preferably a size aa or aaa . battery 24 is held in place by an electrically conductive biasing spring 25 and ensures that electrical power is available at the application electrode 12 when the user grasps and holds the base housing 11 of the apparatus 10 thereby touching the cathodic tactile electrode 20 . the application electrode 12 and the tactile electrode 20 thus form a closed circuit in series with the user &# 39 ; s skin . when current flows across the user &# 39 ; s skin to the application electrode in response to an applied voltage the current promotes and hastens the penetration of the medicament 23 contained in a reservoir 26 within the working electrode 12 into the skin . the polarity of the working electrode 12 is preferably unidirectional to promote the above described penetration without requiring a separate grounding electrode . the working application electrode 12 will be described in greater detail below . the base assembly 11 of apparatus 10 serves as a housing to the aforesaid components as a handle . the portion of the base assembly 11 exclusive of the tactile electrode , is preferably made of a plastic such as polyethylene , acrylonitrile , butadiene , styrene or similar durable plastic . the battery portion 24 is connected to a voltage multiplier 22 which steps up the voltage supplied by the battery 24 and applies the stepped up voltage to the current driver 19 . current driver 19 presents a defined current and voltage output at the application electrode 12 the value of the current , which may be empirically determined being sufficient to drive the medicament through the porous , open - celled material 27 ( fig2 ) within the application electrode interposed between the skin contacting surface 13 and reservoir 26 containing the unit dose medicament and penetrate the patient &# 39 ; s skin . the circuitry limits the maximum current available to the application electrode to preferably to less than about one milliampere per two square centimeters of the skin - contacting surface area 13 of the application electrode 12 . however , depending upon working electrode &# 39 ; s 12 skin - contacting surface 13 configuration , the current level can vary from about 0 . 1 to about 1 . 2 milliamps . currents ranging between 0 . 1 ma to 5 ma have been used clinically by the present inventor , but the higher currents caused the user minor discomfort and , with chronic use over time , may produce untoward effects . fig2 shows a preferred embodiment of the iontophoretic medicament - containing application electrode 12 . the application electrode 12 is preferably disposable and non - reusable and is suitable , for example , for transdermally delivering antiviral agents such as acyclovir ® for the treatment of cold sores or genital herpes . the size of the skin - contacting surface 13 of application electrode 12 may vary to accommodate specific clinical applications . the application electrode 12 is detachably housed within a recess within the receptacle 14 which recess presents an electrically conductive interior surface to complete the electrical flow path from the connecting wires 18 and 16 to a conductive element 29 within the application electrode . the electrical current from the current driver 19 is conducted through conductive inner surface of the application electrode receptacle 14 to the electrically conductive element 29 within the applicator electrode which element 29 is in electrical contact with the inner surface of the receptacle in contact therewith to drive the medicament 23 or treatment agent through the open - celled sponge - like matrix material 27 and through the user &# 39 ; s skin ( not shown ). the medicament or treatment agent 23 is contained within a rupturable polymer reservoir 26 until dispensed during treatment . a slight exertion of pressure or squeezing of the reservoir 26 against reservoir puncture means 28 releases the medicament or treatment agent into an open - celled sponge - like material 27 within the application electrode for iontophoretic delivery into the patient &# 39 ; s skin . medicament 23 release can occur at the time of application or upon peruse compression of the electrode 12 . application electrode 12 can be advantageously designed to include a stripping portion adapted so that upon removal of the application electrode 12 from the electrode receptacle 14 a protruding stripping portion ( not shown ) scrapingly strips the conductive coating from the conductive support arm 29 to prevent reuse of the disposable electrode 12 . application electrode 12 is intentionally packaged with a single dose packet or reservoir 26 of treatment agent or medicament 23 . in addition to the medicament , the reservoir 26 can include a coloring agent , such as iodine , which turns dark blue upon contact with starch in the open - celled material to visibly indicate that the unit dose encapsulation has been used . other suitable coloring agents can include ph indicators , wet saturation indicators or oxidizable pigments . the open - celled sponge - like material 27 surrounding reservoir 26 should be inert to the medicament or treatment agent being employed , as well as being non - corrosive and stable when in contact with the treatment agent . suitable materials include plastic pads , such as polyethylene , paper or cotton , porous ceramics , open - celled porous polytetrafluoroethylene , polyurethane and other inert plastics , and open - celled silicone rubber , such as may be employed with vertically aligned medicament - containing tubes . a typical medicament that can be contained within the rupturable polymer reservoir 26 is xylocaine or similar topical anesthetic . the disposable electrode 12 possesses the advantages of preventing leaching or migration of the medicament from within the rupturable polymer reservoir , no attendant loss of efficacy , a long shelf life and little or no electrode corrosion . a suitable electrical control circuit for use in the iontophoretic medicament delivery apparatus 12 is shown in u . s . patent application , ser . no . 07 / 579 , 799 , filed sep . 10 , 1990 , now u . s . pat . no . 5 , 160 , 316 and hereby specifically incorporated by reference herein in pertinent part . fig3 shows a particularly preferred embodiment of a disposable , one - time use electrode 30 for use with the iontophoresis handpiece 10 of the present invention . fig3 is a top view of the disposable electrode 30 with the upper release film 41 ( fig4 ) removed . a non - conductive substrate 31 is formed into a flat strip having a central portion a and two end portions b . the end portions b each have a cut - out therein containing an electrically conductive gel 32 . the gel 32 may be imbedded within a mesh or it may be constrained within the cut out by means of a porous , non - wicking and non - electrically conducing containment layer 34 and 35 much as tea is contained within a porous tea bag . the central portion a of the strip 31 has a medicament - containing reservoir 33 therewithin . the medicament - containing reservoir 33 may comprise a suitable medicament embedded within the mesh of a pharmacologically inert material . the medicament - containing reservoir 33 is positioned between die cuts 36 in the non - conductive substrate 31 which die cuts provide means for facilitating the predictable bending the electrode strip 30 to matingly conform to the shape of the exterior surface of an iontophoresis handpiece 10 ( fig1 ). magnets 43 and 43 &# 39 ; ( shown in phantom in fig3 ) disposed laterally to the central portion a provide means for magnetically activating a handpiece when the electrode is in position . an exploded side view of the electrode 30 is shown in fig4 . the conductive gel 32 filling the cut - outs may be contained within a mesh or may be contained within the cut - out by means of porous , non - wicking layers 34 and 35 . similarly , the medicament - containing cut - out 33 may comprise the medicament embedded within a mesh , a gel , or similar substrate which releases the medicament in response to an electrical communication therewith . the upper containment layer 34 and the lower containment layer 35 serve to restrain the conductive gel within the medicament reservoir 33 to their respective cut - outs . an upper release film 41 is used to protect the adhesive surface ( not shown ) on the uppermost surface of the containment layer 34 . a lower release film 42 serves a similar function to protect the adhesive surface of the lower medicament containment layer 35 . the cut - outs 36 are shown to penetrate the strip of non - conductive material 31 adjacent to the medicament - containing reservoir 33 . it is particularly desirable to provide one or more activating magnetic bodies 43 and 43 &# 39 ; within the strip 31 in order to properly position the electrode strip 30 and activate the handpiece 10 . since it is anticipated that the handpiece / electrode assembly of the present invention will most likely be used in the bathroom , it is particularly desirable to hermetically seal the handpiece &# 39 ; s internal operational mechanisms . the on / off switch within the handpiece can be in the form of a magnetically responsive switch which is turned &# 34 ; on &# 34 ; and &# 34 ; off &# 34 ; in response to the position of the electrode . turning now to fig5 we see a disposable electrode 30 in the process of being applied to the terminal end of an iontophoresis handpiece 10 . the electrode 30 is applied to the active terminal 16 of the handpiece in such a manner that the medicament - containing reservoir 33 overlies and is in electrical contact with the active terminal 16 of the handpiece 10 . the conductive gel layers 32 are positioned on the handpiece to overly the ground electrode on the handpiece 10 . the ground electrode is indicated at 20 in fig5 . an alternate but equally effective embodiment of fig4 electrode can be manufactured from a mold injected soft , inert material , non - conductive and non - porous ( such as silastic ®- by dow corning ) in the shape embodied in fig3 . the unit will contain vertically aligned open cells for containing and acting as reservoir for therapeutic medicaments as well as a conductive gel ( if necessary ). such an embodiment is less costly to produce and avoids the process of assembling numerous layers . the iontophoresis handpiece and electrode assembly in accordance with the preferred embodiment shown in fig3 and 4 is shown being used by a patient 60 in fig6 . the patient 60 grasps the handpiece by means of placing a finger 61 on at least one of the conductive gel ground electrodes thereby grounding the patient &# 39 ; s body . the active electrode driver 19 of the handpiece is in electrical communication with the medicament - containing reservoir 33 . the medicament - containing reservoir 33 , thus positioned and grasped by the patient , is advanced to come in contact with a lesion 63 on the patient &# 39 ; s skin . upon contact , electrical current flows between the active electrode 19 in the handpiece to the ground electrode ( s ) 32 via passage through the medicament - containing reservoir 33 comprising the active electrode . the polarity of the current may be reversed to accommodate the charge on the medicament . the flow of an electrical current facilitates entry of the medicament within the reservoir 33 into the skin overlying the lesion 63 thereby locally delivering the medicament to the exact area to be treated . the inventor has conducted a clinical study using a prototype iontophoretic device in accordance with the present invention for the treatment of cold sores . the clinical response was promising . a second independent , qualified investigator , a board - certified urologist , conducted a study using the present apparatus and method for treating male genital herpes lesions with encouraging results . table 1 summarizes data ( discussed below ) supporting the claim to unexpected clinical benefits treating disease with this novel method . the method and medicament application device when used together for treating these common , embarrassing , and previously not easily - treatable ailments provide surprising advantages . the embodiment of the device shown in fig1 and described hereinabove is a improvement over the prototype used in the clinical study , which was a larger unit , not user friendly , which required physically connecting wires to the patient &# 39 ; s body which created anxiety , and could not be used without attending personnel . notwithstanding design , the apparatus used in the clinical study summarized in table 1 employed electronics similar to the apparatus described herein and was used to optimize the clinical performance of the embodiment 12 of the device described herein . table 1______________________________________stage i treatment resultsresponse iudr acyclovir ® totals______________________________________no response 1 1 2some response 1 3 4major response 26 42 68______________________________________ the study included a control situation wherein seven patients were found who had simultaneous concurrent herpes lesions at separate locations on their bodies . in each case one lesion was treated with iontophoretic application of antiviral agent ( acyclovir ® or iudr ) and the other lesion was treated in the standard method employed in the prior art comprising repeated topical application of the same antiviral agent . the iontophoretically enhanced treated lesion received a single 10 - 15 minute treatment . all iontophoretically treated lesions demonstrated resolution in 24 hours and none of the unassisted topically treated lesions demonstrated a similar response . the results for the control group are summarized in table 2 . table 2______________________________________control group results no response some resp . major resp . ______________________________________iudrtreated lesion 0 0 7control lesion 5 2 0acyclovir ® treated lesion 0 0 1control lesion 1 0 0______________________________________ the clinical studies included patient volunteers with full informed consent who suffered from recurrent cold sores . the study demonstrated greatest treatment efficacy if the herpes lesion received iontophoretic treatment within 36 hours of lesion onset . the treatment incorporated an electrode saturated with acyclovir ® ointment ( zovirax ®) or iudr ( stoxil ®) ophthalmic drops as supplied by the manufacturer . thus mounted anodic electrode of the prototype system was used for a 10 - 15 minute application directly to the lesion with the average current setting of 0 . 2 ma - 0 . 6 ma which was well tolerated by all patients . the lesion was evaluated in 24 hours . in 92 % of the iontophoretically treated cases (& gt ; 70 lesions treated ) a major response was noted . a major response was categorized by resolution of pain in & lt ; 6 hours and lesion crusted and healing within 24 hours . the normal course of cold sores involves an average period of 10 - 12 days before resolution and healing occurs . the present apparatus and clinical method for treatment of mucocutaneous herpes simplex ( type i and type ii ) eruptions presented herein have been described and performed with excellent results . this novel user friendly apparatus in combination with the disclosed clinical treatment method presents a very effective new treatment for herpes simplex eruptions . while the invention has been described above with references to specific embodiments thereof , it is apparent that many changes , modifications and variations in the materials , arrangements of parts and steps can be made without departing from the inventive concept disclosed herein . for example an impregnated conductive gel can also be used to as medicament containing medium to increase the physical stability and the tissue adhering characteristics of the electrode . accordingly , the spirit and broad scope of the appended claims is intended to embrace all such changes , modifications and variations that may occur to one of skill in the art upon a reading of the disclosure . all patent applications , patents and other publication cited herein are incorporated by reference in their entirety .

a portable iontophoresis apparatus for facilitating delivery of medication across the cutaneous membrane into adjacent underlying tissues and blood vessels . the apparatus employs a modular , detachable non - reusable medicament - containing applicator electrode which is adapted to attach to a base assembly . the apparatus is designed to be hand - held and includes a circumferential tactile electrode band on the base assembly which provides electrical connection between the skin of the user &# 39 ; s hand and one pole of a bipolar power source housed within the base assembly . the opposing pole of the power source is connected to the applicator electrode . the user &# 39 ; s body completes the electrical circuit between the applicator and tactile electrodes . a method for using the device for the treatment of herpes simplex infection and related viral infections which produce similar cutaneous lesions is presented . the apparatus , when used in accordance with the method described herein , demonstrated & gt ; 90 % treatment efficacy in clinical trials .

a current practice when a golfer wishes to refine his golf stroke , most often used at commercial driving ranges , is for the golfer to purchase a bucket of balls and then methodically place a golf ball onto a tee and take a practice stroke . repeating this process over and over in rapid succession is not only tedious and disruptive of the learning process , but constantly stooping over can place a strain on a golfer &# 39 ; s back , potentially causing injury . once a golfer is tired or sore , it is unlikely that he will continue to take practice shots and , as a result , his golf game may suffer . there is a need for providing equipment by which a golfer automatically tees up his golf ball so that the golfer may rapidly tee up successive balls without having to greatly alter his stance or hand position on the grip of the club . given the importance of a good golf swing and a strong drive to success in the sport of golf , numerous attempts have been made over the years to perfect a teeing device which mechanically places a ball onto a golf tee for a golfer to strike . generally speaking , these devices have either been for installation below ground or utilize an above ground approach . however , devices utilizing either of these approaches have additional inherent drawbacks which have prevented their acceptance in the golf industry . teeing devices which are installed below ground are often mechanically and electronically complex and require excavation prior to their installation . u . s . pat . no . 5 , 352 , 964 , for example , teaches an underground system where a photoelectric sensor detects movement of the tee ( i . e . once the golfer swings and displaces the ball ), whereupon the tee is retracted below ground by an electric motor driving a pinion gear and a replacement ball is gravity fed onto the tee at its lowermost retracted position . the height to which the tee will rise is adjusted by use of a height adjustment micro switch . u . s . pat . no . 5 , 356 , 148 teaches an underground trough which receives golf balls from a hopper and a pneumatic device which raises the tee to a position higher than ground level . in all of these teeing devices , ball handling requires complex equipment which is costly and requires high maintenance . referring to fig1 the novel golf ball placement device of the present invention is indicated in the general direction of arrow 10 which includes an elongated storage and feed tube 11 which is fixedly carried on a base 12 by means of a bracket 13 . end 14 of feed tube 11 is open so that a plurality of golf balls may be introduced to the tube 11 for storage purposes and for eventually feeding the lowermost ball in a series to a rotatable cylinder 16 via an open end 15 in tube 11 . the intermediate collection cylinder 16 includes an opening 17 so that a ball captured within the cylinder can be transferred through an opening 18 located in the side of a dispensing tube 20 . the dispensing tube is pivotally mounted on a bracket 21 by means of a pivot 22 and a bracket 23 . the pivot rod 22 passes through a sleeve which is attached to a support plate 24 to which the end of tube 20 is fixedly attached . therefore , it can be seen that the tube 20 can be rotated on its pivot 22 between the brackets 21 and 23 . in order to actuate the pivotal movement of tube 20 , the device is provided with an actuator plate 25 against which a player &# 39 ; s golf club head may be placed in order to actuate the device . therefore , the golfer may remain in a fixed stance of his selection without having to bend , lean or otherwise lose his stance in order to operate the device . it is of importance to note that the intermediate collection cylinder 16 has a counter weight attached thereto so that after the device has been actuated so that the cylinder is rotated , and the ball placed on a tee 27 , the device is automatically reset by causing the dispensing tube 20 to revert to its vertical and standby position , as illustrated . also , the cylinder 16 will rotate to its standby position in order to receive another ball from the feed tube 11 . the ball is indicated by numeral 28 which has been placed on the tee 27 and the dispensing tube has been automatically returned to its at rest or start position . a feature resides in placing the tee 27 so as to serve as a hub for receiving a mat 30 in which a center hole is placed over the tee 27 . the mat augments the device by simulating turf and prevents the golfer &# 39 ; s club head from striking or damaging the base for support on which the device is mounted . a linkage 31 extends from a crank arm 32 attached at one end to the cylinder 16 and to the actuator plate 25 via the pivot 22 and the feed tube 20 . therefore , any actuation of the plate 25 will cause the cylinder 16 to rotate via the linkage 31 and bell crank 32 . since the device is intended to be used for commercial applications , it is important to count balls as they are dispensed from the dispensing tube and for this reason , an automatic ball counter 33 is provided on the base 12 which is operated by the pivotal movement of the dispensing tube 20 . therefore , as the tube 20 dispenses a ball onto the tee 27 , a count will be taken . referring now in detail to fig2 it can be seen that the cylinder 16 serves as a stop for the sequence of balls numbered 2 - 7 which are in the feed tube 11 . however , when the cylinder 16 is rotated so that the opening 17 is beneath the feed tube 11 at opening 15 , the lowermost ball which in this case is numbered 2 , will drop into the cylinder preparatory for introduction to the dispensing tube 20 . however , it is to be understood that the previous placement of a ball on the tee 27 caused the ball numbered 1 to drop into the bottom of the dispensing tube 20 where it rests on a platform or pin 34 . therefore , any one of the series of balls which rests on the pin or platform 34 is the next ball to be dispensed when the actuating plate 25 has been depressed . in the position shown in fig2 which is preparatory for dispensing ball 1 onto the tee , the counter weight has previously caused the cylinder 16 to revolve to where the outside surface of the cylinder serves as a stop for the supply of balls in the feed tube 11 . when the actuating plate 25 has been depressed , as shown in fig3 by arrow 35 , the dispensing tube 20 pivots so that its dispensing end 36 conducts the ball 1 to the top of the tee 27 . at this point , actuation of plate 25 ceases and the counter weight 26 will cause the cylinder 27 to revert back to its originating position . however , ball number 2 from the feed tube 11 will now be on the inside of the cylinder 16 . in fig4 a transition illustration shows that the tube 20 is now returning to its start position wherein ball number 2 has now left the interior of the cylinder 16 via the opening 17 and the ball number 2 enters opening 18 so as to enter the passageway of dispensing tube 20 . as further illustrated in fig4 ball number 3 is now the lower ball in the series of stored balls within the feed tube 11 and is bearing against the outside surface of cylinder 16 preparatory for another actuation of the plate 25 . referring now to fig5 it can be seen that the dispensing tube 20 has returned to its original position for starting the next ball dispensing procedure . the fig5 position is identical to that shown in fig1 with the exception that ball number 2 , as shown in fig4 is now in its preparatory position for the next sequence as it rests against the stop or platform 34 and as shown in fig5 the ball has been renumbered to that of number 1 . depression of plate 25 causes the next sequence to occur , as previously described , and the ball number 1 will be placed onto the tee 27 . of course , a count will be made at every ball placement for commercial purposes . referring now to fig6 and 7 , views are shown of the inventive device in its stationary and ready position for dispensing of golf balls . it is to be understood that the opening 14 to the feed tube 11 may be attached to any convenient reservoir or supply of golf balls such as those which may be kept at a control station , club house or pro shop . it is also to be understood that the mechanism including linkages , bell cranks and even the counter 33 are of mechanical operation and that no electricity is required . the construction of the device is robust and will withstand damage or fatigue when placed in outdoor locations . again , it is to be understood that all that is necessary to operate the dispensing tube 20 so that a ball is placed on the top of tee 27 , is that the golfer need only place or push the end of his golf club against the actuating plate 25 . as force is placed downward on the plate , pivoting occurs so that the dispensing tube will assume the position shown in fig3 and the ball previously stored against the platform or pin 34 will roll by gravity feed through the tube for placement on the tee 27 . the force necessary to cause pivoting and downward movement of plate 25 is sufficient to overcome the force of the counter weight 26 . however , when that force is removed from the plate , the counter weight 26 will cause the cylinder 16 to rotate to its start position , as shown in fig1 and 2 . referring to fig8 another embodiment of the present invention is illustrated in the general direction of arrow 40 which includes an elongated housing 41 , arranged in a vertical orientation and which is resting on a simulated golf green pad 42 . the pad includes an opening 43 through which a conventional golf tee 44 is disposed . the housing 41 includes a pivoting , dispensing member 45 which rotates on the housing 41 by means of pivot connection 46 . it is to be noted that the opposite end of the dispensing member 45 includes an opening 47 through which the first golf ball is dispensed on to the tee 44 . the housing 41 is located from the hole 43 in such a manner that the hole 47 is indexed with the tee 44 or when the dispensing member 45 is pivoted as illustrated with respect to the first embodiment , a pedal or actuation member 48 is attached to the dispensing member 45 and may be actuated either by the foot of the user or the end of a golf club as previously described . a storage tube 50 is included in the housing 41 and outwardly projects from the top thereof with an opening for receiving a quantity of golf balls such as golf ball 51 . referring now in detail to fig9 it can be seen that the golf balls in storage tube 50 are fed into a cup 52 when in a rotatable receiver 53 . the lower most ball in the stack of golf balls in the storage tube 50 is automatically disposed in the cup 52 when the dispensing member 45 is in its fully pivoted or rotated position in order to place ball 54 onto the top of tee 44 . the receiver 53 is rotated about axle 55 when the receiver further includes a counter - weight identified by numeral 56 . therefore , when the device is in a position preparatory for use , a lower most ball in the sack will be disposed in the cup 52 and when the dispensing member 45 is actuated by depression of the lever or pedal 48 , the dispensing member will move into the position shown in fig9 and the ball which was previously in the member will be dispensed through the opening 47 . simultaneously , the next ball in the series in the storage tube so will be transferred to the cup 52 . it can be seen that a link or lever arm 57 has its opposite ends connected to the rotatable receiver 53 and to the dispensing member 45 . once the ball has been dispensed , the counter - weight 56 will cause opposite rotation of the receiver 53 to the position shown in fig1 . also , the dispensing member 45 will have pivoted in a clock - wise direction to it &# 39 ; s storage position in the housing 41 . in both fig9 and 10 , it can be seen that a stop - pin 58 prevents the ball in the dispensing member from falling further into the tube once it has been received into the member to an opening 60 . thus , both embodiments of the invention include storage of multiple golf balls with the bottom - most ball being received into cup in the receiver for eventual transfer to the opening in the dispensing member for placement onto a tee via an end opening on the member . in fig1 , the green pad 42 is illustrated as having an opening 61 which insertably receives a pin or plug 62 , so that the pad is properly centered and the tee properly placed on the plug 62 in alignment with opening 47 when the dispensing member 45 is fully deployed into position as shown in fig9 . the tee 44 may be held in position on the plug by any suitable means . while particular embodiments of the present invention have been shown and described , it will be obvious to those skilled in the art that changes and modifications may be made without departing from this invention in its broader aspects and , therefore , the aim in the appended claims is to cover all such changes and modifications as fall within the true spirit and scope of this invention .

an automatic golf ball placement device having a storage tube for holding a quantity of golf balls preparatory for placement onto a tee . one end of the tube receives the balls for storage while the opposite includes an opening for dispensing the first ball into a rotatable receiver for transfer to a dispensing shoot for delivery to the tee . the receiver is weighted so that upon placement of a ball on the tee , the receiver revolves back to the storage tube for accepting the next ball for dispensing onto the tee . a pedal attached to the receiver is actuated by a player &# 39 ; s foot or engagement with a golf club to urge rotation of the receiver to dispense the first ball .

to isolate detergent resistant membranes ( drms ) from a cell type including but not limited to primary or transformed lymphocytes . cells are washed in buffer a ( 100 mm nacl , 10 mm kcl , 10 mm egta , 10 mm imidazole , ph 6 . 8 ), then in tkm buffer ( 50 mm tris - hc1 , ph 7 . 4 , 25 mm kcl , 5 mm mgcl , and 1 mm egta ). to reduce proteolysis , the following protease inhibitors are included in buffer a : 2 mg / ml of leupeptin ( calbiochem novabiochem corp ., la jolla , calif . ); 5 mm pefa - bloc ( roche molecular biochemicals , indianapolis , ind . ); 1 % aproptinin ( sigma ); 1 % pepstatin a ( roche molecular biochemicals ); and 100 nm benzamidine ( sigma ). drms were prepared using a discontinuous sucrose density gradient . drms are located at the interface between 5 and 36 % sucrose . alternatively , isolation of low - density , triton x - 100 - insoluble membrane complexes is easily performed . briefly , cells were homogenized in 2 - morpholinoethanesulfonic acid ( mes )- buffered saline containing 1 % triton x - 100 ( unless otherwise indicated ), and sucrose was added to a final concentration of 40 %. a 5 to 30 % discontinuous sucrose gradient was layered on top of this detergent extract followed by ultracentrifugation [ 54 , 000 rpm in a rotor ( beckman coulter , fullerton , calif .)] for 18 to 24 hours at 4 ° c . in a tl - 100 ultracentrifuge ( beckman coulter ). successive gradient fractions were collected from the top and subjected to sds - page and western blot analysis . hiv - 1 rf viral supernatant from an infected jurkat cell line can be collected and clarified through a 0 . 45 μm filter . virus supernatant ( 10 ml ) can be co - cultured with purified lipid raft fractions as described above . these lipid raft / virus co - cultures serve as immunogens for the creation of novel antibodies . following hybridoma fusion to create monoclonal expressing immortalized b - cells , antibodies produced in this fashion can be mass screened to determine their effectiveness as neutralizing antibodies . the capacity of purified igg as well as whole serum , to neutralize hiv can be tested in an assay with phytohemagglutinin - stimulated peripheral blood mononuclear cells . briefly , antibodies or sera were incubated for 1 h at 37 ° c . with diluted tissue culture supernatant of virus - infected peripheral blood mononuclear cells ( 40 to 100 50 % tissue culture infective doses , 100 μl ). peripheral blood mononuclear cells ( 10 5 in 50 μl ) were added to the virus - antibody reaction mixture , and the mixture was incubated overnight . all dilutions were performed with rpmi 1640 medium ( gibco , life technologies ltd ., paisley , scotland ) supplemented with 10 % fetal calf serum , 3 mm glutamine , 20 iu of interleukin - 2 , and antibiotics . medium changes were performed on days 1 and 4 . seven days after infection , supernatants were collected and analyzed for hiv antigen by a capture elisa . the neutralization titer was defined as the reciprocal of the last dilution step that showed an 80 % or greater reduction in the od at 490 nm of the culture supernatant compared to that of hiv antibody - negative serum . beta - cyclodextrins β - cds ) are widely used as solubilizing agents , stabilizers , and inert excipients in pharmaceutical compositions ( see u . s . pat . nos . 6 , 194 , 430 ; 6 , 194 , 395 ; and 6 , 191 , 137 , each of which is incorporated herein by reference ). beta - cds are cyclic compounds containing seven units of α -( 1 , 4 ) linked d - glucopyranose units , and act as complexing agents that can form inclusion complexes and have concomitant solubilizing properties ( see u . s . pat . no . 6 , 194 , 395 ; see also , szejtli , j . cyclodextrin technol . 1988 ). the compositions and methods of the invention are exemplified using 2 - hydroxypropyl - β - cd ( 2 - oh - β - cd ). however , any β - cd derivative can be used in a composition or method of the invention , provided the β - cd derivative disrupts lipid rafts in the membranes of nerve cells . beta - cds act , in part , by removing cholesterol from cell membranes , and different β - cds are variably effective in such removal . for example , methyl - β - cd removes cholesterol from cell membranes very efficiently and quickly and , as a result , can be toxic to cells , which require cholesterol for membrane integrity and viability . in comparison , a β - cd derivative such as 2 - oh - β - cd can effectively remove cholesterol from cells without producing undue toxicity . thus , it will be recognized that a β - cd useful in a composition or method of the invention is one that removes cholesterol in an amount that disrupts lipid rafts , without substantially reducing cell viability ( see , for example , rothblat and phillips , j . biol . chem . 257 : 4775 - 4782 ( 1982 ), which is incorporated herein by reference ). beta - cds useful in the present invention include , but are not limited to , β - cd derivatives wherein one or more of the hydroxy groups is substituted by an alkyl , hydroxyalkyl , carboxyalkyl , alkylcarbonyl , carboxyalkoxyalkyl , alkylcarbonyloxyalkyl , alkoxycarbonylalkyl or hydroxy -( mono or polyalkoxy ) alkyl group or the like ; and wherein each alkyl or alkylene moiety contains up to about six carbons . substituted β - cds that can be used in the present invention include , for example , polyethers ( see , for example , u . s . pat . no . 3 , 459 , 731 , which is incorporated herein by reference ); ethers , wherein the hydrogen of one or more β - cd hydroxyl groups is replaced by c 1 to c6 alkyl , hydroxy - c 1 - c6 - alkyl , carboxy - c 1 - c6 alkyl , c 1 - c6 alkyloxycarbonyl - c1 - c6 alkyl groups , or mixed ethers thereof . in such substituted β - cds , the hydrogen of one or more β - cd hydroxy group can be replaced by c1 - c3 alkyl , hydroxy - c2 - c4 alkyl , or carboxy - c1 - c2 alkyl , for example , by methyl , ethyl , hydroxyethyl , hydroxypropyl , hydroxybutyl , carboxymethyl or carboxyethyl . it should be recognized that the term “ c1 - c6 alkyl ” includes straight and branched saturated hydrocarbon radicals , having from 1 to 6 carbon atoms . examples of β - cd ethers include dimethyl - β - cd . examples of β - cd polyethers include hydroxypropyl - p - β - cd and hydroxyethyl - β - cd ( see , for example , nogradi , “ drugs of the future ” 9 ( 8 ): 577 - 578 , 1984 ; chemical and pharmaceutical bulletin . 28 : 1552 - 1558 ( 1980 ); yakugyo jiho no . 6452 ( mar . 28 , 1983 ); angew . chem . int . ed . engl . 19 : 344 - 362 ( 1980 ); u . s . pat . no . 3 , 459 , 731 ; ep - a - 0 , 149 , 197 ; ep - a - 0 , 197 , 571 ; u . s . pat . no . 4 , 535 , 152 ; wo - 90112035 ; gb - 2 , 189 , 245 ; szejtli , “ cyclodextrin technology ” ( kluwer academic publ . 1988 ); bender et al ., “ cyclodextrin chemistry ” ( springer - verlag , berlin 1978 ); french , adv . carb . chem . 12 : 189 - 260 ; croft and bartsch , tetrahedron 39 : 1417 - 1474 , 1983 ; irie et al ., pharm . res . 5 : 713 - 716 , 1988 ; pitha et al ., internat &# 39 ; l . j . pharm . 29 : 73 , 1986 ; u . s . pat . no . 5 , 134 , 127 a ; u . s . pat . nos . 4 , 659 , 696 and 4 , 383 , 992 , each of which is incorporated herein by reference ; see , also , u . s . pat . no . 6 , 194 , 395 ). a method of the invention is performed , for example , by contacting an area of skin susceptible to viral release with a β - cd . as used herein , the term “ contacting ,” when used in reference to a β - cd and the pathogen or cells susceptible to a sexually transmitted pathogen , means that the β - cd is applied to the susceptible area such that it prevents viral budding through lipid rafts at nerve terminals . as described above , budding of hiv - 1 particles occurs at lipid rafts , which are characterized by a distinct lipid composition that includes high concentrations of cholesterol , sphingolipids , and glycolipids . since cholesterol plays a key role in the entry of some other viruses , the role in hiv - 1 entry of cholesterol and lipid rafts in the plasma membrane of susceptible cells was investigated . example 2 demonstrates that intact lipid rafts are necessary for viral infection . a β - cd derivative , 2 - hydroxypropyl - β - cyclodextrin ( 2 - oh - β - cd ), was used to deplete cellular cholesterol and disperse lipid rafts . as disclosed herein , removal of cellular cholesterol rendered primary cells and cell lines highly resistant to hiv - 1 - mediated syncytium formation and to infection by both cxcr4 - and ccr5 - specific strains of hiv - 1 virus . 2 - oh - β - cd treatment of the virus or cells partially reduced hiv - 1 binding , while rendering chemokine receptors highly sensitive to antibody - mediated internalization , but had no effect on cd4 expression . these effects were readily reversed by incubating cholesterol - depleted cells with low concentrations of cholesterol - loaded 2 - oh - β - cd to restore cholesterol levels . cholesterol depletion also made cells resistant to sdf - 1 - induced binding to icam - 1 through lfa - 1 . this may have contributed to the reduction in hiv - 1 binding to cells after treatment with the β - cd , since lfa - 1 contributes significantly to cell binding by hiv - 1 which , like sdf - 1α , can trigger cxcr4 function through gp120 . these results indicate that cholesterol is involved in the hiv - 1 co - receptor function of chemokine receptors and is required for infection of cells by hiv - 1 ( example 2 ). as discussed above , cholesterol , sphingolipids , and gpi - anchored proteins are enriched in lipid rafts ( see simons and ikonen , nature . 387 : 569 - 572 , 1997 ). the high concentration of cholesterol and sphingolipids in lipid rafts results in a tightly packed , ordered lipid domain that is resistant to non - ionic detergents at low temperature . the structural protein caveolin causes formation of flask - shaped invaginations ( caveolae ) in the cell membrane with a lipid composition very similar to that of lipid rafts ( schnitzer et al ., science 269 : 1435 - 1439 , 1995 ). signaling molecules , including lck , lat , nos , and g protein α subunit , are localized to rafts on the intracellular side of the membrane , and are targeted by lipid modifications such as palmitylation , myristylation , or both . in comparison , many other transmembrane proteins do not show a preference for lipid rafts ; for example , cd45 and e cadherin are excluded from these areas . certain lipid modified transmembrane proteins such as the ha molecule of influenza virus localize to lipid rafts . as disclosed herein , hiv - 1 buds selectively from lipid rafts of infected t cells ( example 1 ). in addition , semliki forest virus ( sfv ), measles viruses , influenza viruses , and polioviruses all assemble by raft association and , in the case of influenza virus , bud from lipid rafts ( see , for example , marquardt et al ., j . cell biol . 123 : 57 - 65 , 1993 ; manie et al ., j . virol . 74 : 305 - 311 , 2000 ; zhang et al ., j . virol . 74 : 4634 - 4644 , 2000 , each of which is incorporated herein by reference ). the involvement of lipid rafts in hiv - 1 biology beyond its role in virus budding has been further examined . as further disclosed herein , partial depletion of cholesterol from cell membranes using a β - cd inhibited hiv - 1 - induced syncytium formation in cell lines and primary t cells ( example 2 ). β - cd treatment of cells also increased cr internalization induced by monoclonal antibody ( mab ) binding . primary cells and cell lines were rendered resistant to infection cxcr4 - specific and ccr5 - specific hiv - 1 strains by treatment with 2 - oh - β - cd ( example 2 ). the effects observed were not due to loss of cell viability after treatment with the β - cd , and demonstrate that intact lipid rafts and cholesterol are required for hiv - 1 infection and syncytium formation . the present invention also provides compositions useful for reducing the risk of transmission of sexually transmitted disease . a composition of the invention contains a β - cd , which can be in a form suitable for topical administration to a subject , particularly intravaginal or intrarectal use , including a suppository or a bioadhesive polymer , which can provide timed release of the β - cd ( see , for example , u . s . pat . nos . 5 , 958 , 461 and 5 , 667 , 492 , each of which is incorporated herein by reference ); or can be formulated in combination with a solid substrate to produce a condom , diaphragm , sponge , tampon , a glove or the like ( see , for example , u . s . pat . nos . 6 , 182 , 661 and 6 , 175 , 962 , each of which is incorporated herein by reference ), which can be composed , for example , of an organic polymer such as polyvinyl chloride , latex , polyurethane , polyacrylate , polyester , polyethylene terephthalate , polymethacrylate , silicone rubber , a silicon elastomer , polystyrene , polycarbonate , a polysulfone , or the like ( see , for example , u . s . pat . no . 6 , 183 , 764 , which is incorporated herein by reference ). for topical administration , the β - cd can be formulated in any pharmaceutically acceptable carrier , provided that the carrier does not affect the activity of the β - cd in an undesirable manner . thus , the composition can be , for example , in the form of a cream , a foam , a jelly , a lotion , an ointment , a solution , a spray , or a gel ( see u . s . pat . no . 5 , 958 , 461 , which is incorporated herein by reference ). in addition , the composition can contain one or more additional agents , for example , an antimicrobial agent such as an antibiotic or an antimicrobial dye such as methylene blue or gentian violet ( u . s . pat . no . 6 , 183 , 764 ); an antiviral agent such as a nucleoside analog ( e . g ., azacytidine ), a zinc salt ( see u . s . pat . no . 5 , 980 , 477 , which is incorporated herein by reference ), or a cellulose phthalate such as cellulose acetate phthalate or a hydroxypropyl methylcellulose phthalate ( see u . s . pat . no . 5 , 985 , 313 , which is incorporated herein by reference ); a contraceptive ( see u . s . pat . no . 5 , 778 , 886 , which is incorporated herein by reference ); a lubricant , or any agent generally useful to a sexually active individual , provided the additional agent , either alone or in combination , does not affect the activity of the β - cd or , if it affects the activity of the β - cd , does so in a predictable way such that an amount of β - cd that is effective for reducing viral outbreak can be determined . a pharmaceutically acceptable carrier useful in a composition of the invention can be aqueous or non - aqueous , for example alcoholic or oleaginous , or a mixture thereof , and can contain a surfactant , emollient , lubricant , stabilizer , dye , perfume , preservative , acid or base for adjustment of ph , a solvent , emulsifier , gelling agent , moisturizer , stabilizer , wetting agent , time release agent , humectant , or other component commonly included in a particular form of pharmaceutical composition . pharmaceutically acceptable carriers are well known in the art and include , for example , aqueous solutions such as water or physiologically buffered saline or other solvents or vehicles such as glycols , glycerol , oils such as olive oil or injectable organic esters . a pharmaceutically acceptable carrier can contain physiologically acceptable compounds that act , for example , to stabilize or to increase the absorption of the β - cd , for example , carbohydrates , such as glucose , sucrose or dextrans , antioxidants , such as ascorbic acid or glutathione , chelating agents , low molecular weight proteins or other stabilizers or excipients . the pharmaceutical composition also can comprise an admixture with an organic or inorganic carrier or excipient suitable for intravaginal or intrarectal administration , and can be compounded , for example , with the usual non - toxic , pharmaceutically acceptable carriers for tablets , pellets , capsules , suppositories , solutions , emulsions , suspensions , or other form suitable for use . the carriers , in addition to those disclosed above , can include glucose , lactose , mannose , gum acacia , gelatin , mannitol , starch paste , magnesium trisilicate , talc , corn starch , keratin , colloidal silica , potato starch , urea , medium chain length triglycerides , dextrans , and other carriers suitable for use in manufacturing preparations , in solid , semisolid , or liquid form . in addition auxiliary , stabilizing , thickening or coloring agents and perfumes can be used , for example a stabilizing dry agent such as triulose ( see , for example , u . s . pat . no . 5 , 314 , 695 ). the β - cd also can be incorporated within an encapsulating material such as into an oil - in - water emulsion , a microemulsion , micelle , mixed micelle , liposome , microsphere or other polymer matrix ( see , for example , gregoriadis , liposome technology , vol . 1 ( crc press , boca raton , fla . 1984 ); fraley , et al ., trends biochem . sci ., 6 : 77 ( 1981 ), each of which is incorporated herein by reference ). liposomes , for example , which consist of phospholipids or other lipids , are nontoxic , physiologically acceptable and metabolizable carriers that are relatively simple to make and administer . “ stealth ” liposomes ( see u . s . pat . nos . 5 , 882 , 679 ; 5 , 395 , 619 ; and 5 , 225 , 212 , each of which is incorporated herein by reference ) are an example of such encapsulating materials particularly useful for preparing a pharmaceutical composition of the invention , and other “ masked ” liposomes similarly can be used , such liposomes extending the time that the β - cd remains at the site of administration . the amount a β - cd in a composition can be varied , depending on the type of composition , such that the amount present is sufficient to reduce viral outbreak or reduce severity of outbreak . an example of such an amount is about 1 to 100 mm , generally about 5 to 30 mm , when administered in an ointment , gel , foam , spray or the like , or about 0 . 1 to 2 grams , generally about 0 . 25 to 0 . 75 grams , when administered as a suppository or in combination with a solid substrate . an effective amount of a β - cd also can be measured in a weight : weight ( w : w ) or weight : volume ( w : v ) amount , for example , about 0 . 1 % to 3 % w : w with respect to a solid substrate or about 0 . 1 % to 3 % w : v with respect to a pharmaceutically acceptable carrier . in addition , an amount of a β - cd sufficient to reduce viral outbreak or decrease outbreak severity can be determined using routine clinical methods , including phase i , ii and iii clinical trials . currently , several hiv - 1 vaccine approaches are being developed , each with its own relative strengths and weaknesses . these approaches include the development of live attenuated vaccines , inactivated viruses with adjuvant peptides and subunit vaccines , live vector - based vaccines , and dna vaccines . envelope glycoproteins were considered as the prime antigen in the vaccine regimen due to their surface - exposure , until it became evident that they are not ideal immunogens . this is an expected consequence of the immunological selective forces that drive the evolution of these viruses : it appears that the same features of envelope glycoproteins that dictate poor immunogenicity in natural infections have hampered vaccine development . however , modification of the vaccine recipe through the use of raft / virus co - cultures to expose novel viral epitopes may overcome these problems . accordingly , there is a need in the art for new effective methods of identifying candidate sequences for vaccine development to prevent and treat hiv infection . the present invention fulfills this and other needs . “ antibody ” refers to a polypeptide substantially encoded by an immunoglobulin gene or immunoglobulin genes , or fragments thereof , that specifically bind and recognize an analyte ( antigen ). the recognized immunoglobulin genes include the kappa , lambda , alpha , gamma , delta , epsilon and mu constant region genes , as well as the myriad immunoglobulin variable region genes . light chains are classified as either kappa or lambda . heavy chains are classified as gamma , mu , alpha , delta , or epsilon , which in turn define the immunoglobulin classes , igg , igm , iga , igd and ige , respectively . an exemplary immunoglobulin ( antibody ) structural unit comprises a tetramer . each tetramer is composed of two identical pairs of polypeptide chains , each pair having one “ light ” ( about 25 kda ) and one “ heavy ” chain ( about 50 - 70 kda ). the n - terminus of each chain has a variable region of about 100 to 110 or more amino acids primarily responsible for antigen recognition . the terms variable light chain ( vl ) and variable heavy chain ( vh ) refer to these light and heavy chains , respectively . antibodies exist , for example , as intact immunoglobulins or as a number of well characterized antigen - binding fragments produced by digestion with various peptidases . for example , pepsin digests an antibody below the disulfide linkages in the hinge region to produce an f ( ab ′) 2 fragment , a dimer of lab which itself is a light chain joined to vh - ch1 by a disulfide bond . the f ( ab ′) 2 fragment can be reduced under mild conditions to break the disulfide linkage in the hinge region , thereby converting the f ( ab ′) 2 dimer into an fab ′ monomer . the fab ′ monomer is essentially an fab with part of the hinge region ( see , fundamental immunology , third edition , w . e . paul ( ed . ), raven press , n . y . ( 1993 )). while various antibody fragments are defined in terms of the digestion of an intact antibody , one of skill will appreciate that such fragments can be synthesized de novo either chemically or by utilizing recombinant dna methodology . thus , the term antibody , as used herein , also includes antibody fragments , such as a single chain antibody , an antigen binding f ( ab ′) 2 fragment , an antigen binding fab ′ fragment , an antigen binding fab fragment , an antigen binding fv fragment , a single heavy chain or a chimeric antibody . such antibodies can be produced by the modification of whole antibodies or synthesized de novo using recombinant dna methodologies . thus , an immunogenic composition to this subtype b ancestor protein will elicit broad neutralizing antibody against hiv - 1 isolates of the same subtype . an immunogenic composition to this subtype b ancestor protein will also elicit a broad cellular response mediated by antigen - specific t - cells . monoclonal antibodies ( mabs ) have been available for over 25 years and have revolutionized biomedical research , especially in the areas of disease diagnosis and the treatment of infection and diseases . the conventional method for the production of monoclonal antibodies involves hybridomas ( kohler & amp ; milstein , nature 256 : 495 - 7 , 1975 ). in this method , splenic or lymphocyte cells from a mammal which has been injected with antigen are fused with a tumor cell line , thus producing hybrid cells . these hybrid cells , or “ hybridomas ”, are both immortal and capable of producing the genetically coded antibody of a b cell . to select a hybridoma producing a single antibody , the hybridomas made by cell fusion are segregated by selection , dilution , and regrowth until a single genetically pure antibody - expressing cell line is selected . because hybridomas produce homogeneous antibodies against a desired antigen , they are called “ monoclonal ” antibodies . hybridoma technology has primarily been focused on the fusion of murine lines , but also human - human hybridomas , human - murine hybridomas , rabbit - rabbit hybridomas and other xenogenic hybrid combinations have been made . this example demonstrates that hiv - 1 budding occurs through lipid rafts , thereby accounting for the cholesterol - rich , sphingolipid - rich virus membrane , which bears gpi - linked proteins such as thy - 1 and cd59 , but lacks cd45 . the relative incorporation of gm1 , a ganglioside marker specific for lipid rafts , also was examined . using a soluble ctb binding assay , as much as 75 % of hiv - 1 was precipitated using goat anti - ctb and sac after treating the virus with gm1 - specific ctb . the ctb binding to virus was specific and dose dependent , and no virus was precipitated in the absence of ctb as measured by p24 elisa . these results demonstrate that the majority of hiv - 1 particles incorporate the lipid raft - specific marker gm1 . thy - 1 , cd59 , and gm1 colocalized with hiv - 1 proteins on infected cell uropods , which excluded cd45 . to determine the distribution of hiv - 1 proteins relative to gpi - linked proteins that serve as lipid raft markers , infected cells were subjected to immunofluorescence staining followed by confocal microscopy . expression of hiv - 1 proteins was localized to uropods projecting from one end of the cell . this capping pattern was seen on most cells in the infected cell culture . uropods protruding from hiv - 1 - infected cells have been described for adherent t cells . thy - 1 and cd59 both colocalized with cell surface hiv - 1 proteins , as shown by a superimposed green ( thy - 1 or cd59 ) and red ( hiv - 1 proteins ) fluorescence ( see nguyen and hildreth , supra , 2000 ; fig4 ). cells that were prefixed with 2 % paraformaldehyde before staining showed a similar appearance , indicating that the colocalization was not due to antibody crosslinking of viral and gpi - linked proteins . since the cells were not permeabilized before staining , the hiv proteins seen in these studies are likely gp41 and gp120 . this was confirmed in studies with anti - gp41 mab t32 in the colocalization studies . uninfected cells showed no capping of thy - 1 or cd59 . cd45 did not localize to areas of hiv - 1 protein expression and was excluded from uropods . the distribution of cd45 was unaffected by hiv - 1 infection , and the molecule remained evenly dispersed in patches all over the cell surface . these results confirm those obtained using the virus phenotyping studies . the ability of gm1 to colocalize on the cell surface with hiv - 1 proteins was examined to confirm the finding that gm1 was present on virions . gm1 staining was relatively faint with rabbit anti - gm1 antibody , but confocal microscopy showed colocalization of this molecule with hiv - 1 labeled cells . hiv - 1 proteins were detected in isolated lipid raft fractions . lipid rafts were purified by cell lysis and equilibrium centrifugation in order to confirm the presence of hiv - 1 proteins in these membrane structures . the fractions were assayed for the presence of viral and host proteins by immunoblot analysis . the separation of detergent - resistant lipid rafts was confirmed by the abundance of thy - 1 and cd59 in fractions 3 through 5 , while cd45 was present only in the bottom fractions 9 and 10 ( see nguyen and hildreth , supra , 2000 ; fig6 ). immunoblot detection of membrane fractions revealed that the hiv ma protein , p17 , and gp41 were both present in the detergent - insoluble lipid rafts of infected cells . by removing cholesterol , 2 - oh - β - cd is believed to partially perturb organized lipid rafts , resulting in dispersal of their components ( ilangumaran and hoessli , biochem . j . 335 : 433 - 440 , 1998 ). the capture of hiv - 1 by mabs against cd59 and gp41 decreased substantially after treating cells with 2 - oh - β - cd , as measured by the percentage of total p24 . cd45 capture remained unaffected . the effects on virus precipitation through gp41 indicate that intact lipid rafts are required for efficient gp41 incorporation into virions , since the overall cellular release of p24 actually increased after 2 - oh - β - cd treatment . results . 2 - oh - β - cd treatment blocked syncytium formation of primary cells and cell lines . the role of lipid rafts in the hiv - 1 fusion process was examined by treating cd4 + hiv - susceptible target cells with 2 - oh - β - cd to deplete membrane cholesterol and disperse lipid rafts . treatment of cells with 10 to 20 mm 2 - oh - β - cd for 1 hour at 37 ° c ., followed by washing to remove free 2 - oh - β - cd , depleted greater than 70 % of total cellular cholesterol without any loss in cell viability as measured by trypan blue exclusion . furthermore , treated cells continued to grow normally after 2 - oh - β - cd treatment when placed back into culture in cholesterol - containing medium . the non - toxicity of β - cd treatment was further demonstrated by finding 2 - oh - β - cd treated jurkat cells still showed ca 2 + flux responses to anti - cd3 mab .

disclosed is a novel application for β - cyclodextrin , and a novel technique for the creation of immunogens . topical application of β - cd inhibits or reduces the severity of viral outbreaks such as oral or genital herpes by disrupting lipid rafts , through which viral entry and outbreak occur . viral entry involves virus / lipid raft interaction , wherein the virus unfolds — only in lipid rafts — to enter the cell via the lipid raft . the invention provides a technique for creating immunogens with novel viral epitopes based on the virus / lipid raft interaction and viral unfolding . this fact can be exploited to create novel immunogens based on viral interaction with lipid rafts . the virus / lipid raft co - culture technique creates novel immunogens which will be used to create novel neutralizing monoclonal and polyclonal antibodies to fight viral disease such as hiv infection .

referring to the drawings , there is shown in fig1 to 3 a preferred embodiment of the invention . the tissue dispenser 10 is a u - shaped structure with a wall mounting bracket 12 and a pair arms 14 and 16 at right angles to the bracket . each arm has a coil spring 18 and 20 , respectively , molded in the arm to project inwardly , as shown in fig1 and 3 . the bracket 12 has a pair of screw holes 22 for attaching the tissue dispenser 10 to a wall . in fig1 and 2 , a roll of tissue r is shown supported by the coil springs 18 and 20 . to install the roll r , the cardboard cylindrical tube , t , in the center of the roll is fitted on the springs 18 and 20 . by pressing the roll r between the arms 14 and 16 , the coil springs 18 and 20 flex until the tube is in place . at which point , the coil springs 18 and 20 snap into the tube , and are smaller in diameter than recesses 22 &# 39 ; and 24 . by squeezing the tube to change its cross - sectional shape from round to oblong , the tissue can be payed from the roll r at a controlled rate . that is , the roll r will not freely rotate on the coil springs 18 and 20 . in fact , without squeezing the tube the roll r will not rotate as freely as it would on a roller found in most tissue holders . this is because as the roll turns the weight is not evenly supported around the coil springs , causing a drag on the roll &# 39 ; s rotation . manufacturing the tissue dispenser 10 may use a molding technique where the entire holder is integrally formed , or an assembly procedure where each arm is welded or attached in some manner to the bracket 12 . in either manufacturing method , the coil springs can be molded directly with the arms , or each arm can be bored and the coil springs bonded in the bores . since plastics and metals are simple to mold it is preferred to use a molding technique . however , it is possible to make wooden dispensers in one piece or assembled pieces . there are obviously a wide range of materials and manufacturing methods which can be used . turning to fig4 and 5 , the tissue dispenser 100 in this embodiment is made with two separate arms 102 and 104 . each arm has its own wall bracket portion 106 and 108 integrally formed with the arm . there are screw mounting holes 110 in the brackets for attaching the dispenser to a wall . the coil springs 112 and 114 are fixed to the arms 102 and 104 so that when the tissue dispenser 100 is mounted on a wall , they face each other . fig4 shows one of the arms , 102 , with a large knob end 116 and coil spring 112 fixed in the knob , recesses 118 , 120 larger than springs . with the separate arms and wall brackets of this embodiment , the tissue dispenser 100 can be adjusted to accommodate any size roll . for example , the same pair of arms 102 and 104 can be used as a holder for toilet tissue or paper towels even though the towels are much wider . installing a roll of tissue on dispenser 100 is exactly the same as described in the first embodiment . while two embodiments of the invention have been disclosed , it is understood that one skilled in the art could make changes in the invention without changing the inventive concept . therefore , one should study the drawings and the specification together with the claims to fully understand the invention . there is one simple illustration where changing the coil springs for resilient elements of rubber or similar materials would not change the invention .

a roll tissue dispenser having resilient members for supporting a roll of tissue by its center tube thus making a simple , easy loading and unloading device of this type .

an embodiment of an article of footwear in accordance with the principles of the present disclosure is described herein with reference to the figures . in the depicted embodiment the footwear is a boot 10 having a welted construction . it should be appreciated that the article of footwear according to the principles of the present disclosure is applicable to many different types of welted footwear ( e . g ., dress shoes , athletic shoes , winter boots , sandals , hiking boots , etc .). referring to fig1 , the boot 10 includes an upper portion 12 connected to an outsole 14 via a welt 16 . the upper portion 12 of an article of footwear is configured to hold the outsole 14 to a foot . in the depicted embodiment the upper portion 12 is also configured to protect a foot and an ankle of the person wearing the boot . in the depicted embodiment the upper portion 12 is constructed of leather . many other materials can also be used in the construction of the upper portion 12 ( e . g ., canvas , nylon , etc .). the outsole 14 is configured to engage the ground surface . in particular , the outsole 14 in the depicted embodiment includes a bottom surface 54 that is configured to contact the ground surface . in the depicted embodiment the bottom surface 54 includes a tread surface that provides grip . in the depicted embodiment the outsole includes a shock absorbing material ( e . g ., soft rubber , foam , gel , etc .) that is molded to the bottom surface 54 . in alternative embodiments , the shock absorbing material may be the same material that contacts the ground surface . also , it should be appreciated that the outsole can also include stiff material such as wood , plastic , metal or a combination of materials to provide auxiliary support in the midfoot portion of the footwear . the construction of the outsole 14 is described in greater detail below . referring to fig2 - 10 , an exploded assembly view the boot 10 is shown . the boot 10 includes a foot support platform 18 that is connected to the welt 16 and the outsole 14 . in some embodiments the foot support platform 18 supports a removable foot bed cushion 20 , which contacts the user &# 39 ; s foot . in other embodiments the user &# 39 ; s foot directly contacts the foot support platform 18 or non - removable ( e . g ., stitched and / or cemented ) foot bed cushion materials are provided over the foot support platform 18 . in the depicted embodiment the foot support platform 18 includes a first surface 22 ( an upper surface ) and a second surface 24 ( a lower surface ). the foot support platform 18 includes a downwardly extending rib 26 which extends from the second surface adjacent a periphery edge 28 of the foot support platform 18 . in the depicted embodiment the rib 26 includes an outer side wall 32 that is radiused to the periphery edge 28 and an inner side wall 34 that is generally vertical . the shape of the outer side wall 32 minimizes or eliminates the gaps between the upper portion 12 and the rib 26 where they are stitched together . in the depicted embodiment the foot support platform 18 is molded and the rib 26 is integrally molded to the foot support platform 18 . in the depicted embodiment a pliable material 30 ( e . g ., fabric ) is molded to the second surface 24 and to a portion of the rib 26 . the pliable material 30 can be any material that can make the rib 26 more tear resistance when molded thereto ( e . g ., a pliable material made by weaving , felting , knitting ). it should be appreciated that the pliable material can be a fabric made of natural fibers , synthetic fibers , or a combination of natural and synthetic fibers . in the depicted embodiment , the pliable material 30 is molded through a portion of the rib 26 such that a portion of the lower portion of the rib 26 is on one side of the pliable material 30 , and another portion of the rib 26 is on the other side of the fabric material . in the depicted embodiment the pliable material 30 is present on both the inner side wall 34 and the outer side wall 32 of the rib 26 . the pliable material provides the rib 26 improved tear resistance . in the depicted embodiment , the pliable material 30 is placed in a mold and polymeric molten material is molded to the pliable material 30 . in the area of the rib 26 the molten material is molded through the pliable material 30 , which results in portions of the rib 26 being on either side of the pliable material 30 . it should be appreciated that in alternative embodiments , the fabric 30 is molded over the rib 26 such that the fabric covers the rib 26 rather than extending through the rib 26 as depicted . in the depicted embodiment the welt 16 is stitched to a lower periphery edge of the upper portion 12 and to the rib 26 . in the depicted embodiment the stitches 36 that connect the welt to the upper portion and rib extend through the pliable material on both an inner side wall 34 and an outer side wall 32 portion of the rib 26 . in the depicted embodiment , the stitches 36 extend through two layers of the pliable material 30 when the stitch extends through the zone 53 of the rib 26 , which is shown between the dashed lines in fig1 . this configuration prevents separation due to the rib 26 tearing away from the foot support platform 18 due to stress applied to the rib 26 via the stitches . it should be appreciated that in some embodiments the stitches do not extend through both layers of the pliable material . in some embodiments the stitches extend through only one layer of pliable material and in other embodiments the stitches extend through no layers of pliable material . in the depicted embodiment the welt 16 is molded to the outsole 14 . the connection between the welt 16 and the outsole 14 does not include stitches . however , it should be appreciated that in alternative embodiments the welt 16 can be connected to the outsole with stitches ( e . g ., the welt can be stitched to a midsole structure that is cemented to the outsole ). in addition , in the depicted embodiment the welt 16 includes a flexible construction with a generally t - shaped cross - sectional profile . however , it should be appreciated that the welt can have many alternative configurations . for example , the welt 16 could be constructed of leather and have a generally l - shaped cross - sectional profile , the welt could include a nylon construction with a generally triangular cross - sectional profile , etc . in the depicted embodiment the foot support platform 18 includes a hindfoot zone 40 , a forefoot zone 42 , and a midfoot zone 44 . the forefoot zone 42 includes a metatarsal support area 46 and a toe support area 48 . the hindfoot zone 40 supports a person &# 39 ; s heel , the midfoot zone 44 support a person &# 39 ; s midfoot , the forefoot zone 42 support a person &# 39 ; s forefoot , the metatarsal support area 46 of the forefoot zone 42 supports a person &# 39 ; s metatarsals , and the toe support area 48 of the forefoot zone 42 supports a person &# 39 ; s toes . in the depicted embodiment the foot support platform 18 is substantially stiffer in the midfoot zone 44 than the hindfoot zone 40 . a relatively stiff material ( e . g ., glass reinforced nylon ) is molded into the midfoot zone 44 of the support platform 18 to provide additional support in the midfoot zone 44 . this added stiffness provides many advantages , including minimizing fatigue when the person wearing the boot 10 is standing on a ladder rung . the added stiffness in the midfoot zone 44 can avoid the need to provide a separate shank member in the outsole 14 . in the depicted embodiment the hindfoot zone 40 includes a resilient pliable construction that allows a person &# 39 ; s heel to press into the shock absorption materials in a heel area 56 of the outsole 14 . in the depicted embodiment , the hindfoot zone 40 is pliable and conforms to the shape of the person &# 39 ; s heel in use , thereby avoiding pressure points and hot spots in the heel area . in the depicted embodiment the toe support area 48 of the foot support platform 18 is substantially stiffer than the metatarsal support area 46 . conversely , the metatarsal support area 46 is more flexible than the midfoot zone 44 of the support platform 18 . the relative flexibility in the metatarsal support area 46 enables the person to easily flex the shoe when walking , while the stiffness in the toe support area 48 provides a platform for support for a protective toe covering ( fig1 and 16 ). the flexibility also allows shock to be transferred to and be absorbed by the shock absorption materials in the forefoot area 58 of the outsole 14 . in the depicted embodiment , the metatarsal support area 46 is pliable and conforms to the shape of the person &# 39 ; s foot , thereby avoiding pressure points and hot spots in the metatarsal area . in the depicted embodiment the rib 26 is notched in the metatarsal support area to provide added flexibility . the relative stiffness in the toe support area 48 provides axial support for a protective toe coverings ( e . g ., steel covering ) common in work boots . when the protective toe covering is pressed downward , the force is transferred onto the stiffer toe support area 48 , which distributes the force down to a relatively large area of the outsole 14 . the above - described configuration prevents the toe covering from substantially sinking down into the outsole 14 when impacted , and thereby helps to maintain a relatively constant vertical space in the toe box of the boot 10 when in use . in the depicted embodiment , the material used to mold the relatively flexible hindfoot zone 40 and the metatarsal support area 46 is thermoplastic polyurethane ( tpu ), the relatively stiffer material 50 used to mold a portion of the midfoot zone 44 and toe support area 48 is glass reinforced nylon ( fig9 and 10 ). the construction of the midfoot zone 44 is at least ten percent stiffer than the construction of the hindfoot zone 40 . the toe support area 48 is at least ten percent stiffer than the construction of the metatarsal support area 46 . the toe support area 48 is at least ten percent stiffer than the construction of the hindfoot zone 40 , and the midfoot zone 44 is at least ten percent stiffer than the metatarsal support area 46 . in the depicted embodiment midfoot zone 44 is sufficiently stiff to prevent the midfoot from significant bending when a person stands on a ladder rung , the hindfoot zone 40 is sufficiently soft to conform to a person &# 39 ; s heel , the metatarsal support area 46 is sufficiently flexible to allow the metatarsal area of the shoe to bend in use , and the toe support area 48 is sufficiently stiff to distribute the force applied from the toe covering to a larger area of the outsole 14 . in the depicted embodiment the midfoot zone 44 includes an integrally molded dog bone shaped shank member that provides stiffness . in the depicted embodiment the transition between the zones ( e . g ., line 84 ) is wavy rather than straight and does not have abrupt corners . this construction avoids stress concentration at the transitions as a result of the bending of the platform and results in overlap between the zones in the longitudinal direction . it should be appreciated that many alternative constructions are possible , including transition with sharp corners , straight line transition , or overlaps in the vertical direction . in the depicted embodiment the outsole 14 is a multi material type body that is directly connected to the upper 12 . the outsole 14 includes a shock absorption portion 52 that is molded into the portion that is configured to engage the ground surface 54 , otherwise referred to herein as the tread . in the depicted embodiment , the shock absorption portion 52 of the outsole 14 is molded to the pliable material 30 on the second surface of the foot support platform 18 . in the depicted embodiment the shock absorption portion 52 is delivered into the cavity defined by the tread portion 54 and the bottom surface 24 of the foot platform 18 . this step adheres the outsole 14 to the support platform 18 , and thereby also connects the outsole 14 to the upper . in the depicted embodiment softer materials are molded into the heel areas 56 and the forefoot areas 58 of the shock absorption portion 52 of the outsole 14 . in the depicted embodiment gel - like materials are molded in these areas . in some embodiments the softer materials are preformed and provided as inserts into the heel areas 56 and forefoot areas 58 . in an alternative embodiment , the tread portion of the outsole may be constructed of the same material that is used to construct the shock absorption portion . in such embodiments , the outsole 14 may still be directly connected to the upper via molding . in such an embodiment , molten outsole material would be provided in a cavity defined by a mold portion and the bottom surface 24 of the foot support platform 18 . it should be appreciated that the foot support platform 18 can also be used in construction where the outsole is indirectly attached to the upper . in such embodiments the outsole can be preformed . in such embodiments one surface of a midsole can be cemented to the bottom surface 24 of the foot support platform 18 , and another surface of the midsole can be cemented to the outsole . in such an embodiment the welt can also be stitched to the foot support platform 18 , the midsole , and the outsole . referring to fig1 - 14 an alternative embodiment of the foot support platform is shown . in the depicted embodiment the foot support platform 60 is similar to the support platform 18 as it also includes a hindfoot zone 62 , a forefoot zone 64 , and a midfoot zone 66 . moreover , the forefoot zone 64 includes a metatarsal support area 68 that is less stiff than a toe support area 70 . the support platform 60 further includes a toe cap retaining structure 72 . in the depicted embodiment the toe cap retaining structure 72 includes a ramp 74 having a curved forward raised edge 76 . in the depicted embodiment forward raised edge 76 is configured to engage a portion of a toe cap ( e . g ., a flange on the toe cap ). in the depicted embodiment the raised edge 76 has a height h of about 1 . 0 mm . it should be appreciated that the height can vary from application to application ( e . g ., in another embodiment h could be between 0 . 5 mm and 5 . 0 mm ). the raised edge defines the front arc shape of the ramp 74 . the toe cap retaining structure 72 is configured to engage the toe cap wherein the toe cap has a different profile than the arc shape raised edge . for example , if the toe cap has a curvature that is greater than the radius of curvature of the ramp , the toe cap will engage the raised edge along the center line . see , for example , fig1 a . however , if the toe cap has a curvature that is less than the radius of curvature of the front of the toe cap , the toe cap will engage the raised edge on either side of the center line . see , for example , fig1 b . the configuration enables a certain size toe cap to fit with a variety of side support platforms . in the depicted embodiment the ramp has a sloped profile that transitions the plane of the toe support area upward towards the upper surface of the flange 78 of the toe cap 80 . see fig1 . in the depicted embodiment the ramp slopes upward from the upper surface of the platform in 180 degrees ( both in the forward direction and towards each side ). see fig1 ( see arc 73 identifying the location where the ramp begins to slope upward ). in the depicted embodiment a securing layer 82 is cemented over the ramp 74 and the flange 78 of the toe cap to secure the toe cap 80 down on the platform 60 . the securing layer can be , for example , a fibrous board material ( e . g ., texon ). it should be appreciated that the toe cap retaining structure 72 can have many different configurations . for example , alternatively , the toe cap retaining structure can be a raised rib with a squared off edge rather than a ramp shaped wedge , or the toe cap retaining structure can also be raised spaced apart posts . in addition , the toe cap retaining structure could also be a recess in the foot support platform . in the depicted embodiment the toe cap retaining structure 72 is molded integrally as part of the support platform 60 . it should be appreciated that the toe cap retaining structure can be attached in many other ways ( e . g ., cemented , riveted , stitched , etc .). the above specification , examples and data provide a complete description of the manufacture and use of the composition of the invention . since many embodiments of the invention can be made without departing from the spirit and scope of the invention , the invention resides in the claims hereinafter appended .

the present disclosure provides an improved welted footwear and related method of manufacture . the welted footwear and related method of manufacturing is directed to a molded foot support platform that provides a number of advantageous features .

referring now to the drawings , one embodiment of the livestock waterer 4 can be seen in perspective in fig1 positioned to demonstrate the three dimensional shape of the structure . mounting points 6 can be used to secure the invention to a surface such as a concrete platform with the use of a selected type of mounting hardware . mounting recesses 8 allow easier access to the mounting points 6 and ease in the facility of accessing the chosen mounting hardware . livestock waterer 4 includes a housing 12 which comprises two basins 10 separated by an elevated enclosure 7 . the housing 12 further comprises front and rear longitudinal sidewalls 5 , 13 and opposing end walls 9 , 11 . sidewalls 5 , 13 , end walls 9 , 11 and elevated enclosure 7 are formed integrally of polymeric material . lids 14 substantially cover the opening of basins 10 . lids 14 are buoyant , preferably hollow and are made from a polymeric material . lids 14 preferably float on the surface of water contained within each basin 10 . pass through openings 16 in the lids 14 allow guides 18 to pass through the lids 14 . guides 18 each consist of elongate vertically disposed rods which extend into basin 10 and are fixed at the bottom of basin 10 . guides 18 are also retained in an upstanding orientation by their attachment to guide mounts 20 atop opposing end walls 9 , 11 or by attachment to the sidewalls 15 of elevated enclosure 7 . guides 18 are spaced apart from basin sides a small distance . preferably one guide 18 is located along each opposite side of the basins 10 . a top access panel 22 on the top of the elevated enclosure 7 is removable to access equipment such as a float valve ( not shown ) within elevated enclosure 7 . recess 25 facilitates removal of the top access panel 22 . side access panel 26 is selectively removable from the livestock waterer 4 and provides access to the interior of the elevated enclosure 7 . plugs 28 are received in openings 30 in end walls 9 , 11 to seal openings 30 which are in communication with the basins 10 . the plugs 28 are selectively removable and once removed , allow water to drain from the basins 10 . details of the structure of each lid 14 may be seen in fig2 and 3 . each lid 14 includes an upper surface 50 and an underside 70 . upper surface 50 of each lid 14 is preferably convex in shape and upper surface 50 may be formed as a segment of a cylinder or may otherwise be domed in shape . peripheral regions 57 of upper surface 50 may be planar though they are not required to be so . peripheral regions 57 of upper surface 50 are preferably kept minimal in area to provide little planar surface on which water may collect . lid 14 is preferably hollow with upper surface 50 sealed at side edges 80 , 82 , 84 and 86 to underside 70 so that air is trapped within lid 14 and it is buoyant . as seen specifically in fig3 , the underside 70 of lid 14 is substantially planar . a baffle system 61 depends from the underside 70 . baffle system 61 comprises transverse walls 60 , 68 and longitudinal walls 62 , 66 , each of which are generally perpendicular to the underside 70 of lid 14 . bottom edges 74 of baffle system 61 may be parallel to underside 70 and may extend approximately one to five ( preferably two to three ) inches from underside 70 of lid 14 . the baffle system 61 may be integral with the other structures of lid 14 . longitudinal walls 62 , 66 of baffle system 61 extend substantially the length of underside 70 but are interrupted by gaps 71 therein . in the preferred embodiment transverse walls 60 , 68 interconnect longitudinal walls 62 , 66 at a substantial perpendicular near distal ends 64 , 69 of longitudinal walls 62 , 66 . distal ends 64 , 69 of longitudinal walls 62 , 66 extend past their intersections with transverse walls 60 , 68 a short distance which , in the case of a lid 14 which is of a total length of approximately thirty - six inches , may be one to two inches . distal ends 64 , 69 may be inclined from bottom edge 74 at twenty to seventy degrees and preferably from thirty to sixty degrees . proximal edges 72 , 73 of longitudinal walls 62 , 66 extend approximately ten to twelve inches past transverse walls 60 , 68 in the case of a lid 14 of length in the range of thirty - six inches . longitudinal walls 62 , 66 are longitudinally aligned with proximal ends 72 , 73 thereof spaced apart from one another to form gaps 71 . proximal ends 72 , 73 may be inclined at ten to eighty degrees from perpendicular to underside 70 preferably at 30 to 60 degrees . gaps 71 between proximal ends 72 , 73 of longitudinal walls 62 , 66 are critical in providing turbulence damping so that air is not trapped between longitudinal walls 62 , 66 and transverse walls 60 , 68 below lid 14 . the gaps 71 separate baffle system 61 into first set of baffles 63 and a second set of baffles 67 . the second set of baffles 67 mirrors the first set of baffles 63 in the preferred embodiment . the baffle system 61 interrupts and abates the wave motion of the water caused when an animal manipulates lid 14 to access the water . the baffle system 61 may be formed on underside 70 as an integral part of lid 14 and each wall 60 , 62 , 66 and 68 may be hollow . a second embodiment of the invention is seen in fig4 and fig5 . livestock waterer 104 shares many of the structures and characteristics of the embodiment detailed in fig1 - 3 . mounting recesses 108 allow access to mounting points 106 which can be fitted with hardware to anchor the livestock waterer 104 to a ground surface . livestock waterer 104 contains basins 110 set in housing 112 . the housing 112 further comprises front and rear longitudinal sidewalls 105 , 113 and opposing end walls 109 , 111 . recess 125 allows a top access panel 122 to be removed easier . the top access panel 122 and side access panel 126 are selectively removable and allow access to the interior of the elevated enclosure 107 . a lid 114 substantially covers each of basins 110 . openings 116 in lids 114 allow guides 118 to pass through lids 114 . guide mounts 120 extend from the sidewalls 105 , 113 and secure the guides 118 . guides 118 are further secured by being anchored to bottom 141 of basins 110 . now referring to fig5 , a cross - sectional view shows more detail of the second embodiment livestock waterer 104 . cavity 140 within the livestock waterer 104 extends to the bottom 141 of basin shelf 142 . housing 112 comprises end walls 109 , 111 which cooperate with basin shelf 142 and longitudinal sidewalls 105 ( seen in fig4 ), 113 to define cavity 140 . sidewalls 115 of elevated enclosure 107 , end walls 109 , 111 , longitudinal sidewalls 105 , 113 and basin shelf 142 cooperate to define basins 110 which are elevated above a ground surface . longitudinal sidewalls 105 , 113 , sidewalls 115 of elevated enclosure 107 and end walls 109 , 111 can be seen to be an integral one - piece polymeric structure formed by molding . a water supply pipe ( not shown ) may traverse cavity 140 and pass through basin shelf 142 to enter central fill tub 146 . float compartment 144 adjoins central fill tub 146 and provides a location far a float valve ( not shown ) from which central fill tub 146 is filled . the water enters the basins 110 via ports 148 which connect basins 110 with central fill tub 146 . lids 114 are buoyant and are supported on water surface 132 within basins 110 . therefore , lids 114 rise with the addition of water to the basins 110 . lids 114 slide vertically on guides 118 as water is added to or removed from the basins 110 and as animals seeking water depress lids 114 to gain access to water below lids 114 . once basins 110 are filled to a desired level with water , a float valve ( not shown ) located in elevated enclosure 107 closes to prevent further inflow of water from a water source . an animal gains access to the water by pushing lid 114 downward . as the animal exerts downward force , the lid 114 partially submerges and water rolls over upper surface 150 . once the animal ceases to exert downward force on lid 114 , water rolls off convex lid 114 and the lid 114 returns to its floating position on top of water contained in basin 110 . again referring to fig5 , basin floor 154 contains elements aiding in the heating of the water contained in basins 110 . post 152 extends from basin floor 154 and may be integrally formed with basin floor 154 . in the preferred embodiment , post 152 is cylindrical . the shape and size of post 152 is selected such that heater 156 may attach to the periphery of post 152 . the heater is positioned in the middle of basin floor 154 in such a way so it cannot be accessed by an animal drinking from the livestock waterer 104 . as water is removed from the livestock waterer by the animals or through evaporation , the lids 114 descend toward the basin floor 154 . the baffle system 161 of lids 114 of livestock waterer 104 depend from underside 170 of lids 114 to a distance of at least the height of post 152 . this minimal length assures water will always sufficiently cover the heater 156 and minimize overheating of heater 156 . again referring to fig4 and fig5 , the basin floor 154 may be sloped to provide enhanced emptying and cleaning of the livestock waterer 104 . once plugs 128 are removed from openings 130 , water drains from basins 110 . the top access panel 122 and side access panel 126 allow a person to more easily access a heating element or water supply within the housing 112 . fig6 discloses a lid 114 for the embodiment of the livestock waterer 104 of fig4 . lid 114 comprises an upper convex surface 150 and an underside 170 which is substantially planar . baffle systems 161 depend from underside 170 and each comprises a transverse wall 163 joined perpendicularly to longitudinal walls 162 and 166 which are spaced apart . each of longitudinal walls 162 and 166 inclines from its attachment to transverse wall 163 to the underside 170 , leaving a small gap between baffle systems 161 approximately midway along underside 170 . walls 162 , 163 , 166 each preferably depends at a substantial perpendicular from underside 170 . in the foregoing description , the container has been described in connection with preferred embodiments , but it should be understood that the description does not intend to limit the container to the embodiments described . rather , this description is intended to include such alternatives , modifications and equivalents as may be included in the sphere and scope of this invention , as more particularly set forth in the claims .

a livestock waterer for use in frigid climates includes a lid which floats on the surface of the water in each basin of the waterer . the lid is hollow with a convex upper surface and with baffle walls depending from the underside of the lid . the baffle walls interrupt wave action on the surface of the water created by depression of the lid into the water when an animal presses down on the lid to gain access to the water . the floor of each basin is provided with an integrally formed mounting post to support a heater within the basin . the baffles walls prevent exhaustion of water within the basin thereby preserving submersion of the heater at all times .

since the discovery of therapeutic effects of inhaled smoke of cannabis , the chemical origins of the therapeutic effects have been an intense area of research . the primary focus of the research into the chemical origins of the therapeutic effects of cannabis has been centered around a class of active compounds called cannabis phytocannabinoids . phytocannabinoids , also referred to as cannabinoids , refer to a group of c 21 terpenophenolic compounds that are uniquely produced in cannabis . the most widely known phytocannabinoid is tetrahydrocannabidol ( thc ), which is known to be responsible for producing psychoactivity commonly associated with cannabis . since the isolation of thc , other phytocannabinoids have been isolated and some have been associated with therapeutic effects . while over 100 phytocannabinoids are known to exist , a group of well - documented phytocannabinoids include tetrahydrocannabidol ( thc ), cannabidiol ( cbd ), cannabichromene ( cbc ), cannabigerol ( cbg ), tetrahdrocannabivarin ( thcv ), cannabidivarin ( cbdv ) and cannabinol ( cbn ). some of the therapeutic effects of phytocannabinoids include , without being bound to any theory , euphoric effects ( associated , for example , with thc and thcv ), analgesic effects ( associated , for example , with thc , cbd and thcv ), sedative effects ( associated , for example , with cbd ), antipsychotic effects ( associated , for example , with cbd ), anti - inflammatory effects ( associated , for example , with thc , cbd , cbc , cbg and cbn ), anti - convulsant effects ( associated , for example , with cbd and cbn ), anti - biotic effects ( associated , for example , with cbc , cbn and cbg ), and anti - fungal effects ( associated , for example , with cbc and cbg ), to name a few . under certain circumstances , there may be synergistic enhancement of certain therapeutic effects in naturally occurring cannabis when certain amounts and / or ratios of phytocannabinoids are present in combination . for example , an overall enhancement in therapeutic effects of cannabis may be achieved when a certain balance is struck between thc and cbd . for example , sedative effects of cbd may serve to oppose certain undesirable effects of thc , such as anxiety , thereby enhancing the overall therapeutic effects . other isolated compounds of cannabis may have certain therapeutic effects when inhaled as part of cannabis smoke , including terpenoids , flavonoids , and phytosterol . terpenoids are derived from repeating units of isoprene ( c 5 h 8 ), such as monoterpenoids ( with c 10 skeletons ), sesquiterpenoids ( c 15 ), diterpenoids ( c 20 ), and triterpenoids ( c 30 ). the final structure of terpenoids can range from simple linear chains to complex molecules and may simply be a hydrocarbon , or may include alcohol , ether , aldehyde , ketone , or ester functional groups attached to a carbon skeleton . as used herein , the term terpenoids include terpenes . over 200 naturally occurring terpenoids have been identified and isolated from cannabis . such terpenoids include d - limonene , α - pinene , β - myrcene , linalool , pulegone , 1 , 8 - cineole ( eucalyptol ), α - terpineol , terpineol - 4 - ol , p - cymene , borneol , δ - 3 - carene , β - caryophyllene , caryophyllene oxide , nerolidol , and phytol . some of the therapeutic effects of terpenoids include , without being bound to any theory , analgesic effects ( associated , for example , with β - myrcene ), sedative effects ( associated , for example , with linalool , pulegone and α - terpineol ), antidepressant effects ( associated , for example , with linalool and d - limonene ), anti - inflammatory effects ( associated , for example , with β - myrcene , β - caryophyllene , 1 , 8 - cineole , α - pinene and δ - 3 - carene ), anti - mutagenic effects ( associated , for example , with β - myrcene and d - limonene ), anti - biotic effects ( associated , for example , with β - myrcene , 1 , 8 - cineole , p - cymene , terpineol - 4 - ol , borneol and α - pinene ), and acetylcholinesterase ( ache ) inhibitor effects ( associated , for example , with pulegone , p - cymene , terpineol - 4 - ol and α - terpineol ), to name a few . it will be appreciated that , under certain circumstances , there may be synergistic enhancement of certain therapeutic effects in naturally occurring cannabis when certain amounts and / or ratios of terpenoids are present in combination . in addition , under certain circumstances , when phytocannabinoids and terpenoids are simultaneously present in cannabis , there may also be cross - compound synergistic effects . that is , the therapeutic effects obtained from cannabis having certain combinations of some phytocannabinoids and some terpenoids is greater than the sum of therapeutic effects obtained from the phytocannabinoids or the terpenoids taken alone . for example , without being bound to any theory , analgesic effects of thc may be synergistically boosted by various terpenoids , anticonvulsant effects of cbd and thcv may be synergistically boosted by linalool , anti - inflammatory / antifungal effects of cbc and cbg may be synergistically boosted by caryophyllene oxide , anti - inflammatory / analgesic effects of cbc may be synergistically boosted by various terpenoids , sedative effects of cbn may be synergistically boosted by β - myrcene and nerolidol , to name just few examples of synergistic effects when phytocannabinoids and terpenoids are inhaled together as part of cannabis smoke . naturally occurring therapeutic compounds in cannabis , including phytocannabinoids and terpenoids , are synthesized in secretory cells inside glandular trichomes of cannabis . in addition , different strains of cannabis produce and can be bred to produce varying amounts of certain compounds . for example , common “ street ” cannabis may have been bred such that relatively high amounts of thc are present to maximize the “ high ” of the person using the cannabis for recreational purposes . the same strain of “ street ” cannabis , however , may not have been bred to maximize , and therefore contain less than desired amounts of terpenoids or phytocannabinoids other than thc . as a result , while the effect of such cannabis strain as a euphoriant may be relatively high , their therapeutic effects may be relatively low . therefore , to improve the therapeutic effects and to target certain therapeutic effects from cannabis , attempts to cultivate different strains of cannabis having particular combinations and amounts of specific phytocannabinoids and terpenoids have been made . however , such effort has been time consuming and not necessarily aimed at mass cultivation to serve the general public . while some terpenoids naturally occur in cannabis , terpenoids also naturally occur in plants other than cannabis . as with cannabis , terpenoids in some plants give rise to the distinctive odor of the plants . for example , d - limonene occurs naturally in citrus plants , and is the predominant compound that gives rise to the familiar scent of citrus . similarly , α - pinene occurs naturally in coniferous plants and is the predominant compound that gives rise to the familiar scent of pine . thus , some terpenoids , such as d - limonene and α - pinene , occur relatively abundantly . it has been found that the therapeutic effects of smoking herbs may be tailored by varying the terpenoid composition of the smoking herbs . in some embodiments the smoking herb may be cannabis and the therapeutic effects may include synergistic effects between the phytocannabinoids that are naturally present in a particular strain of cannabis and terpenoids that may be isolated from plants other than the particular strain of cannabis or other than cannabis in general . the terpenoids may be added to a preparation made from the particular strain of cannabis and may provide a terpenoid concentration that is just as high , if not higher , than terpenoid levels that are naturally occurring in , for example , other cannabis strains . thus , in some embodiments , the terpenoid added to the smoking herb preparation may be at a higher concentration than that naturally found in the smoking herb or the terpenoid may not be naturally produced by the smoking herb plant at all . it will be appreciated that adding desired types and amounts of terpenoids from plants other than the particular strain cannabis can offer several advantages . for example , terpenoids from other plants can be economically favorable compared to , for example , breeding particular strains of cannabis having similar types and amounts of terpenoids . in addition , the desired types and amounts can be targeted more specifically to enhance or magnify known therapeutic effects , or even create new therapeutic effects that may not be possible using natural or engineered strains of cannabis alone . reference will now be made to the drawings , in which like numerals refer to like parts throughout . fig1 is a flow chart illustrating a method 10 of preparing an herbal smoking blend , according to some embodiments . the method of preparing an herbal smoking blend comprises providing 20 a smoking herb preparation . the method additionally includes providing 30 a terpenoid solution comprising a terpenoid . the method further includes adding 40 the terpenoid solution to the smoking herb preparation . in some embodiments , providing 20 the smoking herb preparation includes providing a smoking herb including smoking cannabis , including any species , subspecies , strain or variety of cannabis . the herb preparation can include any part of the plant of the cannabis , including the leaf , the root , the stem , the flower , or any other part of the plant that occurs naturally . in some embodiments , the smoking herb includes cannabis plants cultivated for fiber and seed production , sometimes described as low - intoxicant , non - drug , or fiber types . in some other embodiments , the smoking herb includes cannabis plants cultivated for drug production , sometimes described as high - intoxicant or drug types . in some other embodiments , the smoking herb includes cannabis plants that are escaped , hybridized , or wild forms of either of the above types . in some embodiments , a preparation includes smoking herb that has been sufficiently dried so that it can be combusted under ordinary ambient conditions , such that the resulting smoke can be inhaled . in some embodiments , a preparation includes a smoking herb and a rolling paper that can be used to roll the smoking herb into a thin cylinder using a rolling paper , similar to a cigarette . in other embodiments , providing 20 the smoking herb preparation can include providing a smoking herb other than cannabis . examples of other smoking herbs include amaranthus dubius , arctostaphylos uva - ursi , argemone mexicana , arnica , artemisia vulgaris , calea zacatechichi , canavalia maritima , cecropia mexicana , cestrum nocturnum , cynoglossum virginianum , cytisus scoparius , entada rheedii , eschscholzia californica , fittonia albivenis , hippobroma longiflora , humulus japonica , humulus lupulus , lactuca virosa , laggera alata , leonotis leonurus , leonurus cardiaca , leonurus sibiricus , lobelia cardinalis , lobelia inflata , lobelia siphilitica , nepeta cataria , nicotiana ( i . e ., tobacco ), nymphaea alba , opium poppy , passiflora incarnate , pedicularis densiflora , pedicularis groenlandica , salvia divinorum , salvia dorrii , salvia , scutellaria galericulata , scutellaria lateriflora , scutellaria nana , scutellaria , sida acuta , sida rhombifolia , silene capensis , syzygium aromaticum , tagetes lucida , tarchonanthus camphoratus , turnera diffusa , verbascum , and zornia latifolia , to name a few . in some embodiments , providing 20 the smoking herb preparation comprises providing a smoking herb comprising at least one phytocannabinoid , such as a phytocannabinoid selected from the group consisting of delta - 9 - tetrahydrocannabinol ( thc ), cannabidiol ( cbd ), cannabichromene ( cbc ), cannabigerol ( cbg ), tetrahydrocannabivarin ( thcv ), cannabidivarin ( sbdv ) and cannabinol ( cbn ). in some embodiments , providing 20 the smoking herb preparation comprises providing a smoking herb other than cannabis . in some embodiments , for example where a synergistic effect between a phytocannabinoid and terpenoids is desired , the smoking herb other than cannabis may comprise at least one added phytocannabinoid , such as a phytocannabinoid selected from the group consisting of delta - 9 - tetrahydrocannabinol ( thc ), cannabidiol ( cbd ), cannabichromene ( cbc ), cannabigerol ( cbg ), tetrahdrocannabivarin ( thcv ), cannabidivarin ( sbdv ) and cannabinol ( cbn ). still referring to fig1 the illustrated method of method 10 of preparing an herbal smoking blend additionally includes providing 30 a terpenoid solution comprising a terpenoid . as used herein , a terpenoid solution refers to a mixture comprising a terpenoid and a solvent , where at least a portion of the terpenoid is incorporated in the mixture to form the terpenoid solution . the terpenoid can be miscible , immiscible , or partially miscible in the solvent . in embodiments where the terpenoid is at least partially immiscible , the resulting mixture is sometimes referred to as an emulsion . in some embodiments , providing 30 the terpenoid solution includes providing a solution including a terpenoid selected from the group consisting of d - limonene , α - pinene , β - myrcene , linalool , pulegone , 1 , 8 - cineole ( eucalyptol ), α - terpineol , terpineol - 4 - ol , p - cymene , borneol , δ - 3 - carene , β - caryophyllene , caryophyllene oxide , nerolidol , phytol , eugenol , sabinene , linalyl acetate , camphor , chamazulene , beta - farnesene , alpha - humulene , benzyl benzoate , benzyl acetate , geraniol , geranyl acetate , gamma - terpinene , beta - pinene , and combinations thereof . in some embodiments , providing 30 the terpenoid solution comprises providing a terpenoid and a solvent , and mixing the terpenoid and the solvent . the solvent can include any liquid , e . g ., a volatile liquid , which can incorporate a desired amount of the terpenoid in the terpenoid solution . as used herein , a liquid that incorporates the terpenoid includes a liquid that can hold the terpenoid in either dissolved form or undissolved form ( e . g ., suspended in the form of an emulsion ). in some embodiments , a terpenoid solution having a terpenoid incorporated therein can be a solution having at least 0 . 1 % terpenoid by volume at room temperature and atmospheric pressure . in some embodiments , the solvent comprises an alcohol , e . g ., ethanol , and water . in some embodiments , the terpenoid solution comprises about 1 % to about 5 % by volume of the terpenoid , about 40 % to about 90 % by volume of ethanol and about 10 % to about 55 % by volume of water . in some embodiments , the terpenoid solution comprises about 2 % to about 4 % by volume of the terpenoid , about 66 % to about 80 % by volume of ethanol and about 20 % to about 30 % by volume of water . advantageously , such a solution can allow the terpenoid to be evenly distributed or suspended in the solvent , thereby facilitating the formation of a homogenous solution that allows a desire quantity of terpenoid to be added to a smoking herb preparation . still referring to fig1 , in some embodiments , the terpenoid in the terpenoid solution can be in a substantially purified form including a targeted terpenoid selected from the group consisting of d - limonene , α - pinene , β - myrcene , linalool , pulegone , 1 , 8 - cineole ( eucalyptol ), α - terpineol , terpineol - 4 - ol , p - cymene , borneol , δ - 3 - carene , β - caryophyllene , caryophyllene oxide , nerolidol , phytol , and combinations thereof . as used herein , a substantially purified terpenoid refers to the terpenoid being free of impurities other than the targeted terpenoids , with a volume percent of the impurities not exceeding about 5 %, about 1 %, or about 0 . 1 %. for example , if a substantially pure terpenoid includes a first terpenoid ( e . g ., d - limonene ) and a second terpenoid ( e . g . α - pinene ) as targeted terpenoids , any other substance including other terpenoids ( e . g ., β - myrcene , linalool , etc .) would be considered impurities . as described above , terpenoids can naturally originate from cannabis or other plants . in some embodiments , the terpenoid in the terpenoid solution does not naturally occur in the herb or herbs forming the smoking herb preparation . in some embodiments where the smoking herb preparation includes cannabis , providing 30 the terpenoid solution includes providing a solution including a terpenoid that is derived from a plant other than cannabis in general . in some other embodiments where the smoking herb preparation includes cannabis , providing 30 the terpenoid solution includes providing a solution including a terpenoid that is derived from a plant other than the cannabis strain from which the smoking herb has been prepared . in some embodiments , the terpenoid in the terpenoid solution can be provided in the form of an essential oil . an essential oil , sometimes referred to as a volatile oil , an ethereal oil , or an athereola , refers to a concentrated liquid extracted from a plant that can contain , among other compounds , terpenoids . compounds such as terpenoids included in essential oil often carry a distinctive scent , or essence ( hence the name ). in some embodiments , the essential oils can be prepared using one of several methods including , without limitation , distillation , expression and solvent extraction , among others . in distillation , raw plant material , which can include the flowers , leaves , wood , bark , roots , seeds , and / or peel , is put into a distillation apparatus over water . the water is then heated above the boiling point to generate steam therefrom , which passes through the plant material . as the stem passes through the plant material , the volatile compounds are vaporized . the vapors may flow through a coil , where they condense back to liquid , which is then collected in a receiving vessel . in expression , the raw plant material is expressed mechanically or cold - pressed . expression can be a suitable method where the raw material is available in relatively large quantities at relatively lower cost , such as orange peels for producing citrus - fruit oils . in solvent extraction , a solvent such as hexane or supercritical carbon dioxide is used to extract the oils . solvent extraction can be a suitable method where the raw material is available in relatively small quantities at relatively higher cost , such as flowers . solvent extraction can also be a suitable method where the chemical components are too delicate and easily denatured by the high heat used in steam distillation . a non - exhaustive list of plant species from which essential oils can be extracted to provide a terpenoid in the method 10 of fig1 include : abies alba , abies balsamea , abies sibirica , achillea millefolium , achillea millefolium ligustica , acorus calamus , agathophyllum anisata , agathophyllum aromatica , agathosma betulina , agathosma crenulata , allium cepa , allium sativum , aloysia triphylla , alpinia galanga ( l .) sw ., alutinosum druce , ammi visnaga , amyris balsamifera , anethum graveolens , angelica archangelica , angelica glauca , aniba rosaeodora var . amazonica , anthemis nobilis , anthopogon rhododendron d . don , apium graveolens , aquilaria malaccensis , artemisia absinthium , artemisia afra , artemisia annua , artemisia dracunculus , artemisia pallens , artemisia vulgaris , backhousia citriodora , boswellia carteri , boswellia carterii , boswellia neglecta , boswellia serrata , bulnesia sarmienti , callitris intratropica , cananga odorata , cananga odorata genuina , cananga odorata macrophylla , canarium luzonicum , carum carvi , cedrelopsis grevei , cedrus atlantica , cedrus deodara , chamaecyparis callitropsis nootkatensis , chamaecyparis lawsoniana , chamaecyparis obtusa endl ., chamaemelum nobile ( anthemis nobilis ), cinnamomum camphora , cinnamomum camphora l , cinnamomum cassia , cinnamomum glaucescens , cinnamomum polyandrum , cinnamomum zeylanicum , cinnamosma fragrans , cistus ladaniferus , citrus aurantifolia , citrus aurantium , citrus aurantium var . amara , citrus bergamia , citrus bergamia risso , citrus clementine , citrus hystrix , citrus junos , citrus junos siebold , citrus limonum , citrus paradisi , citrus reticulata , citrus sinensis , citrus tangerina , coleonema album , commiphora holtziana , commiphora myrrha , copaifera officinalis , coriandrum sativum , cotinus coggygria , croton eluteria , cryptocarya massoia , cuminum cyminum , cupressus rotundus , cupressus sempervirens , curcuma longa , cymbopogon citratus , cymbopogon flexuosus , cymbopogon flexuosus stapf , cymbopogon martini var . martinii ( var . motia ), cymbopogon nardus , cymbopogon winterianus jewitt , cymbopogon winterianus jowitt , cympobogan martini type sofia , cyperus scariosus , daucus carota , elettaria cardamomum maton , eremophila mitchellii , eriocephalus africanus , eriocephalus punctulatus , eucalyptus citriodora , eucalyptus citriodora hook ., eucalyptus dives , eucalyptus globulus , eucalyptus polybractea , eucalyptus radiata , eucalyptus smithii , eugenia caryophyllata , ferula galbaniflua , foeniculum vulgare mill var dulce , foeniculum vulgare mill ., fokienia hodginsil , gaultheria procumbens , geranium macrorrhizum , helichrysum gymnocephalum , helichrysum italicum , helichrysum stoechas , hippophae rhamnoides , humulus lupulus , hydicum spicatum , hypericum perforatum l , hyssopus officinalis , illicium verum , juniperus communis , juniperus communis l ., juniperus oxycedrus , juniperus virginiana , kaempferia galanga l , kunzea ericoides , lantana camera , laurus nobilis , lavandula hybrida , lavandula latifolia , lavandula officinalis , leptospermum petersonii , leptospermum scoparium , levisticum officinalis , lippia citriodora , lippia javanica , litsea cubeba , marjorana hortensis , matricaria chamomilla , matricaria recutita , matricaria recutita , melaleuca alternifolia , melaleuca minor , melaleuca quinquenervia , melaleuca viridiflora , melissa officinalis , mentha arvensis , mentha citrata , mentha piperita , mentha pulegium , mentha spicata , michelia alba , mix of 4 species , monarda fistulosa l ., murraya koenigii , myristica fragrans , myrocarpus fastigiatus , myroxylon pereirae , myrtus communis , myrtus communis , nardostachys grandiflora , nardostachys jatamansi , nepeta cataria , ocimum basilicum , ocimum basilicum l ., ocimum basillicum , ocimum sanctum , ocotea cymbarum , oleum abies sibirica , oleum chamomille , oleum pinus nigra , oreganum vulgare , origanum compactum benth ., origanum minutiflorum , origanum syriacum , origanum vulgare , ormenis mixta , pandanus odoratissimus , pelargonium graveolens , pelargonium × asperum , perilla frutescens crispa , petroselinum crispum , petroselinum sativum , picea mariana , pimenta dioica ( pimenta officinalis ), pimenta officinalis , pimenta racemosa , pimpinella anisum , pimpinella anisum l ., pinus pinaster , pinus pumilio , pinus sylvestris , piper cubeba , piper nigrum , pistacia lentiscus , pogostemon cablin , prunus amygdalus , pseudotsuga menziesii ( mirb .) franco , psiadia altissima , rhus tarantana , rosmarinus officinalis , ruta graveolens , salvia lavandulifolia , salvia officinalis , salvia sclarea , salvia stenophylla , santalum album , santalum spicatum , santolina chamaecyparissus , satureja hortensis , satureja montana , schinus molle , tagetes bipinata l , tagetes minuta , tanacetum annuum linnaeus , tarchonanthus camphoratus , thuja occidentalis , thuja orientalis , thuja plicata , thujopsis dolabrata , thymbra spicata , thymus capitatus , thymus mastichina , thymus satureioides , thymus serpillum , thymus vulgare , thymus vulgaris , thymus zygis , trachyspermum ammi , tsuga canadensi , valeriana officinalis , vetivera zizanioides , vitex agnus - castus l , vitis vinifera , xanthoxylum armatum , zanthoxylum armatum dc . ( rutaceae ), zingiber cassumunar , zingiber officinale , and zinziber officinale , among others . in some embodiments , examples of the the essential oil mixture includes mixtures that comprise at least one essential oil extracted from the group of plants consisting of salvia sclarea , pimenta racemosa , pistacia lentiscus , citrus limonum or a combination thereof . in some embodiments , the essential oil mixture consists essentially of salvia sclarea and pimenta racemosa . in some of other embodiments , the essential oil mixture consists essentially of salvia sclarea and pistacia lentiscus . in yet other embodiments , the essential oil mixture consists essentially of pistacia lentiscus and citrus limonum . in some other embodiments , the essential oil mixture comprises first and second essential oils extracted from the group of plants consisting of salvia sclarea , pimenta racemosa , pistacia lentiscus , or citrus limonum , wherein a volume ratio between first and second essential oils is between about 0 . 01 : 1 and about 1 : 1 . in some other embodiments , the volume ratio is between about 0 . 10 : 1 and about 1 : 1 , or between about 0 . 50 : 1 and about 1 : 1 , for instance about 1 : 1 . still referring to fig1 , the illustrated method 10 of preparing an herbal smoking blend further includes adding 40 the terpenoid solution to the smoking herb preparation . the terpenoid solution can be added using a suitable method for incorporating at least a portion of the terpenoid in the terpenoid solution into the smoking herb preparation . in some embodiments , adding 40 the terpenoid solution comprises dropping the terpenoid solution on the smoking herb . as used herein , adding the terpenoid solution by dropping refers to delivering a volume of liquid using , for example , a dropper , to deliver the liquid . in some embodiments , the dropper may deliver the liquid in an amount of between about 5 - 100 drops per ml , depending on , among other things , the viscosity of the terpenoid solution and the type of dropper used . in other embodiments , adding 40 the terpenoid solution comprises spraying a mist ( or droplets ) of the terpenoid solution on the smoking herb . as used herein , adding the terpenoid solution by spraying refers to delivering fine drops of the terpenoid solution dispersed in a gas by using , for example , a spray nozzle or atomizer , to deliver the terpenoid solution . the spray characteristics , including the spray pattern , the spray capacity , and the spray drop size depend on , among other things , the viscosity of the terpenoid solution and the type of spray nozzle used . in yet other embodiments , adding the terpenoid solution comprises spraying using an aerosol spray which includes the terpenoid solution . in some embodiments , adding 40 the terpenoid solution comprises dipping , or at least partially immersing the smoking herb into the terpenoid solution . by way of an example , the smoking herb can be placed in a dip net or a similar device and lowered into a container containing the terpenoid solution . in some embodiments , a soaking time can be tailored to control the amount of terpenoid solution that is absorbed , impregnated , or incorporated into the smoking herb . in some embodiments , the soaking time is between about 1 second and about 1 day , or between about 10 seconds and about 1 hour , or between about 1 minute and about 10 minutes . the smoking herb can be subsequently dried in air , or by heating the smoking herb , for example at a temperature below a temperature at which the smoking herb ignites . in some other embodiments , the smoking herb preparation comprises a smoking herb and a rolling paper . in these embodiments , adding 40 the terpenoid solution comprises adding the terpenoid solution to the rolling paper , which can subsequently be used to roll the smoking herb . the terpenoid can be added to the rolling paper using a suitable method to impregnate the rolling paper with the terpenoid solution . for example , the rolling paper can be dipped in a bath of terpenoid solution . other methods include dropping or spraying the terpenoid solution on the rolling paper . for example , in some embodiments , the terpenoid can be added to a pre - rolled cigarette containing smoking herbs . it will also be appreciated that the terpenoid solution can be added to the smoking herb by more than one method , for example , by two or more of the methods disclosed herein . for example , the terpenoid solution can be added to the smoking herb by dipping and drying the smoking herb preparation , and subsequently by providing drops of the terpenoid solution to the smoking herb or rolling paper for the smoking herb . in some embodiments , this can increase the concentrations of terpenoids ( e . g ., volatile terpenoids ) in the preparation . in some other embodiments , different terpenoids solutions are added to the smoking herb preparation at different times . for example , a solution with relatively less volatile terpenoids may be added to the smoking herb concentration initially ( e . g ., hours before consumption , or from a manufacturer or supplier ) and a solution with relatively more volatile terpenoids may be added to the smoking herb preparation immediately ( e . g ., minutes ) before smoking . in some embodiments where the smoking herb preparation includes cannabis , the amount of terpenoid added to the smoking herb preparation exceeds the amount of cannabis terpenoid that was present in the smoking herb prior to adding the terpenoid solution to the smoking herb preparation . in some embodiments , the amount of terpenoid added to the smoking herb preparation exceeds the amount of cannabis terpenoid that was present in the smoking herb prior to adding the terpenoid solution to the smoking herb preparation , such that the overall amount of terpenoid increases by more than about 50 %, by about 100 %, or by about 1000 %. in some embodiments , the amount of added terpenoid exceeds about 0 . 001 % by weight of the smoking blend , about 0 . 01 % by weight of the smoking blend , or about 0 . 05 % by weight . in some embodiments , the method 10 of preparing an herbal smoking blend further comprises subjecting the smoking herb preparation to a drying process after adding the terpenoid solution . fig2 is a schematic illustration of a smoking herb preparation system comprising according to some embodiments . the smoking herb preparation system comprises a smoking herb 80 and a terpenoid solution application kit 70 . in some embodiments , the terpenoid solution application kit 70 comprises a terpenoid solution 62 , a terpenoid solution container 74 for holding the terpenoid solution , and a terpenoid solution applicator 72 for administering a dose of the terpenoid solution to the smoking herb . still referring to fig2 , in some embodiments , the terpenoid solution 62 can be prepared by using a terpenoid solution preparation system 50 . the terpenoid preparation system includes a terpenoid measurement device 52 , a terpenoid mixture 54 comprising at least one terpenoid , a solvent measurement device 56 , a solvent 58 , and a terpenoid solution mixing container 60 . the terpenoid measurement device 52 can be any suitable container for measuring and mixing terpenoids to form the terpenoid mixture 54 , such as a beaker , a graduated cylinder , a measuring cup , and the like . in some embodiments , the terpenoid mixture 54 includes one or more terpenoids , such as terpenoids selected from the group consisting of d - limonene , α - pinene , β - myrcene , linalool , pulegone , 1 , 8 - cineole ( eucalyptol ), α - terpineol , terpineol - 4 - ol , p - cymene , borneol , δ - 3 - carene , β - caryophyllene , caryophyllene oxide , nerolidol , phytol , and combinations thereof . in some other embodiments , the terpenoid mixture 54 includes an essential oil mixture extracted from the group of plants consisting of salvia sclarea , pimenta racemosa , pistacia lentiscus , citrus limonum , and combinations thereof . the solvent measurement device 56 can be any suitable container for measuring and mixing different solvent components to form the solvent 58 , such as a beaker , a graduated cylinder , a measuring cup , and the like . the solvent 58 can include any liquid , e . g ., a volatile liquid , which can incorporate a desired amount of the terpenoid in the terpenoid solution . in some embodiments , the solvent components include ethanol and water , in proportions described above . in some embodiments , the terpenoid solution 62 is formed by mixing the terpenoid mixture 54 and the solvent 58 in the terpenoid solution mixing container 60 . the terpenoid solution 62 includes the terpenoid mixture 54 incorporated into the solvent 58 . in some embodiments , at least a portion of the terpenoid mixture 54 is miscible in the solvent 58 and can be dissolved in the solvent 58 to form the terpenoid solution 62 . in other embodiments , at least a portion of the terpenoid mixture 54 is immiscible in the solvent 58 and can be suspended in the solvent 58 to form the terpenoid solution 62 . the terpenoid solution 62 can then be transferred into the terpenoid solution container 74 of the terpenoid solution application kit 70 . still referring to fig2 , the terpenoid solution application kit 70 comprises any suitable terpenoid solution applicator 72 for administering a dose of the terpenoid solution 62 to the smoking herb 80 . in some embodiments , the applicator comprises a dropper having a bulb member and a pipette member . the dropper can have any suitable design for forming suitable drops as discussed above for application on the smoking herb 80 . for example , the dropper member may have a bulb made of elastic material configured to fill the pipette member with the terpenoid solution 62 thorough a vacuum suction effect . in some embodiments , the dropper may have a threaded closure to enable long term storage of the terpenoid solution . in some embodiments , the pipette member can be graduated to guide a user to administer a predetermined dose of the terpenoid solution on the smoking herb 80 . in some other embodiments , the applicator 72 may deliver a stream of the terpenoid solution to the smoking herb 80 , rather than delivering drops . in some other embodiments , the dropper may be integrated into the container 74 itself , which may provide drops directly from an opening in the container 74 . for example , the container 74 may be dropper bottle and the dropper section may be the drop generating opening of the bottle . fig3 is a schematic illustration of a smoking herb preparation system comprising a smoking herb according to some embodiments . the smoking herb preparation system comprises a smoking herb 80 and a terpenoid solution application kit 90 . the smoking herb preparation system of fig3 is similar to the smoking herb preparation system of fig2 except for the terpenoid solution application kit 90 . the terpenoid solution application kit 90 comprises a terpenoid solution 62 , a terpenoid solution container 94 for holding the terpenoid solution , and a terpenoid solution applicator 92 for administering a dose of the terpenoid solution to the smoking herb . the terpenoid solution container 94 can be , for example , a plastic spray bottle made of plastic , or other terpenoid solution reservoir in fluid communication with a nozzle for dispensing the terpenoid solution , such as an atomizer that dispenses the terpenoid solution as mist or spray . the terpenoid solution 62 can be mixed in the terpenoid solution container 94 and dispensed , for example through the terpenoid solution applicator 92 , which can be a trigger sprayer , mounted on the terpenoid solution container . in some embodiments , the trigger sprayer may have a threaded closure to enable long term storage of the terpenoid solution . in some embodiments , the trigger sprayer can be configured to administer a predetermined dose of the terpenoid solution on the smoking herb 80 . the trigger sprayer 92 can also be configured to determine other spray characteristics such as droplet volume , spray angle , etc . fig4 is a schematic illustration of a smoking herb preparation system comprising a smoking herb according to some embodiments . the smoking herb preparation system comprises a smoking herb 80 and a terpenoid solution application kit 90 . while the smoking herb preparation system of fig4 includes terpenoid solution application kit 90 is similar to fig3 , a terpenoid solution application kit similar to the terpenoid solution application kit 70 of fig4 , or any other similar application kits can be used . in addition , the smoking herb preparation system of fig4 further includes a rolling sheet 100 . unlike fig2 or fig3 , instead of incorporating the terpenoid solution directly into the smoking herb 80 , the smoking herb preparation system of fig4 is configured such that the terpenoid solution can be incorporated into the rolling sheet 100 instead of , or in addition to , incorporating the terpenoid solution into the smoking herb 80 using the suitable terpenoid application kit 90 . in these embodiments , the resulting terpenoid rolling sheet 104 can be subsequently dried and used to roll the smoking herb 80 into a thin cylinder 110 having the smoking herb 80 rolled therein , in a similar manner to a rolled cigarette . in some embodiments , the rolling sheet 100 can be a paper made from wood pulp . in other embodiments , the rolling sheet 100 can be made from rice or other plant matter such as hemp . in some other embodiments , the rolling sheet can be a pre - formed wrapper ( e . g ., a cylindrical wrapper ) for holding the smoking herb 80 . although this invention has been described in terms of certain embodiments , other embodiments that are apparent to those of ordinary skill in the art , including embodiments that do not provide all of the features and advantages set forth herein , are also within the scope of this invention . moreover , the various embodiments described above can be combined to provide further embodiments . in addition , certain features shown in the context of one embodiment can be incorporated into other embodiments as well . accordingly , the scope of the present invention is defined only by reference to the appended claims .

the disclosed embodiments relate generally to herbal smoking blends and methods for preparing and using herbal smoking blends , and relate more particularly to herbal smoking blends having terpenoids added thereto . in one aspect , a method of preparing an herbal smoking blend comprises providing a smoking herb preparation . the method additionally comprises providing a terpenoid solution comprising a terpenoid . the terpenoid solution may be added to the smoking herb preparation to , for example , provide a smoking herb preparation that achieves a desired effect on a consumer of the preparation .

a first embodiment of the invention will be described with reference to fig1 to 10 . the embodiment comprises the following four mechanisms . the first one is a brake mechanism used in the case where a user rises from a wheelchair and in the case where a user rides on the wheelchair , the second one is a brake actuating mechanism for a helper , the third one is a brake release mechanism during conveying an empty wheelchair , and the fourth one is an automatic opening mechanism for steps . first , an explanation will be given to a constitution of the brake mechanism . as shown in fig1 , a frame of the wheelchair comprises main rear columns 1 a composed of a pair of left and right pipes extending vertically , a pair of left and right , main lower columns 1 b extending forward from lower ends of the main rear columns 1 a , a pair of left and right , first main front columns 1 c extending upward from forward ends of the main lower columns 1 b , a pair of left and right , main upper and horizontal columns 1 d fixed to intermediate portions of the main rear columns 1 a and extending forward therefrom , a pair of left and right , second main front columns 1 e extending downward from forward ends of the main upper and horizontal columns 1 d , a pair of left and right , first mount pipes 1 f , both ends of which are interposed between the main rear columns 1 a and the second main front columns 1 e and fixed to upper ends of front and rear , cross braces 40 , and a pair of left and right , second mount pipes 1 g , which are arranged below and in parallel to the first mount pipes 1 f , and one ends of which are fixed to the main rear columns 1 a and the other ends of which are fixed to the first and second main front columns 1 c , 1 e . the front and rear , cross braces 40 are fixed at upper ends thereof to front or rear portions of the first mount pipes 1 f and at lower ends thereof to front or rear portions of the main lower columns 1 b on an opposite side , and intersect each other at central portions thereof to be turnably fixed to each other at the intersections , thus enabling folding of the wheelchair . upper ends of the main rear columns 1 a make rearwardly bent handles 2 held by a helper . a pair of left and right , rear wheels 3 are rotatably mounted to the main rear columns 1 a , and a pair of left and right , front wheels 4 are rotatably mounted to lower portions of the first main front columns 1 c . mounted to the pair of left and right , first mount pipes 1 f is a seat 5 having elasticity and capable of moving downward with an underside thereof bending . in addition , depiction of spokes of the rear wheels 3 and the front wheels 4 is omitted in fig1 and 3 . as shown in fig1 and 2 , mounted on left and right axle shafts 10 of the rear wheels 3 are axle - shaft clamping type brake means 11 . fixed to brake actuating portions of the brake means 11 are ends of brake levers 12 . used as the brake means 11 are , for example , “ servo brakes ”, “ band brakes ” ( both being jis . no . 6415 ) manufactured by karasawa seisakusho kabushiki - kaisha , which are used for axle shaft brakes for bicycles , and so on . fixed to the pair of left and right , second mount pipes 1 g are upper ends of first mount plates 13 each extending below the brake levers 12 and toward the main rear columns 1 a . lower end of the first mount plates 13 , respectively , are fixed to the pair of left and right , main lower columns 1 b . fixed to upper portions of the pair of left and right , first mount plates 13 , respectively , are second mount plates 14 , to which one ends of actuation plates 16 are mounted through hinges 15 to be able to swing vertically . here , the actuation plates 16 are arranged in a manner to contact with an underside of a portion amounting to about ¼ of a rear portion of the seat 5 . upper ends of dampers 20 composed of a gas damper , an air damper , an oil damper , or the like to serve as first bias means are pivotally mounted to the actuation plates 16 , and lower ends of the dampers 20 are pivotally mounted to support plates 21 fixed to lower portions of the first mount plates 13 . extension forces of the dampers 20 push up the actuation plates 16 to bring the same into contact with the underside of the seat 5 . lower ends of lengths of wire 22 for actuation of braking are fixed to the brake levers 12 , and upper ends of the lengths of wire 22 are mounted to the actuation plates 16 through small windows 13 a provided on the first mount plates 13 . as shown in fig1 and 2 , the lengths of wire 22 loosen in a state , in which the dampers 20 are not extended and the actuation plates 16 swing downward , that is , a user of the wheelchair sits on the seat 5 , and the brake levers 12 swing downward owing to restoring forces of bias means housed in the brake means 11 , so that braking of the axle shafts 10 is released . as shown in fig3 and 4 , in a state , in which the dampers 20 are extended and the actuation plates 16 swing upward , that is , a user of the wheelchair rises from the wheelchair , the lengths of wire 22 are pulled upward and the brake levers 12 are pulled upward , so that the axle shafts 10 are braked against restoring forces of bias means housed in the brake means 11 . subsequently , an explanation will be given to an action of the brake mechanism . fig1 and 2 show a state , in which a user of the wheelchair sits on the seat 5 and body weight is applied on a corresponding portion of the seat 5 to the actuation plates 16 , so that the seat 5 is pushed down at the corresponding portion to push down the actuation plates 16 against extension forces of the dampers 20 . also , the actuation plates 16 are pushed down whereby the lengths of wire 22 with upper ends thereof fixed to the actuation plates 16 loosen and the upward pulling forces of the lengths of wire 22 acting on the brake levers 12 disappear , so that biasing forces of bias means housed in the brake means 11 are restored to swing the brake levers 12 downward and braking of the axle shafts 10 is released ( put in a non - braked state ). in contrast , when a user rises from a state , in which the user sits on the seat 5 , that is , a state shown in fig1 and 2 , weight produced by body weight applied on the seat 5 disappears , so that pressure on the dampers 20 is released and so the dampers 20 are extended to push up the actuation plates 16 as shown in fig3 and 4 . when the lengths of wire 22 with upper ends thereof fixed to the actuation plates 16 are thereby pulled upward , the brake levers 12 , to which lower ends of lengths of wire 22 are joined , are pulled up whereby restoring forces of the bias means housed in the brake means 11 to release braking are applied on the brake levers 12 and so the axle shafts 10 are braked ( put in a braked state ). in this manner , since braking is applied the moment a user rises , and there is no play , the wheelchair remains stable and safe . also , since the axle - shaft clamping type brake means 11 , of which durability and safety are warranted on the basis of results of use in many years , are adopted to clamp and brake the axle shafts 10 , they are excellent in durability and safety . incidentally , there is in many cases the possibility that when a user by one self rides on a wheelchair , the user first puts a hand or hands on the seat 5 trying to support a body , and so risk of fall is highly possible since the user &# 39 ; s posture is not stable in the case where forces produced when the user puts a hand or hands on the seat 5 release braking to permit the wheelchair to move . accordingly , in order to avoid such risk , the actuation plates 16 in the first embodiment are arranged in a manner to contact with an underside of a portion amounting to about ¼ of a rear portion of the seat 5 . more specifically , body weight of the user is applied on that portion amounting to about ¼ of the rear portion of the seat 5 , which is disposed at the back of the seat to be adequately distant from that portion , on which the user possibly puts a hand or hands , and braking is released after the user &# 39 ; s posture becomes adequately stable , which warrants safety . in addition , while the first embodiment uses the dampers 20 as tension applying means for pushing up the actuation plates 16 , springs or the like may be used to bias the actuation plates 16 . also , while the actuation plates 16 are pivotally on the first mount plates 13 , they may be provided on the first mount plates 13 to be vertically movable . subsequently , an explanation will be given to the brake actuating mechanism . as shown in fig1 and 3 , handle levers 30 , respectively , are mounted on the pair of left and right handles 2 . lengths of brake wire 31 are coupled at upper ends thereof to the handle levers 30 , and at lower ends thereof to the brake levers 12 as shown in fig1 to 5 . hereupon , in the case where there is a need of braking when a user rides on the wheelchair and a helper pushes the wheelchair , the lengths of brake wire 31 are pulled upward upon grasping of the handle levers 30 and so the brake levers 12 coupled to the lengths of brake wire 31 are pulled up to apply braking . in addition , although not shown , it goes without saying that when there is a need of braking by a user who sits on the wheelchair , a conventional manual brake mounted on the wheelchair is used as it is . subsequently , an explanation will be given to a constitution of the brake release mechanism when an empty wheelchair is to be conveyed . as described , when a user goes away from the wheelchair to make the same empty , braking is automatically applied to come to a state shown in fig4 . accordingly , there is a need of releasing braking when an empty wheelchair is to be conveyed . as shown in fig5 , both ends of a release lever 41 are pivotally mounted to a portion substantially intermediate between an intersection 40 a of the rear cross braces 40 among the two pairs of front and rear cross braces 40 , which connect between the first mount pipes 1 f and the main lower columns 1 b on a side opposed to the first mount pipes 1 f , and upper ends of the cross braces 40 and to the main rear column 1 a disposed on the same side as that of the portion . an upper end of a length of release wire 42 is fixed to the release lever 41 and a lower end of the length of release wire 42 is fixed to the brake lever 12 from below through wire through of the support plate 21 and holes 13 b formed on bent portion the first mount plate 13 . a location 12 a , in which the length of release wire 42 is fixed to the brake lever 12 , is positioned much distant from a pivot of the brake lever 12 relative to a location 12 b , in which the lengths of brake actuating wire 22 are fixed to the brake lever 12 , such that a larger force than brake actuating forces with the wheelchair being empty acts on the brake lever 12 in a release direction as shown in fig5 . subsequently , an explanation will be given to an action of the brake release mechanism when an empty wheelchair is to be conveyed . generally , wheelchairs can be folded by causing a pair of left and right , rear wheels 3 and a pair of left and right , front wheels 4 to approach in an overlapping manner . more specifically , by lifting a longitudinal center line of the seat 5 in a manner to make the center line upwardly convex when an empty wheelchair is to be conveyed , it is possible to cause the pair of left and right , first mount pipes 1 f , to which both left and right , outer edges of the seat 5 are fixed , to approach each other . hereupon , when the pair of left and right , first mount pipes 1 f are caused to approach each other in a manner described above , the pair of left and right , second mount pipes 1 g , the pair of left and right , main lower columns 1 b , the pair of left and right , rear wheels 3 , and the pair of left and right , front wheels 4 are caused interlocking therewith to approach each other , and further the front cross braces 40 and the rear cross braces 40 are caused interlocking therewith to approach each other . therefore , a fixed end of the release lever 41 on a side of the cross brace 40 , the release lever being arranged between the cross brace 40 and the main rear column 1 a , is lifted upward about an axis of turning on a fixed end of the release lever on a side of the main rear column 1 a . then , the length of release wire 42 is simultaneously pulled upward , and a force , which the length of release wire 42 applies on the brake lever 12 from below , exceeds the brake actuating forces in association with points of action on the brake lever 12 and directions of forces , so that braking is released to enable conveying an empty wheelchair . finally , an explanation will be given to a constitution of the first embodiment of the automatic opening mechanism for legs , which hold steps , with reference to fig1 , 3 , and 6 . struts 51 fixed to upper portions of legs 50 are pivotally fitted and inserted into upper ends of the first main front columns 1 c . torsion springs 52 mounted on the first main front columns 1 c bias the struts 51 to open the same outside as viewed from a front of the wheelchair . the struts 51 may be reversely biased so that the left and right legs 50 are closed inside to be folded to overlap each other . formed on lower ends of the legs 50 are supports 50 a to extend substantially horizontally and forward . provided on intermediate portions of the legs 50 are horizontal struts 50 b to extend toward the first main front columns 1 c . ends of the horizontal struts 50 b are pivotally mounted on the first main front columns 1 c . strut supports 60 are fixed below the horizontal struts 50 b . the strut supports 60 house therein structures as shown in fig6 . the strut supports 60 comprise top - opened casings 61 , in which top - opened spring supports 62 are fixed . bushes 63 are fixed in upper areas of the spring supports 62 . stoppers 64 arranged through the spring supports 62 are slidably inserted into the bushes 63 . springs 65 are arranged between the spring supports 62 and flanges 64 a of the stoppers 64 to bias the stoppers 64 so that tip ends of the stoppers 64 project from the bushes 63 . fixed to inner ends of the stoppers 64 are wire fixing members 66 . fixed to the wire fixing members 66 are lower ends of lengths of wire 68 for opening of steps . the lengths of wire 68 are surrounded by wire guides 67 . upper ends of the lengths of wire 68 are fixed through the damper support plates 21 to the actuation plates 16 . recesses 50 a are provided in those positions on undersides of the horizontal struts 50 b , which correspond to the stoppers 64 . subsequently , an explanation will be given to an action of the automatic opening mechanism for legs . as described with respect to an action of the automatic brake mechanism , the brake levers 12 swing downward to release braking in a state , in which a user sits on the seat 5 of the wheelchair as shown in fig1 and 2 . at the same time when the lengths of wire 22 for actuation of braking , connected to the brake levers 12 loosen , the lengths of wire 68 for opening of steps also loosen , so that the springs 65 in the casings 61 for the stopper bias and project the stoppers 64 , as shown in fig6 a , to engage the same with the recesses 50 a in the horizontal struts 50 b so that the legs 50 are not opened by the bias of the torsion springs 52 when the legs 50 are set in positions for use . in contrast , when a user rises from a state of sitting on the seat 5 as shown in fig1 and 2 , extension forces of the dampers 20 pull the lengths of wire 22 upward and the brake levers 12 coupled to the lengths of wire 22 are pulled up to apply braking , as described with respect to the action of the brake mechanism . since the lengths of wire 68 coupled at upper ends thereof to the actuation plates 16 are also pulled in the same as the lengths of wire 22 , the stoppers 64 of the strut supports 60 withdraw , as shown in fig6 b , to be released from engagement with the recesses 50 a in the horizontal struts 50 b . thereby , control on the bias of the torsion springs 52 is released , so that the bias of the torsion springs 52 opens steps 53 left and right together with the pair of left and right legs 50 and so no obstacle is constituted when a user of the wheelchair begins walking . setting of the legs 50 to positions for use is effected such that when the legs 50 are manually turned to positions for use after a user goes away from the wheelchair , the stoppers 64 are projected to engage with the recesses 50 a to thereby fix the legs in a forwardly directed , neutral state , which corresponds to positions for use when a user rides on the wheelchair . conventionally , the steps 53 must be removed to positions constituting no hindrance to walking with hands or feet before a user rises and begins walking . in the first embodiment , accidents are prevented , in which a paralytic user or a user who cannot bend forward to reach hands to the steps 53 stumbles and falls , since the steps 53 are moved to positions constituting no hindrance to beginning of walking before a user rises and begins walking . fig7 and 8 show a second embodiment of the automatic opening mechanism for steps . in addition , in the second embodiment , members being the same as , or corresponding to those in fig1 to 6 are denoted by the same reference numerals , and an explanation therefor is omitted . in the present embodiment , legs 50 are fixed to first main front columns 1 c . tip ends of lower portions of the legs 50 constitute supports 50 a , and steps 53 are rotatably born by the supports 50 a . the steps 53 turn to assume two positions including a horizontal position and a vertical position . springs 70 are mounted on the supports 50 a to bias the steps 53 to vertical position at all times . also , formed in base positions of the supports 50 a are stoppers 64 having the same function as that of the stoppers 64 in the control device for the leg opening mechanism in the first embodiment . provided on the steps 53 are recesses 53 a , with which the stoppers 64 engage . like the first embodiment , lengths of wire 68 for opening of steps are fixed at lower ends thereof to wire fixing members 66 in the casings 61 for the stoppers and at upper ends thereof through support plates 21 to actuation plates 16 . accordingly , with the embodiment , the stoppers 64 at lower portions of the step holding legs project to engage with the recesses 53 a in the same manner as the case in fig1 , in a state , in which a user sits on a seat 5 of the wheelchair as shown in fig7 . therefore , the steps 53 are held in positions ( horizontal ) for use notwithstanding the bias of springs 70 . also , when a user rises from a state shown in fig7 , the stoppers 64 withdraw and separate from the recesses 53 a on the steps 53 , and so the steps 53 are put in a vertical position from a horizontal position as shown in fig8 by the bias of the springs 70 not to constitute an obstacle when a user of the wheelchair begins walking . such arrangement produces the same effect as that in the first embodiment . fig9 and 10 show a third embodiment of the automatic opening mechanism for steps . fixed to a first mount plate 13 is a crank support arm 80 extending toward an actuation plate 16 , and swingably born by the crank support arm 80 is a bent portion of a l - shaped crank 81 having a short arm 81 a and a long arm 81 b . an end of the short arm 81 a of the crank 81 is pivotally coupled to the actuation plate 16 , and an upper end of a length of wire 82 for opening of a step is fixed to an end of the long arm 81 b of the crank 81 . the length of wire 82 for opening of a step extends through a second mount pipe 1 g and passes guide rollers 83 , 84 , 85 , which are rotatably provided on the second mount pipe 1 g and a leg 50 , and a lower end of the length of wire is fixed to a step actuation arm 54 , which is united with the step 53 , from below . subsequently , an explanation will be given to an action . when a user sits on a wheelchair , the user &# 39 ; s body weight lowers a seat 5 as shown in fig9 , and the actuation plate 16 is correspondingly pushed down . thereby , the crank 81 is caused to swing about a support shaft of the crank support arm 80 in a clockwise direction as viewed in fig9 a , so that the end of the short arm 81 a lowers and the end of the long arm 81 b rises . when the end of the long arm 81 b rises , the length of wire 82 for opening of a step , an upper end of which is coupled to the end of the long arm , is pulled up to go round the step actuation arm 54 from beneath , thus acting as a force to pull down the step actuation arm . thereby , the step 53 having been put in a vertical position is turned inside 90 degrees to come to a horizontal position to be set in a position for use . meanwhile , when a user of the wheelchair rises , the seat 5 ascends and the actuation plate 16 is pushed upward by the force of a damper 20 as shown in fig1 , the crank 81 is caused to swing about the support shaft of the crank support arm 80 in a counterclockwise direction , so that the end of the short arm 81 a rises and the end of the long arm 81 b lowers . thereby , since the length of wire 82 for opening of a step loosens to release a pulling force acting on the step actuation arm 54 , the restoring force of the springs 70 housed in the step 53 shifts the step 53 from the horizontal position to the vertical position , so that the step is positioned not to prevent a user of the wheelchair from rising and then beginning walking . in this manner , according to the third embodiment , when a user sits on a wheelchair , the step 53 automatically comes to a horizontal position to be set in a position for use , and when a user rises , the step automatically comes to a vertical position to be set in a position not to obstruct walking , so that a more excellent effect than that in the first embodiment is produced . in the above embodiments , the brake levers 12 are connected directly to the brake means 11 but may be connected to the brake means through a length of wire . the first bias means adopts the dampers 20 but may adopt other means . the second bias means adopts the coil springs 52 and the third bias means adopts the coil springs 70 but may adopt other bias means than coil springs . the actuation plates 16 are not necessarily disposed on the back side of the seat 5 . the present examples and embodiments are to be considered as illustrative and not restrictive , and the invention is not to be limited to the details given herein , but may be modified within the scope and equivalence of the appended claims .

a wheelchair has actuation plates provided in juxtaposition with the seat to descend when a user sits on the seat to lower the seat with the user &# 39 ; s weight and to ascend when the user rises from the seat to permit the seat to return with removal of the weight . a brake is mounted on the axle shafts to brake the axle shafts and energized constantly in a non - braking direction . levers are coupled directly or indirectly to the brake to move according to descending motions of the actuation plates to put the brake in a non - braking state and to move according to ascending motions of the actuation plates to put the brake in a braking state . biasing devices for evacuating legs that extend from the seat and / or steps that are mounted onto the legs .

based on the description and illustrations provided herein , the many benefits provided by the invented structure and methods of utilization are apparent . these described benefits , as well as those that are inherent to those skilled in the art , fall within the scope of the invention of the present patent application as limited only by the claims appended hereto . referring to the drawings , fig1 illustrates the general layout of a patient cooling system in accordance with the invention , comprising an air tent 2 forming an enclosure with an air inlet duct 4 and an outlet duct 6 . the tent is preferably constructed from panels of fabric material , as described in more detail below . the tent is supplied with cool air through an air inlet duct 8 , with an intake filter 10 and an intake valve 12 comprising a movable vane that communicates with a main blower 14 . this pressurizes the air , and it then passed through a heat exchanger 16 , which comprises the evaporator section of a refrigeration circuit . the refrigeration circuit further comprises a compressor 18 and a condenser 24 , which is provided in a conventional fashion with a condenser fan having an intake filter 20 , a wick 26 for absorbing condensate drain from the evaporator section , and an outlet air filter 28 . having passed through the heat exchanger 16 and thus being cooled , the air passes into the patient enclosure via the inlet 4 , circulates past the patient , and leaves the enclosure via the outlet 6 . the outlet is connected by means of a re - circulation filter 30 to a re - circulation flow sensor 32 and a re - circulation valve 34 comprising a vane that can be moved in order to control the proportion of re - circulated air . the enclosure 2 is also provided with a vane type exhaust valve 36 that enables the pressure inside the enclosure to be independently controlled . in this way , the proportion of re - circulated air and the internal temperature of the enclosure can be controlled without unduly increasing or decreasing the total pressure inside the enclosure . the apparatus also includes a patient - supporting mattress , indicated generally at 42 in fig1 which comprises a plurality of inflatable compartments or cells to which air is supplied through an arrangement of valves 44 which are connected to the cooling circuit by a conduit 46 containing a further blower 48 . as illustrated , the conduit 46 is also incorporated in the coaxial hose set , forming a central core 50 , so that the air passing through the conduit is insulated from the ambient temperature by the outer coaxial passageways 38 and 40 . [ 0032 ] fig2 illustrates in more detail bow air is supplied to the mattress , so that alternate cells are pressurized with high and low pressure air in successive cycles . as shown , there are two interleaved sets of cells or compartments a and b , both of which are connected continuously to a source of cold air at low pressure by means of non - return valves 54 and 56 respectively . in the general arrangement of fig1 these will normally be connected via line 52 to the conduit 4 which supplies the air tent , and will therefore provide little supporting effect for the patient ( being at low pressure ) but will have fairly substantial cooling capacity . the high pressure air supply 46 driven by the blower 48 ( as described above with reference to fig1 ) is connected to each set of cells a or b , by a respective servo valve 44 , and these are activated alternately so that during a first cycle , all cells a are inflated to a high pressure so as to support the patient while cells b are connected to the re - circulation line 6 . a controlled amount of leakage is of course permitted through the fabric of each cell , as indicated by arrow c , since the high pressure air cannot escape via the non - return valves 54 , 56 . since the air supply 46 has been subjected to greater pressurization , it is , of course , at a somewhat higher temperature than the low pressure supply , and thus , primarily performs a supporting function rather than a cooling function for the patient &# 39 ; s body . at the same time , however , the cells b are receiving the supply of colder air 52 at relatively low pressure , so these cells primarily provide a cooling function rather than a supporting function . at the next cycle , the high pressure air supply is shut off from the cells a , by operating their respective servo valve 44 and instead , they are connected to the re - circulation line so that they now act primarily to provide cooling , as passageways for the cold air supply 52 . at the same time , the cells b are connected to the high pressure supply , so as take over the patient supporting function , in the same way , as described above for the cells a in the previous cycle . in this way , each region of the patient &# 39 ; s body is alternately supported by the high pressure , or subjected to cooling , rather than being continuously subjected to high pressure . [ 0037 ] fig3 illustrates the patient enclosure system in more detail , and as shown , this comprises a generally semi - cylindrical fabric structure , having a base portion ( not visible in the figure ) that is supported on a mattress cover 62 enclosing a mattress structure of the kind described above with reference to fig2 . as can be seen from the plan view of fig3 b , the upper or covering portion of the enclosure comprises a pair of elongate flaps 64 whose adjoining edges can be connected with a “ velcro ” seal ( i . e ., separable complementary hook and loop fasteners ) or similar seal 66 , each flap being formed with a flexible , transparent inspection panel 68 . a “ head end ” panel 70 ( fig3 c ) is formed with an aperture 72 for the neck of the patient , to allow the patient &# 39 ; s head to protrude from the enclosure , and this aperture 72 is connected to the circular edge of the panel 70 , by means of a slit 74 to facilitate the process of positioning the patient &# 39 ; s neck . the slit is also provided with velcro along its adjacent edges , for subsequent closure . the enclosure is also provided with a series of specially adapted apertures 76 , for the entry of various conduits and connectors , as will be described in more detail below while the foot end ( fig3 d ) is provided with a pair of ports 78 for air input ducts , as well as an aperture 80 for connection to re - circulation and pressure relief valves . [ 0040 ] fig4 illustrates a “ full enclosure ” version of the system of fig3 in which , as depicted in fig4 a and 4 b , the enclosure is longer so as to enclose the patient &# 39 ; s head . this version includes additional transparent panels 68 in the head region to allow the patient external vision . in this case , of course , the end panel 70 does not include a neck aperture . [ 0041 ] fig5 a and 5 b illustrate the arrangement by which pipes and conduits are passed through the walls of the tent , with minimum air leakage . each conduit aperture 76 is provided with a radially collapsible tubular sleeve 78 made of flexible material such as fabric . the tubular sleeve 78 is stitched into the head end wall 70 in the arrangement shown and projects from the wall . the outer edge of the tubular sleeve 78 is reinforced with a split aluminum anchor ring 82 ( fig5 c ) having a covering of velcro material stitched around it . thus the velcro - covered ring 82 forms a rim at the outer end of the tube to maintain the sleeve in a generally circular configuration as it is closed around the conduit . this rim , as well as the sleeve 78 itself , are formed with corresponding slits 84 which enable the sleeve to be closed around a conduit , as explained in more detail below . four velcro “ loop ” pads 86 stitched to the wall of the enclosure surround the sleeve 78 . the wall itself includes a slit 88 that extends from the split 84 of the sleeve to the outer edge 90 of the wall . in this way , a pipe or conduit ( which may for example already be connected to the patient ) can be passed into the enclosure , so as to exit through the sleeve 78 , without disconnecting either end . after the conduit has been properly positioned , the reinforced end 82 of the sleeve is twisted around and squeezed into engagement with the conduit , and pressed against the velcro pads 86 . the rim is then attached to the pads , locating the conduit tightly in position . it will be appreciated that this closure system works equally well for a wide range of conduit sizes . in addition , if any particular aperture is not needed , the sleeve can be twisted up more tightly to close the aperture completely ( as indicated schematically in fig3 and 4 ). it will be appreciated that the slit 88 is also provided with suitable velcro or similar closure means along its adjacent edges , so that the entire closure can be made substantially leak proof , thus reducing significantly the overall re - circulation losses in the system . although the foregoing specific details describe various embodiments of the invention , persons reasonably skilled in the art will recognize that various changes may be made in the details of the method and apparatus of this invention without departing from the spirit and scope of the invention as defined in the appended claims . therefore , it should be understood that , unless otherwise specified , this invention is not to be limited to the specific details shown and described herein .

a patient cooling system comprises a patient enclosure or tent having a coaxial hose connection to a re - circulating air - cooling system . the hose comprises an inner tube to introduce air into the enclosure and an outer tube for the return air . the patient cooling system further comprises a patient - supporting mattress comprising a plurality of inflatable compartments extending transversely across the width of the mattress , which can also be supplied with cooled air . the compartments can be alternately pressurized for pressure relief therapy . moreover , the compartments can be pressurized either with relatively low pressure cold air from the air cooling system , or with higher pressure air which acts to support the patient , but provides relatively less cooling effect . radially collapsible , sleeved openings in the tent panel enable connection of conduits or patient care lines to the patient .

the best mode for carrying out the invention is presented in terms of its preferred embodiment , herein depicted within fig1 through 9 . however , the invention is not limited to the described embodiment and a person skilled in the art will appreciate that many other embodiments of the invention are possible without deviating from the basic concept of the invention , and that any such work around will also fall under scope of this invention . it is envisioned that other styles and configurations of the present invention can be easily incorporated into the teachings of the present invention , and only one particular configuration shall be shown and described for purposes of clarity and disclosure and not by way of limitation of scope . the terms “ a ” and “ an ” herein do not denote a limitation of quantity , but rather denote the presence of at least one of the referenced items . the present invention describes an apparatus and method that incorporates a self - watering , vertically adjustable tree stand . the self - watering vertically adjustable tree stand ( herein described as the “ apparatus ”) 10 comprises a base 20 , a vertical member 30 , a water receptacle 120 , a clamping mechanism 96 , a water reservoir 130 , a ground fault circuit interrupter ( gfci ) power strip 40 , and a means for attachment of said components . referring now to fig1 through 3 , pictorial representations of the apparatus 10 and a portion of the components according to the preferred embodiment of the present invention , is disclosed . a base member 20 of circular design is envisioned to support the apparatus 10 before , during , and after securing a christmas tree 100 . the base 20 comprises a circular framework having an overall diameter sizable to accommodate the weight of the apparatus 10 and the tree 100 . the base 20 comprises a rectangular cross - section in a coplanar format with a reasonably dense thickness for optimum stability and strength capabilities . the bottom of the base 20 is envisioned to comprise a plurality of removably attachable rubber feet 25 for the minimization of damage done to rugs , hardwood floors , ceramic floors , or other floors . the feet 25 are envisioned to be fabricated of a hard rubber and may be attached thereto the bottom surface of the base 20 to protect the floor from scraping , scratching , rubbing , and the like against the desired floor surface while preventing sliding of the apparatus 10 . the base member 20 comprises a vertical member 30 removably attached thereto , envisioned to comprise a circular cross - sectional tubing , projecting vertically upwards at a designated distance . the vertical member 30 can be welded , bolted , or otherwise permanently fixed transversally thereto the axial plane of the base 20 ; however , it is preferred if the vertical member 30 to be temporally affixed thereto the base 20 . the vertical member 30 comprises an upper end and a lower end thereof such that the lower end is detachably affixed thereto the base 20 thereof . the lower end is centrally positioned thereon the base 20 having the diameter preferably the same as the base 20 thickness for optimal stabilization . the upper end comprises an extension member 55 having a support aperture 57 receiving and accepting a support member 95 having a clamping mechanism 96 described in more detail subsequently . a ground fault circuit interrupter ( gfci ) power strip 40 is removably attached thereto the upper portion of the vertical member 30 to provide an electric power source to electrically power decorative lights and / or other ornamentation . the gfci power strip 40 has a rectangular face comprising two ( 2 ) to four ( 4 ) openings or female adapters 45 embedded on the face in electrical communication with a power supply . the female adapter 45 is adapted to except and retain prongs 48 of an electric plug 47 , from decorative lights for example , and maintain electrical continuity . the gfci power strip 40 comprises a cord 46 with a plug 47 electrically connected at the distal end thereof . the gfci power strip 40 operates from an ac or dc input voltage power source preferably having remote reset capability to provide protection for the power supply and against user injury . the cord 46 extends downwardly and may be affixed to the vertical member 30 via ties , binding , string , or other suitable means such to prevent entanglement of the cord 46 . referring now to fig4 through 6 , pictorial representations of the apparatus 10 and a portion of the components according to the preferred embodiment of the present invention , is disclosed . a water receptacle 120 is removably attached thereto a stalk 105 of a desired christmas tree 100 . the water receptacle 120 , envisioned to be fabricated brass coupling , which is dense , corrosion resistant , inexpensive , and readily available , has a diameter considerably larger than that of a conventional tree 100 such to encircle the stalk 105 of said tree 100 while leaving sufficient space to contain water 140 and to allow a user put in additives such as vitamins , preservatives , and the like . the water receptacle 120 comprises a screw 126 or nail welded thereon the base surface of the receptacle 120 . the receptacle 120 is designed as a one - piece component being leak - proof while keeping the minimum system water level 140 above the tree stalk 105 cut , insuring the tree stalk 105 is always in the water 140 . the water level 140 will typically be approximately one ( 1 ) to three ( 3 ) inches from the base of the stalk 105 such that it will remain immersed for adequate consumption for a live tree 100 . the removability features of the water receptacle 120 permit the occasional discarding of water 140 which may become dirty and somewhat stagnant . the reservoir 130 is envisioned to be designed in a cylindrical format capable of holding a sufficient amount of water 140 to supply the water receptacle 120 with the necessary water 140 . the reservoir 130 is designed to be leak - proof while being unobstructive having a lid 135 to fit snuggly thereon the upper surface without having a seal , allowing the necessary pressure equalization to occur . the lid 135 protects from outside substances ( i . e . pine needles ) undesirably from traveling within the reservoir 130 while preventing spillage of water 140 residing therewithin . the lid 135 could be screwed threaded or could be simply a friction fit on the reservoir 130 . the reservoir 130 will have a height sufficient to contain a water level 140 high enough to permit the flow of water 140 to the receptacle 120 . the size of the reservoir 130 will vary depending on the size of the tree 100 to be withheld . the reservoir 130 is capable of containing a sufficient amount of water 140 while still delivering a certain amount of water 140 to the receptacle 120 until the receptacle 120 is containing a sufficient amount of water 140 . the reservoir 130 is at a higher elevation therefrom the receptacle 120 thereby providing positive water 140 pressure thereto said reservoir 130 without the opportunity of the “ old ” water 140 in the receptacle 120 to flow backwardly and upwardly towards the reservoir 130 thereby providing clean water 140 therewithin . the receptacle 120 and / reservoir 130 may be of plastic or glass such to contain transparent or translucent qualities so the amount of water 140 left residing therewithin may be easily discernible . the base of the reservoir 130 comprises a fluid dispersing aperture ( not pictured ) to which the water 140 exits therethrough to a tube 136 . a flexible tube 136 of certain diameter , preferably , but not essentially , one - fourth ( ¼ ) of an inch , delivers the water 140 from the reservoir 130 to the receptacle 120 . the tube 136 comprises a fluid dispersing end which is in fluid communication with the receptacle 120 and a fluid receiving end which is in fluid communication with the fluid dispersing aperture of the reservoir 130 . both ends of the tubing 136 , the fluid receiving end and the fluid dispersing end is connected and sealed to the fluid receiving aperture of the receptacle 120 and the fluid dispersing aperture of the reservoir 130 . the tube 136 allows a continuously inter - connection of the reservoir 130 and receptacle 120 water - sealed thereby preventing leakage . the tube 136 may be transparent or translucent such to permit a user to observe that the reservoir 130 and the receptacle 120 are continuously inter - connected . the tube 136 is long enough to span across the reservoir 130 thereto the receptacle 120 with ample excess remaining should additional tubing 136 be needed . the reservoir 130 is secured thereon a support member 95 via a strapping mechanism preferably a chain 138 having links , as depicted in the figures . the strapping mechanism may be any other device suitable to secure and withstand the weight of the reservoir 130 and the water 140 residing therewithin . protruding members 137 allow the points of connection of the chain 138 . the chain 138 is attached on two ( 2 ) sides of the outer diameter of the reservoir 130 preferably 180 ° apart thereof . the upward tension on the chain 138 , exerted by the weight of the reservoir 130 and water 140 stabilizes the chain 138 tightly against the support member 95 which allows the chain 138 to support the weight of the reservoir 130 and water 140 . the reservoir 130 may comprise a handle ( not pictured ) thereupon the surface so it can be easily moved and / or refilled . referring now to fig7 a and 7 b , transparent side views of the water receptacle 120 and a float valve 150 having a float 125 according to the preferred embodiment of the present invention , is disclosed . the receptacle 120 comprises a float valve 150 utilized as a mechanical electrical which operates having a float 125 to raise when the water level 140 goes up , as depicted in fig7 b , and drop when the water level 140 goes down , as depicted in fig7 a , with respect to a specified level . the float valve 150 is a mechanical feedback mechanism in fluid communication with the fluid receiving aperture of the tube 136 to regulate the water level 140 therewithin the receptacle 120 via a float 125 to drive an inlet valve such that a higher water level 140 will force the valve 150 closed whilst a lower water level 140 will force the valve 150 open . thus , the float valve 150 will allow a predetermined level of water 140 to enter the receptacle 120 , thereby shutting off the water supply 140 , the water reservoir 130 . the float 125 , fabricated of a buoyant material , is free to move up and down according to the level of water 140 and is mounted thereupon an extended shaft arm 145 at the distant end . the extended arm 145 withholds the weight of the float 125 thereby absorbing the force due to buoyancy from the float 125 and causing the extended arm 145 to pitch . upward movement of the float 125 causes the extended arm 145 to pitch upwardly to close the float valve 150 and to stop the flow of water 140 , while downward movement of the float 125 causes the extended arm 145 to pitch downwardly to open the float valve 150 and to permit the flow of water 140 therein . it will be appreciated to those skilled in the art that other float valve 150 designs may also be used in accordance with the invention to permit the automatic control of water flow 140 without intervening with the scope of the invention . referring now to fig8 , a top close - up view of the clamping mechanism 96 securing a tree stalk 105 thereof according to the preferred embodiment of the present invention , is disclosed . a support member 95 is adjustably and perpendicularly mounted to the vertical member 30 via an extension member 55 permanently and perpendicularly integrated thereon the uppermost portion of said vertical member 30 . the vertical member 30 may bend perpendicularly such to provide the extension member 55 or the extension member 55 may be later installed thereupon the vertical member 30 at the uppermost edge . the support member 95 is provided to provide support for the christmas tree 100 and help maintain the upright position of the tree 100 . the extension member 55 is envisioned to have an opened end 57 such to slidably receive the support member 95 . the extension member 55 and the support member 95 are envisioned to comprise a circular cross - section , preferably tubular having the extension member 55 with a larger diameter than the support member 95 such that the inner diameter of said extension member 55 is similar or slightly larger than the outer diameter of said support member 95 . the support member 95 has a first and second end comprising a circular cross - section , preferably tubular shaped to correspondingly be inserted therewithin the extension member 55 such that the inside walls of the extension member 55 uniformly abuts against the outside walls of the support member 95 . the support member 95 is sized to slidably move in a lateral direction within the extension member 55 . the extension 55 and support 95 members each have a contact surface having a plurality of apertures 56 equally spaced therethrough said surface . the apertures 56 are drilled therethrough the extension member 55 for selectively receiving a projection pin 90 to secure the relative position of the support member 95 . the apertures 56 are selectively alignable with the projection pen , and then fastenable with said projection pin 90 . referring now to fig9 , a side view of the rubber - coated member 115 and the insertion thereinto a winged screw 110 according to the preferred embodiment of the present invention , is disclosed . the support member 95 comprises a clamping mechanism 96 for the proper secure the placement of the stalk 105 of a tree 100 in an upright position perpendicularly with respect to the ground or other horizontal surface . the clamping mechanism 96 is envisioned to be “ u ” shaped with a plurality of bores 103 with threads incorporated therewithin each to operably engage and receive a threaded screw 110 . the two ( 2 ) threaded winged screws 110 are utilized to secure the stalk 105 of the tree 100 within said clamping mechanism 96 . the threaded screws 110 comprise a rubber - coated member 115 incorporated at the distal end shaped much like a “ u ”. the rubber - coated member 115 is slightly contoured and rounded to abut thereagainst the stalk 105 of the tree 100 . the rubber - coated member 115 is envisioned to comprise a shaft 99 to be operably received therewithin a bore or the like ( not pictured ) centered in the winged screws 110 with a washer 98 abutting thereagainst the rubber member 115 . the winged screw 110 acts like a sleeve or the like to allow rotatable motion of the rubber - coated member 115 and / or shaft 99 about the lateral axis i - i , without the longitudinal movement of said rubber - coated member 115 and shaft 99 , as depicted in fig9 . the rubber - coated members 115 are designed specifically to completely or partially encircle the stalk 105 of the tree 100 above the central point of the base 20 thereby securing the tree 100 with a center of gravity on or in close proximity to the center of the base 20 thereby providing optimum stability . the rubber - coated members 115 have an adjustable opening for receiving and securing the stalk 105 of the tree 100 . said opening may be expanded by the utilization of the two ( 2 ) winged screws 110 mirrored equidistantly therefrom the axis of the support member 95 . the winged screws 110 bring the rubber - coated members 115 closer together for trees 100 whose stalks 105 comprise a relatively small diameter . on the contrary , the opposite applies for those stalks 105 which comprise a relatively large diameter , to which case , the screws 110 may bring the rubber - coated members 115 outwardly further apart thereby providing a wide range of opening space for larger and / or unsymmetrical stalks 105 . the threaded screws 110 are inserted therewithin the clamping mechanism 96 comprising two ( 2 ) apertures defining bores for rotatably accepting said screws 110 so that the rubber coated member 115 may be abutting thereagainst the stalk 105 of the tree 100 in order for securely holding said tree 100 . the rubber - coated members 115 are envisioned to conform thereto the outer periphery of the stalk 105 of the tree 100 without puncturing said stalk 105 . the rubber material provides a frictional force against the stalk 105 for optimum holding stability capabilities . further , the rubber - coated member 115 is envisioned to be rotatable and / or pivotable along the lateral axis , i , of the threaded screws 110 , as depicted in fig9 , to provide adjustments as needed . the rotatable and / or pivotable rubber - coated member 115 allows said member 115 to adjust accordingly thereby providing a wide range of securing features for trees 100 comprising symmetrical or unsymmetrical stalks 105 . alternate fastening mechanisms may be used . an alternate embodiment of the present invention 10 may disclose alternate fixing means for the support member 95 to be adjustably slidably received therewithin the extension member 55 . the extension 55 and support 95 members may each have a contact surface having a plurality of matching and transverse apertures 56 equally spaced therethrough two ( 2 ) surfaces spaced 180 therefrom each other such to receive a through pin 90 . the transverse apertures of the support member 95 correspondingly match with the matching apertures 56 of the extension member 55 which may be selectively aligned and secured with the through pin to fix the relative position of the support member 95 . the through pin will be inserted therethrough the matching aperture 56 on the upper surface of the extension member 55 , therethrough the transverse aperture on the upper surface of the support member 95 , therethrough the transverse aperture on the lower surface of the support member 95 , and therethrough the matching aperture on the lower surface of the extension member 55 . yet further , the present invention 10 may disclose a supporting member 95 that comprises a pivot point with a position pin inserted through one of the pivot position holes . thus the support arm 95 may pivot sideways , downwardly , and / or upwardly . another alternate embodiment of the present invention 10 may disclose an adjustable vertical member 30 of telescoping construction so that the apparatus 10 may be adjusted in height . the vertical member 30 may be designed in sections such that each section is slightly smaller than the next such that the sections may be slid within one another so that the overall height of the apparatus 10 may be varied . alternately , the vertical member 30 may contain apertures 56 for receiving a projection pin 90 or a through pin similar to the method used for the adjustable attachment of the extension member 55 and support member assembly 95 aforementioned . yet another alternate embodiment of the present invention 10 may disclose a decorative design with the colors symbolizing the time of the season with or without decorative motifs thereupon . still yet another alternate embodiment of the present invention 10 may disclose a support arm or the like integrally connected thereto the water receptacle 120 for further stabilization of the tree 100 . said support arm may comprise adjustment means such that it may adjustably and slidably move upwardly and downwardly along the vertical member 30 and releasably secured in a desired position thereon said vertical member 30 utilizing a clamping mechanism or the like . yet still another alternate embodiment of the present invention 10 may utilize a float switch having a float 125 connected to an extended shaft of a determined weight . once the water level 140 reaches a certain height , the float 125 and the extended shaft closes a circuit which either closes a valve . this may be done with a ball valve with an electromechanical actuator to effect a positive shut - off when the water 140 reaches a certain height ; however , other valves or a solenoid may be utilized . the float switch would sense the level of water 140 within the receptacle 120 to activate a valve producing discrete outputs as the water 140 reaches many different levels within the receptacle 120 and actuates a micro - switch designed to be actuated by the physical motion of a mechanical device . the preferred embodiment of the present invention can be utilized by the common user in a simple and effortless manner with little or no training . after initial purchase or acquisition of the self - watering , vertically adjustable tree stand 10 , it would be configured as indicated in fig1 through 9 . the method of utilizing the device may be achieved by performing the following steps : securing the rubber feet 25 thereon the underside surface of the circular base 20 via screws , bolts , nuts , or other fastening means ; securing the vertical member 30 perpendicularly thereon the base 20 with an extension member 55 protruding in a parallel arrangement therewith the floor ; filling the water reservoir 130 therewith water 140 with or without additives therein ; closing the lid 135 thereon the water reservoir 130 ; slidably attaching the support member 95 therein the extension member 55 until a designated position is achieved and locked via a projection pin 90 therethrough an aperture 56 ; attaching the reservoir 130 thereto the support member 95 via a chain 138 or other attachment means ; fluidly attaching the float valve 150 and float 125 thereto the fluid receiving end of the receptacle 120 ; rotatably screwing the water receptacle 120 thereon the stalk 105 via a welded screw 126 positioned at the base of said receptacle 120 ; inserting the tree stalk 105 therein the clamping mechanism 96 ; securing said tree stalk 105 via rotatably screwing the screws 110 until the contoured rubber - coated members 115 are abutted thereagainst said tree stalk 105 ; fluidly attaching the tube 136 thereto the water reservoir 130 and / or water receptacle 120 , if needed ; and , utilizing the gfci power strip 40 to power the holiday decor . the apparatus 10 is envisioned to come in a variety of sizes and utilized to securely hold a christmas tree 100 at various specified distances from the floor later to be determined to allow a storage area for gifts and / or decorations under the tree 100 . the components of the apparatus 10 provide minimum storage space with the support member 95 , vertical member 30 , water receptacle 120 , and the water reservoir 130 being unattachably secured . the apparatus 10 or portions of the apparatus 10 may be decorative to resemble the holidays . the apparatus 10 may further disclose the securement and watering of other trees 100 not prone to the holidays . the apparatus 10 may be used to water other plants and / or animals . because the water receptacle 120 and water reservoir 130 are envisioned to fabricated of plastic , they can be colorful and decorative being transparent , translucent , or opaque . the water receptacle 120 receives water 140 therefrom a water reservoir 130 . the water level 140 can likewise be checked either by lifting the lid 135 of the reservoir 130 , if not of transparent or translucent qualities , observing the water flow 140 therethrough the tube 136 , and / or observing the water receptacle 120 , if needed . the water level 140 is specifically maintained via a horizontal float valve 150 . the reservoir 130 is located at an easily accessible point away from the tree 100 . the vertical member 30 is positioned at a reasonable distance away from the tree 100 such to prevent obstruction to the tree 100 and / or the decorations laid upon the tree 100 . the water 140 flows from the reservoir 130 into the receptacle 120 via a tube 136 . as the water level 140 in the receptacle 120 rises , the buoyancy causes the float 125 to rise . the buoyancy exerted by the float 125 is reflected upon the extended arm 145 to which closes and seals the float valve 150 . as the water level 140 lowers in the receptacle 120 due to evaporation and absorption , the float 125 lowers accordingly eventually resulting in a buoyancy force no longer acting upon the float 125 and the extended arm 145 respectfully . the valve 150 is then opened to allow water 140 to flow from the reservoir 130 to the receptacle 120 . this cycle is repeated continuously and automatically until the apparatus 10 is not longer of use for the holidays . as a result of evaporation and the absorption of water by the tree 100 , the water level 140 in the water receptacle 120 lowers . float 125 lowers accordingly . with the force due to buoyancy of float 125 no longer acting upon the extended arm 145 , the float valve 150 opens . water 140 again flows from the water reservoir 130 , through the tube 130 , and into the water receptacle 120 , and the cycle is repeated . the foregoing descriptions of specific embodiments of the present invention have been presented for purposes of illustration and description . they are not intended to be exhaustive or to limit the invention and method of use to the precise forms disclosed . obviously many modifications and variations are possible in light of the above teaching . the embodiment was chosen and described in order to best explain the principles of the invention and its practical application , and to thereby enable others skilled in the art to best utilize the invention and various embodiments with various modifications as are suited to the particular use contemplated . it is understood that various omissions or substitutions of equivalents are contemplated as circumstance may suggest or render expedient , but is intended to cover the application or implementation without departing from the spirit or scope of the claims of the present invention .

the invention as presently conceived discloses a unique system and method that incorporates a self - watering tree stand that is an improvement on a conventional floor - standing holiday tree stand and watering system . the design of this novel tree stand is that it supports the tree from the tree &# 39 ; s midsection that allows gravity to self - level the tree held within the stand . the stand comprises a large circular base for stability as well as adjustable height watering cup that can be brought up to the bottom of the tree and is fed from a water reservoir located on the vertical section of the stand at the outside perimeter of the tree . also integral to the system and apparatus is a power receptacle fed from a power cord located near the top of the stand in order to power decorative lights or other electric tree decorations .

liquid honey if permitted to crystallize naturally will normally form large coarse crystals and will invariably result in a relatively solid product of a consistency , for example , which may or may not be spreadable , but which is in the nature of a rather solid product . it has long been known that honey can be induced to crystallize in smaller crystals and crystal groups by seeding liquid honey with ground crystalline honey . the seed honey provides crystallization cites which initially lead to formation of smaller crystals . the resulting creamed honey product has a much more desirable texture and consistency . unfortunately , the creamed honey product produced from seed honey was invariably unstable and would rather quickly revert to the harder and more granular creamed honey product . liquid honey is of a consistency that makes use by the average consumer somewhat difficult . this is particularly so in attempting to transfer the liquid honey from a retail container to a food product in association with which honey would normally be eaten as , for example , bread . this transfer is , in short , often quite messy , particularly when attempted by younger children . to alleviate this problem to some extent liquid honey is currently often sold in squeezable bottles or containers having an appropriate closure device with an orifice of , say , 0 . 25 inch , and from which a liquid honey can be ejected by inverting and squeezing the container . the product can thus be transferred directly to the food product in association with which it will be eaten . while the problems associated with hardened creamed honey differ from those associated with liquid honey , there has nonetheless been a strong desire to have available creamed honey which can be marketed in a similar squeezable container . to date the problems discussed above have always prevented the use of squeezable containers for creamed honey because the required texture and consistency for both attractiveness of product and usability of squeezable containers could not be maintained . a &# 34 ; squeezable &# 34 ; creamed honey can be produced according to the following process . while not part of the invention as such , liquid honey would normally be treated in the same way as is conventional among most , if not all , commercial honey producers . that is to say , the raw liquid honey is first pasteurized and then filtered to remove impurities . the preferred pasteurization temperature is between 150 ° to 160 ° f . and may be carried out in a normal high temperature short time pasteurizer which is exemplified by typical dairy type plate heat exchangers . filtration is preferably carried out utilizing a 100 mesh stainless steel filter coated with a diatomaceous earth ( kenite 3000 ™ or equivalent filter media ). the liquid honey is preferably cooled immediately after the pasteurization and filtration steps . the temperature to which the honey is chilled is chosen to be below the temperature at which the seed honey to be added subsequently would melt and above the temperature at which hard granulation would occur . the most preferred temperature is 78 ° to 80 ° f . this temperature is preferably maintained until the final process step to be discussed below . the cooling step may be carried out with the same type of plate heat exchanger as that used for the pasteurization step . finely ground seed honey is next added to the liquid honey . it is desirable that the seed honey be thoroughly mixed with the liquid honey but also that the mixing be sufficiently gentle to minimize air entrainment . in that regard a ribbon type mixer operated at a speed of 33 to 44 rpm , and preferably 44 rpm , has been found suitable . seed honey is preferably added to comprise 25 % of the total resulting honey volume . in that regard use of an insufficient amount of seed honey results in the formation of larger crystals resulting in a very coarse hard granulation . as indicated , the preferred amount of seed honey is 25 % by volume of the total honey . adding additional seed honey will produce the required product but simply increases production cost and reduces net yield . the seed honey is hard granulated honey which has been ground . it is preferably very finely ground to have a particle size which will freely pass through an 80 mesh screen . the mixture is then pumped through a positive displacement pump into a storage tank where it is held to allow substantially complete crystallization of the liquid to occur . the temperature requirement is as discussed above and is preferably maintained at 78 ° to 80 ° f . in the storage tank . the mixture is held in the tank until crystallization has advanced to the required extent . this period will normally be at least 96 hours . the crystallized honey is then transferred to a second storage tank . again a positive displacement pump is preferably used to effect this transfer . the temperature is preferably maintained with the constraints discussed above and most preferably in the 78 ° to 80 ° f . range . the effect of the positive displacement pumps utilized in the transfer steps is to physically break down the honey crystals and crystal groups in such a way that they will not continue to grow or reform into groups . any other means apart from a positive displacement pump may be utilized provided the desired breakup of crystals and crystal groups is achieved . the crystallized honey is preferably pumped a third time through the positive displacement pump or whatever other apparatus has been used to effect the crystal breakup . the honey is at this point preferably pumped directly to a filling line and into retail containers . while a great advantage of the product of the present invention is its use in squeezable bottles , it is of course possible to utilize any other conventional container . the temperature is preferably maintained in the 78 ° to 80 ° f . range through this third transfer and container filling step . the packaged product is then preferably placed in a cool storage area and held for a period of time sufficient to permit the crystallized honey to stabilize . this holding period is preferably carried out at a temperature of about 54 ° f . for a period of preferably at least 96 hours . the 54 ° f . holding temperature in the final step is in a range which is optimum for crystallization . accordingly , in the event that the process steps have not been correctly carried out , so that crystal breakup has been insufficient to result in a stable product , it is highly likely that this storage step will provide evidence of that fact through the appearance of hard or granular crystallization . in the normal course , however , the product will after the stabilization period have an acceptable shelf life at room temperature . for example , the consistency and smoothness will be maintained for up to a year . at 54 ° f . or cooler , the product will have an essentially unlimited shelf life . refrigeration is not , however , required . thus it is apparent that there has been provided in accordance with the invention a process for the preparation of a creamed honey product that fully satisfies the objects , aims and advantages set forth above . while the invention has been described in conjunction with a specific embodiment thereof , it is evident that many alternatives , modifications and variations will be apparent to those skilled in the art in light of the foregoing description . accordingly , it is intended to embrace all such alternatives , modifications and variations as fall within the spirit and broad scope of the invention .

there is provided a new and useful honey product and a process for the preparation thereof , the process comprising adding a predetermined quantity of seed honey to a mass of honey , treating the mass of honey a first time to physically break up crystal groups , holding the mass of honey a first time for a predetermined period to allow crystallization , treating the crystallized honey at least one additional time to physically break up crystal groups , and holding the honey a second time for a predetermined period .

discussing the present invention first in overview , it is a fundamental desideratum to provide a portable non - invasive analgesia inducing apparatus that exhibits a selectively developed complex waveform of electrical output . this output is applied between at least two contact probes for generating intracorporal current . the placement of the probes will depend on the treatment regimen . for example , migraine headache syndrome may involve the placement of the contacting probes on each side of the patient &# 39 ; s cranium , one at the primary site of pain and the second at the contralateral trapezius insertion . other locations may include intraoral , e . g ., for local analgesia to control the pain associated with a dental restoration procedure . although the theory describing the underlying pain control phenomenon is not well known or , for that matter , even established , and while not desirous of being constrained to a particular theory , it is generally believed that the introduction of an intracorporal current acts upon the electrically conducted neural transmitters of the patient . it has been discovered that the particular complex waveform of the present invention when applied to a patient creates distinct changes in the blood plasma and cerebral spinal fluid concentration of such compounds as melatonin , serotonin , beta endorphin , norepinephrine and cholinesterase which are highly correlated with the pain / pleasure centers of the central nervous system . in operation , the present invention involves two functional attributes . the first involves the generation of the complex waveform of a select signature . the second attribute is directed to the implementation of the treatment in a delineated treatment regimen . with the above overview in mind , attention is first directed to fig1 a - 1f which presents the various components of the complex waveform of the present invention . more particularly , and starting with fig1 a , a graphical representation is provided of the carrier frequency for one specific time segment . in this representation , the carrier frequency equals 15 kilohertz . the amplitude is 40 . 0 volts peak max ( dc ) with a duty cycle of 50 %. the waveform contains 25 bursts of 15 pulses for each burst . the period for each burst is 2 milliseconds and the period for each pulse is 66 . 7 microseconds . for each , the burst and the pulse , the duty cycle is 50 % on time . continuing , fig1 b presents the first modulation to the carrier frequency . in this example , the first modulation has a frequency of 15 hertz and a duty cycle of 75 %. the second modulation is depicted in fig1 c . the second modulation has a frequency of 500 hertz and a 50 % duty cycle . continuing through fig1 d , the complex waveform combining the components depicted in fig1 a through 1c are presented . the complex waveforms of the present invention may be generated with sinusoidal , sawtooth , hyperbolic or other wave shapes ; for simplicity and clarity , the waveforms presented in fig1 a through 1d and further discussed below have been exemplified by simple square waves . a cycle for the waveform will consist of 50 milliseconds &# 34 ; on &# 34 ; time , in which the pulses for that frequency combination are generated , and an &# 34 ; off &# 34 ; time of 16 . 7 milliseconds . finally , in fig1 d , a complex waveform according to the present invention is provided , in which the polarity of the output is switched from positive to negative on a periodic basis , e . g ., 67 ms , resulting in a bipolar waveform . for purposes of rough approximation , the energy dissipation in using the present invention is represented by the area under the pulses depicted in fig1 d . it can , therefore , be recognized that by adding the second modulation , having a 50 % duty cycle , results in a 50 % decrease in power dissipation . in another particular embodiment , wherein a monopolar waveform is used , the monopolar stimulation contains a 15 khz square wave carrier which is rectified and which varies in current ( via intensity adjustment ) from zero to a maximum of about 4 ma . the first modulating signal of 15 hz provides an &# 34 ; on &# 34 ; time of 50 ms and an &# 34 ; off &# 34 ; time of 16 . 7 ms . the second modulating signal of 500 hz changes the &# 34 ; on &# 34 ; time series of the 15 khz carrier pulses ( 750 pulses in 50 ms ) into 25 minibursts of 15 pulses each of the 15 khz carrier signal ( 375 pulses in the same 50 ms ). in yet another embodiment wherein a bipolar stimulation is used , the bipolar waveform can be composed of the same just - aforementioned frequency specification , with each basic 15 hz signal alternated positively and then negatively . in this manner , the first 66 . 7 ms period ( 50 ms of &# 34 ; on &# 34 ; time and 16 . 7 ms of &# 34 ; off &# 34 ; time ) is a given voltage and the next 66 . 7 ms period is a voltage of the same absolute value but of the opposite sign . in summary , the carrier frequency will preferably range between 1 khz and 300 ghz . the first modulation to this carrier wave will have a frequency between 0 . 01 and 199 kilohertz ( i . e ., between 10 hz and 199 khz ). the second modulation to the carrier will have a frequency range between 0 . 1 and 300 kilohertz ( i . e ., between 100 hz and 300 khz ). preferred combinations for these three frequencies , and as also shown in the figures , include : 15 hz , 500 hz , and 15 khz ( fig1 a - g ); and 10 hz , 100 hz , and 3 . 3 khz ( fig2 a - g ); all values are preferably ± 2 %. as noted in the above u . s . pat . no . 5 , 109 , 847 , an optional third modulation of the carrier wave having a frequency range of 0 . 1 hz to 1 , 000 hz , more preferably 1 - 50 hz , and most preferably 5 - 25 hz can be utilized . in accordance with the present invention , the combined waveform , such as shown in fig1 d , is used to modulate a tens signal , shown in fig1 e , or a stimulatory signal , administered to the patient . tens devices are commonly known and used ( e . g ., as described by katims , in u . s . pat . no . 4 , 305 , 402 , rossen , in u . s . pat . no . 4 , 989 , 605 , the disclosures of which are incorporated herein by reference , and others ), and by this invention the application of a tens signal having conventional frequencies and durations is administered to a patient and modulated by means of the aforedescribed combined waveform . two types of tens devices are recognized by the american national standard for transcutaneous electrical nerve stimulators # ns4 ( a standard developed by the assn . for the advancement of medical instrumentation and approved by ansi ). one standard type of tens device creates an accommodative or habituating condition that can be controlled by the patient ; this type is believed to provide a counter - stimulation signal that is able to overload the body &# 39 ; s one pain - communicating signal . another type of conventional tens device involves microcurrent stimulation (&# 34 ; mens &# 34 ;). particularly preferred tens frequencies are 2 n where 0 & lt ; n & lt ; 8 ( i . e ., 1 , 2 , 4 , 8 , 16 , 32 , 64 , and 128 hz ) and the frequency remains constant , or the frequency changes randomnly among those between one and 256 hz in either a continuous or discontinuous manner ( preferably continuous ), or is some constant frequenct between one and 256 hz or one randomnly and continuously or discontinuously varying therebetween ( or between 60 and 120 hz ). further , this tens signal may be administered totally asychronously with any of the other signals ( i . e ., totally unmodulated ), or may be synchronous with one or more of the other simple or complex waveforms and thus be modulated along therewith . in yet another embodiment of the present invention , gigahertz ( ghz ) frequencies can be administered to the patient ( these signals have wavelengths on the order of millimeters , near the boarder in the electromagnetic spectrum where &# 34 ; light &# 34 ; waves meet &# 34 ; radio &# 34 ; waves ). in particular , the ghz signal is preferably provided as a bipolar signal . it is also preferred that the ghz signal be provided in the gap ( silence ) in the combined waveform when the first modulation is off the duty cycle , as shown in fig1 g ; it can also be seen that the ghz signal likewise occurs when the duty cycle of the combined waveform - modulated tens signal is off . for the uhf signal ( ultrahigh frequency , i . e ., the ghz signal ), frequencies of 1 khz to 300 ghz , preferably 100 mhz to 200 ghz , more preferably 20 - 100 ghz , and most preferably 50 - 75 ghz are used . as just described , and as shown in the figures , the combined waveform , the tens signal , and the ghz signal can be considered to be synchronized , the tens signal being modulated by the combined waveform and the ghz signal occurring opposite thereto . in other embodiments , the tens signal and / or the ghz signal can be administered asynchronously to the combined waveform and / or to each other ; that is , the combined , tens , and ghz signal can be in any combination of synchronicity or asynchronicity with each other . although the square waveforms in fig1 a - 1f may not be of uniform height , it is preferred that the total current delivered in any combination of signals administered to the patient be in the range of about one to about 50 ma . the modulated waveform , with the optional bipolar spike waveform synchronous or asychronous therewith , can be administered to the patient using any of a number of the modulated subcombinations of signals as described herein . for example , using the waveforms depicted in fig1 the patient can receive simultaneously the typical combined waveform of fig1 d and the tens and / or bipolar stimulation signal ( fig1 e and 1f ), and during the &# 34 ; off &# 34 ; portion of the duty cycle of these ` combined ` waveforms there is adminstered the millimeter wave ghz frequency signal ( fig1 g ). on the other hand , all of the signals can be modulated together , or any combination can be used . in fact , based on the empirical nature of medical treatment , whether in eastern or western medicine , it would likely be beneficial to the care provider to try different combinations ( i . e ., mutual modulations ) of these signals to determine with which particular combination the patient finds the most relief . turning now to fig3 the functional elements of the inventive device are presented . the power source to the present system will either be a battery having nominal 9 volt terminal voltage or some rectified and properly transformed line ( ac ) power source . the battery provides the basic dc power source for generating the complex waveform . this is channeled and controlled by the voltage multiplier , 20 . the output of the voltage multiplier 20 which is between 27 v to 40 v , is fed to signal generating circuit 60 which is the oscillating circuit that converts the constant dc output into the complex waveform having the desired characteristics . the specific constant current and current limited waveform generated by signal generating circuit 60 is pre - set by entering the various frequency settings for the two modulations , and the carrier . this may be entered manually through adjusting the settings on control panel 90 . alternatively , these settings may be stored in digital memory 40 as previously set values . the actual output of this system is regulated by monitor 70 which then provides the system output on a display , via control panel 90 , or a memory value for subsequent retrieval from memory 40 . the signal generating circuit 60 receives the voltage of 27 v to 40 v from the voltage multiplier . within the signal generating circuit 60 , the voltage branches off into a carrier frequency and two modulation frequencies . an example of the branching of the waveform is depicted in fig1 a - 1c . in fig3 the system supports two separate probes for placement on the patient . probe 63 represents the positive terminal as generated by signal generating 60 . the second probe 65 , is grounded within the circuit . for operation applying a bipolar waveform , the probes are connected to terminals 65 and 68 , respectively . terminal 68 is the output from reversing circuit 50 , which may be present and which acts to flip the signal generating circuit pursuant to pre - set timing constraints . the following ancillary systems are also present in this circuit . the low battery and system on indicator 10 which monitors the battery output via voltage multiplier 20 generates an alarm signal when battery output voltage drops below the pre - set limit , say 7 . 0 volts . it also shuts the system down if the battery voltage falls below the preset limit of approximately 6 . 0 volts . the analog / digital converter 92 converts the signal from the signal generating circuit 60 so that the patient can read it . the analog / digital converter 92 reads the level of output and converts it to the appropriate signal for the four gate integrated circuit which uses that signal to turn on the appropriate sequence of four leds 110 . finally the impedance detector 160 is used to determine if the system is being used on a person ( as opposed to someone just running the system without attaching it to a person ). while conventional impedence detection / determining apparatus uses an alternating 1000 cycle signal , it is preferred in the present invention to use the preferred 15 khz cycle as a reference for matching impedience . impedence is then measured by determining the voltage across the 15 khz leads on the patient &# 39 ; s body . in other preferred embodiments , it is desirable for any device incorporating the present invention to have an indication verifying , if not also displaying , the impedance of the subject . in yet another preferred embodiment , it is desirable for such a device to have a detector to confirm the presence of millimeter wave energy ; such a detector is constructed using a field detecting diode like analogous devices used for detecting laser energy ( e . g ., as in hand - held scanners ). fig4 depicts an exemplary flow chart of the timer unit 90 which the apparatus will use to monitor usage by the patient . a computer program embodying the protocol shown in the flow chart operating in combination with the present invention will prevent the patient from misusing the apparatus , and will allow the physician to set an individual treatment program and to monitor the patient &# 39 ; s compliance to the set program . the timer unit 90 will allow the therapist to set the number of days the system is to be used , the number of times per day the system will be used , and the time duration for each use . in various embodiments , conventional timing circuits , preferably with associated audible alarms , can be set to provide 1 , 2 , 3 , 10 , 20 , 30 , 40 , or 60 minutes of administration the waveform , or any particular duration as is desirable for affecting the patient . the program will start 800 with an origination decision module 810 . the origination decision module 810 will give the therapist three choices for use . if the individualized program 820 pathway is chosen , the timer unit will load the individualized program 820 . then the individualized program will begin with a display showing the current setting 900 , for each of the parameters ( i . e . the number of days of use , the number of times per day of use and the length of time for each use ). next the program will ask the therapist whether he wants to keep the current settings 900 , or input new settings 830 . if the therapist wishes to use the same settings as are already registered in the program , the individualized program 820 , will store 860 the values and will end 840 . however , if the therapist wishes to change the settings , the program will proceed to the change input values 850 module in which the computer will ask the therapist for the new values for the settings . then the computer will store 860 the new values and will end 840 . another selection which a therapist may make at the origination decision module 810 is to read the stored information from the patient &# 39 ; s system . if the therapist decides to access the read stored results 865 module , the setting and use information will be displayed 870 , and the therapist will decide whether to store the patient information in the patient storage module 880 , or else it will dump the information 890 and it will end 840 . a final selection which the therapist may access through the origination decision module 910 , is actually to use the system . if this choice is the inputted selection , the run timed program 910 will be initialized . the run timed program 890 will read the stored 860 values . then the program will check 920 the stored 860 values against the current running settings 900 which is the values of the run timed program 890 for this usage of the system . if the current running settings 900 for the number of days of use is greater than the stored 860 values , the program will end 840 without the system being turned on . next , the run timed program 890 will check the value of the stored 890 values for the number of uses for a given day and if the current running settings 900 is greater than the stored 890 values for number of uses for a day , the system will end 840 for that day and the system will not be able to be used until the next day . finally , as the system is being used , a running time clock will be compared to the run timed program , 890 , and when the current running settings in 900 is greater than the stored 890 values for the length of time for that session , the system will end 840 for that session and the system will not be able to be used until the next session period . in operation , it is preferred to use a conventional monopolar or bipolar waveform ; generally , the monopolar should be attempted first and , if the patient does not find relief , a bipolar waveform is then attempted . the modulated combined waveform ( combined waveform modulation of a gigatens signal , optionally including a synchronous or asynchronous conventional spike waveform ) is transmitted to the patient preferably using physiologically related reactive sites on the body . these sites can be derived from the meridians of acupuncture , from chakra trigger points , from shiatsu trigger points , or from dermatomes ( neurogenic ), myotomes ( myogenic ), or sclerotomes ( osteogenic ); examples of dermatomes on the male human body are shown in fig5 a and 5b . in general , these &# 34 ; physiologically related reactive sites &# 34 ; effectively join what may appear as anatomically distant sites on the body but which , by western , eastern , or other acknowledged standards , are actually related to the same physiological condition . see . e . g ., j . j . keegan et al ., &# 34 ; the segmental distribution of the cutaneous nerves in the limbs of man ,&# 34 ; anat . rec ., 102 : 409 ( 1948 ); j . h . martin , &# 34 ; somatic sensory system ii : anatomical substrates for somatic sensation ,&# 34 ; in principles of neural science , ed . by e . r . kandel et al . ( north holland , n . y . : elsevier , 1981 ); and janet g . travel et al ., myofascial pain and dysfunction : the trigger point manual ( baltimore , md . : williams & amp ; wilkins ) ( defining a &# 34 ; trigger point &# 34 ; as a focus of hyperirritability in a tissue that , when compressed , is locally tender and , if sufficiently hypersensitive , give rise to referred pain and tenderness , and sometimes to referred autonomic phenomena and distortion of proprioception ). in general , the combined modulated waveform is preferably administered to the patient using electrodes . the positive electrode is typically placed on the spinous process and the negative electrode is placed distally of the positive electrode with respect to the location of the discomfort perceived by the patient . ( it is not uncommon that alleviating one symptom will expose a prior existing condition which may , in fact , have been the cause of the perceived pain or other problem .) more particularly , the negative electrode ( s ) are preferably placed in the dermatome ( or myotome or sclerotome , or along the acupuncture meridian , etc .) corresponding to the location of discomfort as well as distally from such location . alternatively , for example , it may be desirable to place the negative electrode ( or another negative electrode ) at the point of insertion of the muscle apparently associated with the myotome of the location of the discomfort . ( as is typical in the medical arts , treatment is performed on a empirical basis due to the unpredictability of many treatments .) as an example , if treatment of a patient using conventional tens therapy is ineffective , the present invention can be used , with the electrodes placed as describe , and the intensity is increased until the patient feels any of the typical stimulation sensations ( itching , pins and needles , warmth , or an insect - biting sensation ). the intensity is then decreased and maintained just at subthreshold of this sensation ( with further adjustments in intensity depending upon the patient &# 39 ; s sensations ). the treatment time is preferably for about 10 to about 60 minutes , and the skin condition is typically observed every 10 to 20 minutes to check for irritation . in another mode , where the equipment is so designed , the patient is immersed in a bath ( preferably at least warm ), the positive electrode is placed on the spinous process at the back of the neck above the water line , and the negative electrode is placed in the water for whole body stimulation ( only low , microcurrents should be used ). this invention can be used in the treatment and / or prophylaxis of such conditions as migraine headaches , tension headaches , sinus headaches , tic doloreux , tmj ( tribomandibular joint ) syndrome , post - herpetic facial neuralgia , stress , spasticity , depression , drug dependence or withdrawal , anxiety , insomnia , general or localized muscle pain ( e . g ., neck , shoulder ( e . g ., bursitis ), elbow ( e . g ., tennis elbow ), back ( e . g ., sciatica ), wrist ( e . g ., carpal tunnel syndrome and other repetitive motion disorders )), post - operative pain , arthritis , phantom limb pain , finger pain , shingles , decubitus ulcers , gastroenterological pain , and other maladies . fig6 a - 6d depict schematic representations of electrode placements for treating various maladies , specifically ( in respect of the figures ) bursitis , postoperative pain , gi pain , and tmj pain . in general , blood flow is increased towards the negative electrode . the embodiment of the above description has been based on discrete components to enhance the understanding of the functional characteristics of the system . numerous modifications and adaptations thereof will be readily apparent to those skilled in the art without departing from the spirit and scope of the present invention .

this invention provides a system and apparatus for treating neurally responsive conditions by use of a novel combined waveform in combination with , and preferably modulated onto , a gigatens waveform administered to a patient . this modulated combined waveform can also be administered synchronously or asynchronously with a conventional mono - or bipolar spiked waveform , useful for tens applications and / or for stimulatory input to the patient .

the inventive system and methods disclosed herein comprise a simple - to - insert suture anchor which allows adjustment of suture or tissue tension prior to deployment , does not change the tension on the suture or tissue ( and as a result , the captured tissue ) when it is deployed , does not require a knot to secure the suture or tissue , and accepts multiple suture ends . referring now more particularly to the drawings , there is shown in fig1 - 6 a suture anchor 10 constructed in accordance with the principles of the present invention . the anchor 10 comprises a body 12 having a plurality of proximal suture barbs 14 , as well as bone barbs 16 . a portion of the outer surface of the body 12 comprises a suture recess 18 . an inner cavity 20 ( fig3 ) is provided for accommodating a suture pulley rod , to be described below . the distal end of the anchor body 12 includes bone displacement tabs 22 . within the suture recess 18 are disposed a suture pinch ramp 24 , a suture cleat 26 , and a suture eyelet 28 , which extends transversely through a width of the body 12 so that it is open to opposing sides of the body . now with reference to fig7 - 13 , the insertion system 30 for the anchor 10 will be described . the insertion system or inserter 30 comprises a suture pulley rod 32 ( fig7 ), suture cleat retainers 34 on the distal end of the pulley rod 32 ( also fig7 ), and an insertion tube 36 . in some embodiments , an optional metal distal tip 38 ( fig9 ) may be employed . a handle portion 40 of the insertion system 30 is illustrated in fig1 - 13 . the handle portion 40 comprises a knob release slide 42 and a proximal knob 44 . the anchor 10 has a number of features that are important to its innovative function . for example , the suture barbs 14 pinch the suture against the surrounding bone when the implant is deployed . the remaining barbs are the bone barbs 16 , distal to the suture barbs 14 , function to engage the bone during the initial and final deployment . the suture recess 18 , because of its recessed profile relative to remaining portions of the outer surface of the body 12 , allows the suture to slide between the anchor body and adjacent bone during the initial deployment . the inner cavity 20 for the suture pulley rod 32 , allows for the metal suture pulley rod 32 to support the anchor during initial deployment . the bone displacement tabs 22 displace the bone distal to the suture to allow for optimal suture sliding during initial deployment . the suture pinch ramp 24 helps to maintain tension during individual tensioning of the suture . it is configured to slope outwardly in a proximal direction , so that its distal end is at a depth approximating the depth of the suture recess 18 and its proximal end is at the outer surface of the implant body 12 , i . e . a depth of approximately zero . the suture cleat 26 pinches the suture to increase the suture pullout strength of the construct . the suture eyelet 28 allows for one or more suture ends to be placed in the implant . each suture end is individually tensionable , as well be described below . though the tip 46 of the anchor 10 is illustrated as being closed , as shown in fig9 , the optional metal tip 38 may be added to the anchor 10 to allow for the anchor to be inserted directly into bone without the requirement of a pilot hole . the insertion system 30 , as well , has several important features which contribute to the innovative function of applicant &# 39 ; s inventive system . in particular , the suture pulley rod 32 , in the initial deployment stage , allows the suture to move freely in the suture eyelet 28 , by preventing the suture from entering the suture cleat 26 . the pulley rod 32 also increases the strength of the anchor 10 by extending to the distal tip 46 of the anchor body 12 during initial deployment . the insertion tube 36 , as well as the pulley rod 32 , transmits the insertion force from a mallet to the anchor during initial deployment . rotation of the proximal knob 44 actuates a mechanism that retracts the pulley rod 32 between initial and final deployment stages . the knob release slide 42 releases the knob 44 to allow for removal of the inserter 30 after final deployment . the suture cleat retainers 34 maintain a set gap in the suture cleat 26 during final deployment . the remaining fig1 - 32 will now be referenced in connection with a description of methods of using the inventive system to deploy an anchor 10 in bone 48 . to deploy the anchor 10 in a suitable bone site , suture 50 is first passed through soft tissue ( not shown ) requiring repair . viewing , for example , fig1 , the suture loops 51 in the suture 50 would normally be occupied by the soft tissue to be approximated against the bone 48 , but that tissue is not shown , for clarity . alternatively , soft tissue itself may be anchored directly in place within the desired bone site 48 , rather than using suture 50 , in which case the tissue is manipulated in the same way as the suture to be described in this explanation . for this reason , though the term “ suture ” is used throughout this specification , for convenience , the term should be considered sufficiently broad to include other media having similar functional characteristics , including soft tissue itself . a pilot hole 52 ( fig9 and 28 ) is drilled or punched into the attachment site ( bone 48 ), through the cortical bone layer 54 and into the cancellous bone layer 56 . in some circumstances , the optional metal distal tip 38 may be employed ( fig9 ), in which case the step of drilling a pilot hole is unnecessary . the suture is then fed through the suture eyelet 28 , as shown in fig1 and 15 , directly or with a snare . one or more suture ends 58 , 60 ( fig1 ) may be placed through the eyelet 28 . with the anchor 10 and attached inserter 30 positioned at the desired bone site , as shown in fig1 and 15 , initial deployment of the anchor 10 can occur . it should be noted that fig1 and 17 , and fig2 , illustrate the same step as fig1 and 15 , with the suture 50 removed for clarity . to initiate this initial deployment , a mallet is driven against the proximal end of the handle portion 40 to drive the anchor 10 distally to its initial deployment position , as shown in fig1 and 19 , and also in fig2 and 21 , and 29 , with the suture again removed for clarity . at this juncture , the suture recess 18 is acting to apply pressure to the sutures or tissue 50 disposed between the outer surface of the anchor body 12 and the adjacent bone surface , as well as against the suture pinch ramp 24 . this pressure maintains the tension on the suture 50 . the free suture ends 58 , 60 may be individually tensioned around the suture pulley rod 32 to approximate the tissue within the suture loops 51 up against the anchor and repair site and its surrounding bone 48 . if the suture is over - tensioned , a probe may be used to loosen the tissue side of the suture . once the desired tension is achieved , the suture pulley rod 32 is pulled proximally into the insertion tube 36 , by rotating the threaded proximal knob 44 on the handle portion 40 until further rotation is prevented . when the tube 36 is retracted by the rotation of knob 44 , the gap of the suture cleat 26 is exposed . at this point , the suture cleat retainers 34 are in position on either side of the suture cleat 26 . this retracted pulley rod position is illustrated in fig2 and 27 , which is the position required prior to the final insertion step . as noted above , the suture cleat 26 is exposed and held open by the suture cleat retainers 34 , which thus allow the suture to pull into proper position during final insertion . at this juncture , the final deployment steps are initiated , as shown in fig2 and 23 , and also in fig2 and 25 , and 30 , wherein the suture 50 has been removed for clarity . with the gap of the suture cleat 26 maintained by the suture cleat retainers 34 , the inserter handle 40 is again malleted , directing insertion force into the insertion tube 36 until the anchor 10 rests below the surface of the bone , as shown in fig3 . because the suture 50 has maintained an equal distance from the surface of the bone , post - tensioning and post - final deployment , the tension in the suture 50 is maintained . if additional tension is required , the anchor can be malleted deeper into the bone , pulling the suture ends with it , thereby increasing tension . the suture 50 is now pinched between the suture barbs 14 and the bone on the tissue side of the anchor , as shown in fig2 . it is also pinched between the suture cleats 26 on both sides of the anchor body 12 . finally , the free suture ends 58 , 60 are pinched between the suture barbs 14 and the bone opposite to the tissued side of the anchor . the suture pulley rod 32 may now be pulled out of the anchor body 12 , as shown in fig3 , releasing the inserter 30 by actuating the knob release slide 42 to allow the threaded knob 44 to be free to rotate . the knob 44 is then rotated until the inserter is released from the implant . at this juncture , the free suture ends can be cut , as shown in fig3 , which completes the repair . accordingly , although an exemplary embodiment of the invention has been shown and described , it is to be understood that all the terms used herein are descriptive rather than limiting , and that many changes , modifications , and substitutions may be made by one having ordinary skill in the art without departing from the spirit and scope of the invention , which is to be limited only in accordance with the following claims .

an anchoring system for securing tissue to bone includes an implant having a body through which a suture eyelet extends transversely , a suture recess extending along a portion of a length of the body , having a predetermined depth below an outer surface of the body , and a suture pinch ramp disposed at a proximal end of the suture recess . the suture pinch ramp has a depth approximately equal to the predetermined depth at a distal end thereof and sloping outwardly in a proximal direction so that a depth of a proximal end of the suture pinch ramp approaches zero . an insertion member includes an insertion tube and a handle which is engageable with the anchor body to deploy the anchor in a selected bone site .

the following detailed description includes references to the accompanying drawings , which form a part of the detailed description . the drawings show , by way of illustration , specific embodiments in which the invention may be practiced . these embodiments , which are also referred to herein as “ examples ,” are described in enough detail to enable those skilled in the art to practice the invention . the embodiments may be combined , other embodiments may be utilized , or structural , logical and electrical changes may be made without departing from the scope of the present invention . the following detailed description is , therefore , not to be taken in a limiting sense , and the scope of the present invention is defined by the appended claims and their equivalents . in this document , the terms “ a ” or “ an ” are used , as is common in patent documents , to include one or more than one . in this document , the term “ or ” is used to refer to a nonexclusive or , unless otherwise indicated . furthermore , all publications , patents , and patent documents referred to in this document are incorporated by reference herein in their entirety , as though individually incorporated by reference . in the event of inconsistent usages between this document and those documents so incorporated by reference , the usage in the incorporated reference ( s ) should be considered supplementary to that of this document ; for irreconcilable inconsistencies , the usage in this document controls . in varying examples , a morphological template can be generated from a tachyarrhythmia episode and used to identify a later episode . for example , a tachyarrhythmia episode can be detected by an implantable medical device and analyzed to determine whether the episode is a type that necessitates antitachyarrhythmia therapy . in one example , a morphological graph of a tachyarrhythmia episode is presented to a human analyst , such as a physician , and an assessment of the tachyarrhythmia episode is received from the human analyst . the assessment can , for example , include an input that indicates whether the human analyst deems the tachyarrhythmia episode is a vt episode or a svt episode . in another example , the tachyarrhythmia episode can be analyzed by a computer to determine whether it is a vt or svt episode . the computer can be in an implanted medical device , or external to the patient . a morphological template can be generated from the tachyarrhythmia episode and later used to identify a similar episode as it is occurring . for example , if a tachyarrhythmia episode correlates with an svt template , an svt can be declared , i . e . the episode can be identified as an svt and treated accordingly . templates can be selected or discarded based a variety of factors including conditions in the patient or characteristics of arrhythmias . in an example , a template is a sampled data representation of a heart depolarization . in another example , a template is a set of selected features from a sampled data representation of a heart depolarization . in another example a template is generated from multiple svt beats , for example by taking an average of several beats . fig1 shows a schematic illustration of an exemplary medical device 10 and a heart 20 . a processing circuit 30 communicates with a sensing circuit 40 and an antitachyarrhythmia therapy circuit 50 . the sensing circuit 40 detects an intrinsic electrical signal from a heart . the antitachyarrhythmia therapy circuit 50 delivers defibrillation or other antitachyarrhythmia therapy to the heart 20 . the processing circuit 30 analyzes input from the sensing circuit 40 and directs the antitachyarrhythmia therapy circuit 50 to administer antitachyarrhythmia therapy as necessary . the processing circuit 30 also sends information to a memory circuit 60 . the memory circuit 60 includes a storage medium , such as solid state ram . in an exemplary configuration , the processing circuit 30 sends data received from the sensing circuit 40 during a tachyarrhythmia episode to the memory circuit 60 and the memory circuit 60 stores the data for later reference . the processing circuit 30 also communicates with a wireless communication system 70 . the wireless communication system 70 sends data to or receives data from an external system 80 , which typically includes a display system on which a user can view a graphical representation of the data . the medical device 10 can be configured as an implantable device , but is not necessarily implantable . while one processing circuit is shown , examples of the medical device including multiple processors are also possible . in varying examples , the processor is in a device implanted in the patient , or in a device such that is external to the patient , such as a programmer or a remote computer system . fig2 a is a flow chart that illustrates a process in which a svt episode is identified and declared . at 210 , an implantable medical device senses an intrinsic heart signal . at 220 , the medical device stores a portion of the intrinsic electrical heart signal that was sensed during a tachyarrhythmia episode . at 230 , a user indicates whether the portion of the intrinsic electrical heart signal is considered to be indicative of a svt . in an alternative embodiment , a processor analyzes the portion of the signal to determine whether it is indicative of a svt . if the portion of the intrinsic electrical heart signal is determined to be indicative of a svt , a svt template is generated at 240 . in an example , a processor in the implanted medical device generates the template . in another example , the template is generated on an external computer system and downloaded to the implanted medical device . various techniques can be used to generate the template . in an example , the template consists of one heart beat from the svt episode . alternatively , the template includes more than one heart beat . in an example , the template consists of the actual data from the intrinsic electrical heart signal as the template . alternatively , a processor converts the intrinsic electrical heart signal data into a file that requires less storage space than the original data . returning to fig2 a , at 250 , a processor determines at least one degree of similarity between a second portion of the heart signal from a later tachyarrhythmia episode and at least one svt template . the degree of similarity is a quantity that is computed through an algorithm that uses the sensed intrinsic electrical heart signal ( or a derivative thereof ) as an input . in varying examples , determining the degree of similarity includes computing a feature correlation coefficient , a wavelet coefficient , or areas or integrals of a heart signal waveform or an approximation thereof . in varying examples , determining the degree of similarity involves computation of data in the time domain , wavelet domain , frequency domain , or other domains . at 260 , the device declares the second portion of the heart signal to represent a svt episode if the degree of similarity exceeds a threshold valued . in one example , a processor in the medical device declares a svt episode if a feature correlation coefficient for a heart beat exceeds a threshold . in another example , a processor declares a svt if multiple feature correlation coefficients for respective multiple beats exceed a threshold value . in one scenario , a svt is declared if a specified fraction of heart beats in a sequence of beats ( e . g . 3 out of 10 beats ) exhibit a feature correlation coefficient that exceeds a threshold . in another example , a svt is declared if an average feature correlation coefficient for a number of beats exceeds a threshold ( e . g . the average for 10 beats ≧ 0 . 94 ). in an example , the processor determines a degree of similarity between the second portion and multiple svt templates . in one example , the processor begins determining degrees of similarity for the second portion for a sequence of templates and stops determining the degree of similarity if the degree of similarity for one of the templates exceeds a threshold . in other words , the processor compares the heart signal to a sequence of templates until a template match is found or all the templates are used . in another example , the portion of the heart signal is compared to all of the templates regardless of whether a match is found , and an svt is declared if the degree of similarity for any one of the templates exceeds a threshold . in addition to supraventricular tachyarrhythmia ( svt ) episodes , a heart can exhibit other types of tachyarrhythmia that do not warrant antitachyarrhythmia therapy , including some instances ventricular tachyarrhythmia ( vt ). such other non - lethal vt episodes can also be identified and used to generate templates . fig2 b is another flow chart that illustrates a process in which a degree of similarity is determined between a svt template and a heart signal . at 212 , an implantable medical device senses an intrinsic heart signal . at 222 , the medical device stores a tachyarrhythmia portion of the intrinsic electrical heart signal that was sensed during a tachyarrhythmia episode . at 232 , a processor determines at least one degree of similarity between the tachyarrhythmia portion of the heart signal and at least one svt template . at 242 , the processor determines whether the at least one degree of similarity exceeds at least one threshold value . in an example , the processor determines degrees of similarity for multiple beats and determines whether the degree of similarity exceeds a threshold for at least a predetermined fraction of the beats ( e . g . 3 out of 8 beats ). if the at least one degree of similarity exceeds at least one threshold value , the portion of the heart signal is declared to represent a svt episode and antitachyarrhythmia therapy is suppressed , at 252 . if the at least one degree of similarity does not exceed at least one threshold value ( e . g . fewer than 3 out of 10 beats exhibit a degree of similarity in excess of a threshold ), the portion of the heart signal is declared to represent a vt episode and antitachyarrhythmia therapy is delivered , at 262 . the portion of the heart signal is stored and later presented to a user . if , at 272 , an input from the user indicates that the portion is indicative of svt , an svt template is generated at 282 . if another tachyarrhythmia event occurs , the process returns to box 232 and determines at least one degree of similarity between the tachyarrhythmia portion of the heart signal from the next tachyarrhythmia event and at least one svt template , which can be the template generated at 282 . if the user input does not indicate that the portion is indicative of svt , a template is not generated , at 292 . fig2 c is a flow chart that illustrates a process in which a template is generated for an arrhythmia morphology that does not require antitachyarrhythmia therapy . at 205 , an implantable medical device senses an intrinsic heart signal . at 215 , the medical device stores one or more portions of the intrinsic electrical heart signal that were sensed during a tachyarrhythmia episode . at 225 , a graphical representation of one or more stored portions of the intrinsic electrical heart signal is presented to a user . at 235 , the user provides input that identifies at least one tachyarrhythmic portion of the intrinsic electrical heart signal that did not require antitachyarrhythmia therapy . the portion of the intrinsic electrical heart signal that did not require antitachyarrhythmia therapy can be , but is not necessarily , indicative of svt . at 245 , input is received from a user designating at least one portion of the intrinsic electrical heart signal that should be used to generate a template . at 255 , a template is generated from a portion of the heart signal designated by the user . in an embodiment , an external computer system receives the input from the user to generate the template , which is downloaded to the implantable medical device . in another example , the user communicates directly with the implantable medical device , which generates the template . in an example , the user designates multiple portions of the heart signal , and multiple templates are generated . referring again to fig2 c , at 265 , a processor in the medical device determines one or more degrees of similarity between a second portion of the intrinsic electrical heart signal from a later tachyarrhythmia episode and the template . at 275 , the processor determines whether the one or more degrees of similarity exceed a threshold value . if the one or more degrees of similarity exceed a threshold value , the processor suppresses an antitachyarrhythmia therapy at 285 . in an alternative embodiment , in lieu of presenting a graphical representation to a user and receiving an input , a portion of the heart signal is analyzed automatically by a processor to determine whether antitachyarrhythmia therapy is appropriate . fig3 is a flow chart that illustrates a method in which a degree of similarity is determined between a monitored heart signal and a svt template selected from a group of candidate svt templates . at 305 , a medical device monitors a heart signal . at 310 , portions of the heart signal that are indicative of svt are identified . in varying examples , the portions that are indicative of svt can be identified by a physician , for example , or identified by an automated computerized analysis . at 315 , portions of the heart signal that are indicative of svt are stored as candidate svt templates . the candidate template can be stored with a corresponding heart rate at which the template was observed . one or more selection protocols can be used to select a svt template from a group of candidate svt templates when analyzing a later tachyarrhythmia episode . for example , at 320 , a svt template is selected from a group of candidate templates based upon the heart rate associated with the candidate templates . the processor selects a template having a heart rate that is closest to the heart rate of the later tachyarrhythmia episode . alternatively , at 325 , a candidate svt template is selected based other information about the patient . in an example , the drug treatment regimen of a patient is considered in the selection of a svt template . the morphology of svt episodes in a patient can vary depending upon the drug treatment regimen of the patient . in one example , the medical device stores information about drug treatment regimens associated with the tachyarrhythmia episodes used to generate the candidate templates . the current drug regimen is also stored in the device . the processor selects a svt template based upon a similarity between the drug treatment associated with the selected template and the current drug treatment . in another example , the medical device detects one or more of neural activity , patient activity , sleep state , hemodynamic status , transthoracic impedance , or cardiac impedance . in further examples , the device detects rem ( random eye movement ) status , sympathetic / parasympathetic tone , intercardiac blood pressure including right ventricular pressure , left atrial pressure , or pulmonary artery pressure , oxygen saturation , heart size and contractability , blood flow , or edema . in varying examples , the medical device considers one or more of these parameters in selecting an svt template . in another example , the processor identifies one or more characteristics of the patient , and selects a svt template using statistics from other patients having similar characteristics . in varying examples , the characteristics include ( but are not limited to ) as height , weight , age , disease history , medication , and patient status ( such as neural activity , blood pressure , etc .) in another alternative , at 330 , a candidate svt template is selected based upon multiple factors . in an example , both the heart rate and the drug treatment regimen are taken into consideration . at 335 , the processor determines a degree of similarity between the heart signal from the later tachyarrhythmia episode and the selected svt template . the processor compares the degree of similarity to at least one threshold , at 340 . if the degree of similarity falls below a threshold , a svt episode is not declared . in an example , if a svt episode is not declared , the medical device declares a vt episode at 341 and delivers a ventricular antitachyarrhythmia therapy at 342 . alternatively , other determinations can be made before the medical device administers ventricular antitachyarrhythmia therapy . if the degree of similarity does exceed a threshold , the medical device declares the heart signal from the later tachyarrhythmia episode to represent a svt episode at 345 . the medical device then suppresses ventricular antitachyarrhythmia therapy at 350 . fig4 is a flow chart that illustrates a method in which a heart signal from a tachyarrhythmia episode is compared to a normal sinus rhythm and to a svt template . at 405 , a medical device senses an intrinsic electrical heart signal . the medical device monitors the heart rate at 410 . at 415 , the medical device compares the heart rate to a threshold . if the heart rate does not exceed the threshold , the medical device continues sensing the heart signal but does not perform a tachyarrhythmia discrimination algorithm . if the heart rate does exceed a threshold , the medical device declares a tachyarrhythmia episode at 420 . at 425 , the medical device compares the tachyarrhythmia portion of the heart signal to the normal sinus rhythm ( nsr ) template for the patient . in an example , the medical device computes a feature correlation coefficient between the tachyarrhythmia portion of the heart signal and the nsr template . if the tachyarrhythmia portion of the heart signal sufficiently correlates with the nsr template ( e . g . the feature correlation coefficient exceeds a threshold ), the medical device declares the tachyarrhythmia portion of the heart signal to represent a svt episode at 430 and suppresses a ventricular antitachyarrhythmia therapy during the episode , at 435 . if the tachyarrhythmia portion of the heart signal is not similar to the nsr template , at 440 the medical device determines a degree of similarity between a portion of the heart signal and a svt template . at 445 , the medical device determines whether the degree of similarity exceeds a threshold . if the degree of similarity exceeds a threshold , the medical device declares the portion of the heart signal to represent a svt episode at 450 . in an example , declaring the portion of the heart signal to represent a svt episode merely means making a determination to executing a response that is consistent with a svt , such as suppressing a ventricular antitachyarrhythmia episode at 455 . if , at 445 , the degree of similarity does not exceed a threshold , the medical device stores the tachyarrhythmia portion of the heart signal at 460 . the stored portion is displayed to a user at 465 and an input is received from the user at 470 . at 475 , if the user indicates that the heart signal is indicative of svt , a template is generated from the tachyarrhythmia portion of the heart signal , at 480 . fig5 is a flow chart that illustrates examples of methods by which a svt template is added and an old svt template is discarded . a medical device monitors a heart signal at 510 . portions of the heart signal that are indicative of svt are identified at 520 through computer analysis or input from a user . the medical device stores the portions of the heart signal that are indicative of svt as svt candidate templates at 530 . at 540 , the medical device discards the oldest svt template . alternatively , the medical device tracks the frequency of similarity of a portion of the heart signal from a tachyarrhythmia episode to one of a plurality of svt templates at 550 and discards the svt template exhibiting the least frequent similarity with the heart signal and saves a new template at 560 . in another alternative example , the medical device discards a svt template with a heart rate similar to heart rates of other svt templates at 570 . in the example at 580 , the medical device discards a svt template that is associated with a discontinued drug therapy regimen . in the example at 590 , the medical device discards a svt template that is most correlated to other svt templates . in varying examples , a decision of which template to discard is made by a computer system , the medical device , or a user who inputs a direction to discard a template . fig6 is a flow chart that illustrates an example of a process in which a heart signal from a tachyarrhythmia episode is compared against a normal sinus rhythm ( nsr ) template 630 and then a supraventricular tachyarrhythmia ( svt ) template 660 . at 610 , a tachyarrhythmia episode is detected . a nsr correlation module 620 computes a nsr feature correlation coefficient ( fcc ) for 10 heart beats . if the nsr feature correlation coefficient is equal to or greater than 0 . 94 for 3 out of 10 beats , the correlation module 620 declares a svt and a svt protocol 640 is followed . if the fewer than 3 out of 10 beats have a nsr feature correlation coefficient greater than or equal to 0 . 94 , a svt correlation module 650 computes a svt feature correlation coefficient for the 10 heart beats . if the svt feature correlation coefficient is equal to or greater than 0 . 95 for 3 out of 10 beats , the svt correlation module 650 declares a svt . if fewer than 3 out of 10 beats have a svt feature correlation coefficient equal or greater than 0 . 95 , the episode is treated as a ventricular tachyarrhythmia ( vt ) and a vt protocol is followed . for example , vt protocol 670 can include administration of antitachyarrhythmia therapy . fig7 is a block diagram of an exemplary implantable device 700 incorporating a processor 710 and that runs software modules to analyze a signal from a heart 720 through a lead 770 . a sensor 720 detects an intrinsic electrical heart signal . the processor 710 receives the signal from the sensor 720 and interprets the signal to determine whether an antitachyarrhythmia therapy should be delivered . a similarity module 740 determines a degree of similarity between portion of the heart signal from a tachyarrhythmia episode and a svt template representative of a previous svt episode . a suppress therapy module 750 suppresses a ventricular antitachyarrhythmia therapy if the degree of similarity exceeds a threshold value . svt templates are stored in a memory circuit 760 . a lead 770 delivers ventricular antitachyarrhythmia therapy as directed by the processor . while the present examples have generally been described in terms of an implanted or implantable device , the presently described examples can also be implemented in non - implantable devices and systems . fig8 shows an example of a normal sinus rhythm morphology . fig9 shows an example of a svt morphology . in an example , a template includes a morphology for a single beat , as shown in fig8 . in another example , a template includes multiple beats , as shown if fig9 . in another example , a template for an atrial tachyarrhythmia can be created . the atrial tachyarrhythmia template can be used to declare a future episode of atrial tachyarrhythmia and suppress antitachyarrhythmia therapy as appropriate . varying algorithms can be used to generate a template and determine the degree of similarity between a heart signal and a template . in one example , a set of pre - determined rules are used to locate a number of points on a waveform , and those points are used as the template for comparison against a heart signal . in an example , eight pre - determined points can be located . in one example , the maxima , minima , and inflection points are located . the located points are stored as the template . features are extracted from a portion of the heart signal by aligning the portion of the heart signal with the template . in an example , a peak on the template is aligned with a peak on the portion of the heart signal from one beat of a tachyarrhythmia episode . the amplitude of the points on the portion of the heart signal is measured at times corresponding to the points in the template . to determine the degree of similarity , a feature correlation coefficient ( fcc ) is computed using the amplitudes measured from the signal and the amplitude in the template . computation of the feature correlation coefficient is further described in u . s . pat . no . 6 , 708 , 058 , which is incorporated herein by reference in its entirety . in an example , a cardiac rate channel signal and a shock channel signal are sensed . the rate channel signal is measured from a sensing tip to a distal coil on a lead . the shock channel is measured from a distal coil to a proximal coil of the rv lead . a fiducial point is determined from the cardiac rate channel signals . a shock channel signal is aligned using the fiducial point . a template is generated using the aligned shock channel signal . use of signals from rate and shock channels is further described in u . s . pat . no . 6 , 708 , 058 , which is incorporated by reference in its entirety . in other examples , a signal is sensed and then aligned using the same channel from which it was sensed . in another example , a processor computes a wavelet transform or fourier transform of the signal from which a template is to be generated . a predetermined number of largest wavelet coefficients are saved as a template . features are extracted from a heart signal by aligning the peak of the signal with the peak of the template and computing the wavelet transform of the aligned tachy beat waveform . a predetermined number of largest wavelet coefficients are saved . the sum of the absolute value of the differences between the saved wavelet coefficients and the wavelet coefficients in the template is determined and divided by the sum of absolute value of the wavelet coefficients in the template . the resulting value is subtracted from 1 and multiplied by 100 to provide a “ percent match score ”, which is compared to a threshold . in an example , the threshold is 70 %, and beats having a percent match score greater than or equal to 70 % are considered svt in origin . in an example , if 3 out of 8 beats are svt , an svt episode is declared . wavelet - based algorithms are further discussed in u . s . pat . nos . 6 , 393 , 316 and 5 , 782 , 888 , which are incorporated herein by reference in their entirety . in another example , a heart signal waveform is approximated as three consecutive triangles . the areas of each of the triangles is calculated and saved in a template . to extract features from a portion of a heart signal , peaks in the heart signal are aligned with the template , and the heart signal is approximated as three triangles . the area of each of the three triangles is calculated . to determine the degree of similarity to the template , a “ similarity score ” is determined based on the sum of the differences in the areas of the signal triangles and the template triangle . the similarity score is inversely proportional to this sum . if the similarity score is greater than a threshold , the beat is considered svt in origin . if a predetermined number of beats exceed a threshold , an svt episode is declared . the preceding descriptions of techniques for determining a degree of similarity are considered exemplary . other techniques , or variations of the described techniques , can be employed with the methods described in this application . it is to be understood that the above description is intended to be illustrative , and not restrictive . for example , the above - described embodiments ( and / or aspects thereof ) may be used in combination with each other . many other embodiments will be apparent to those of skill in the art upon reviewing the above description . the scope of the invention should , therefore , be determined with reference to the appended claims , along with the full scope of equivalents to which such claims are entitled . in the appended claims , the terms “ including ” and “ in which ” are used as the plain - english equivalents of the respective terms “ comprising ” and “ wherein .” also , in the following claims , the terms “ including ” and “ comprising ” are open - ended , that is , a system , device , article , or process that includes elements in addition to those listed after such a term in a claim are still deemed to fall within the scope of that claim . moreover , in the following claims , the terms “ first ,” “ second ,” and “ third ,” etc . are used merely as labels , and are not intended to impose numerical requirements on their objects . the abstract of the disclosure is provided to comply with 37 c . f . r . § 1 . 72 ( b ), requiring an abstract that will allow the reader to quickly ascertain the nature of the technical disclosure . it is submitted with the understanding that it will not be used to interpret or limit the scope or meaning of the claims . in addition , in the foregoing detailed description , it can be seen that various features are grouped together in a single embodiment for the purpose of streamlining the disclosure . this method of disclosure is not to be interpreted as reflecting an intention that the claimed embodiments require more features than are expressly recited in each claim . rather , as the following claims reflect , inventive subject matter lies in less than all features of a single disclosed embodiment . thus the following claims are hereby incorporated into the detailed description , with each claim standing on its own as a separate embodiment .

this document discusses , among other things , a method of identifying a non - fatal tachyarrhythmia episode by determining a degree of similarity between the episode and a template generated from a previous tachyarrhythmia episode .

the present invention was actually reduced to practice by the present invention as shown in the fig1 through 12 , and with reference to table 1 showing the material and dimensions used for substantially each item . although specific materials , dimensions , and hardware are indicated in table 1 , such indications are for purposes of example only and not meant to be limiting , in that different dimensions , hardware , and materials may be substituted therefore without deviating from the spirit and scope of the invention . with reference to fig1 through 7 , and table 1 , the various items of the invention are either welded or bolted together , or otherwise secured . a canopy 45 is provided for shielding a person sitting on seat 8 from the sun , and for cosmetic purposes . typically , the frame is fabricated from steel tubing and angle iron , for example . table 1__________________________________________________________________________ref . ref . no . description no . description__________________________________________________________________________ 1 1 ea . @ 1 / 8 &# 34 ; × 48 &# 34 ; × 48 &# 34 ; * aluminum 27 1 ea . @ 11 / 2 &# 34 ; × 11 / 2 &# 34 ; × 16 ga . × 5 &# 39 ; 0 &# 34 ; steel tube 2 1 ea . @ 3 / 16 &# 34 ; × 47 3 / 4 &# 34 ; × 48 &# 34 ; * 28 1 ea . @ 1 &# 34 ; dia . × 55 &# 34 ; × 171 / 2 &# 34 ; steel aluminum latch bar 3 4 ea . @ 11 / 2 dia . × 4 &# 39 ; 3 &# 34 ; * 29 1 ea . @ 1 &# 34 ; × 1 &# 34 ; × 14 ga . × 18 &# 34 ; steel aluminum tube angle 4 3 ea . @ 21 / 2 &# 34 ; × 21 / 2 &# 34 ; × 3 / 16 &# 34 ; 30 2 ea . steel latching teeth aluminum angle 5 4 ea . @ 1 &# 34 ; dia . × 2 &# 34 ; long × 1 / 4 &# 34 ; 31 2 ea . @ 3 / 8 &# 34 ; × 21 / 4 &# 34 ; cam bolt , nut eyebolt & amp ; lock washer 6 4 ea . springs 32 4 ea . @ 1 / 4 &# 34 ; × 11 / 4 &# 34 ; stainless hex bolt , nut , & amp ; lock washer 7 2 ea . @ 1 / 4 &# 34 ; × 1 &# 34 ; × 1 &# 34 ; hardened 33 12 ea . @ 11 / 4 &# 34 ; × 11 / 2 &# 34 ; hex bolt , nut , steel d notch stops or steps & amp ; lock washer 8 1 ea . @ 1 / 4 &# 34 ; × 16 &# 34 ; × 44 &# 34 ; * 34 24 ea . @ 1 / 4 &# 34 ; × 11 / 4 &# 34 ; stainless steel aluminum seat hex bolt nut , & amp ; lock washer 9 5 ea . @ 1 &# 34 ; ballbearing pillow 35 8 ea . @ 3 / 8 &# 34 ; × 21 / 2 &# 34 ; cam bolt , nut , block & amp ; washer10 1 ea . @ 1 &# 34 ; dia . × 48 &# 34 ; * 36 68 ea . @ 1 / 4 &# 34 ; × 11 / 4 &# 34 ; stainless steel hex aluminum bar bolt , nut , & amp ; lock washer11 2 ea . @ 1 &# 34 ; × 51 / 2 &# 34 ; * aluminum 37 6 ea . @ 3 / 8 &# 34 ; × 21 / 2 &# 34 ; cam bolt , nut , latch spindle & amp ; washer12 1 ea . @ 48 &# 34 ; × 48 &# 34 ; × 236 . acrylic 38 2 ea . @ 3 / 8 &# 34 ; × 2 3 / 4 &# 34 ; cam bolt , nut , plastic ( clear ) & amp ; washer13 1 ea . @ 471 / 2 &# 34 ; × 48 &# 34 ; × 1 / 2 &# 34 ; acrylic 39 1 ea . @ 3 / 32 &# 34 ; × 2 &# 34 ; × 47 &# 34 ; * aluminum plastic ( clear ) 14 1 ea . @ 1 / 4 &# 34 ; × 11 / 2 &# 34 ; × 2 &# 34 ; × 4 &# 39 ; 5 &# 34 ; 39 &# 39 ; 2 ea . @ 3 / 32 &# 34 ; × 2 &# 34 ; × 451 / 2 &# 34 ; * aluminum steel angle15 4 ea . @ 1 &# 34 ; × 1 &# 34 ; × 16 ga . × 9 &# 39 ; 0 &# 34 ; 40 8 ea . @ 1 / 4 &# 34 ; × 2 &# 34 ; × 4 &# 34 ; * aluminum angle steel tube16 2 ea . @ 1 &# 34 ; × 2 &# 34 ; × 1 &# 34 ; × 16 &# 34 ; × 1 / 4 41 1 ea . @ 1 / 4 &# 34 ; × 3 &# 34 ; × 7 &# 34 ; × 3 &# 34 ; steel steel channel bracket17 4 ea . @ 3 &# 34 ; × 31 / 2 &# 34 ; × 1 / 4 &# 34 ; steel 42 1 ea . @ 3 / 4 &# 34 ; × 3 / 4 &# 34 ; × 5 &# 39 ; 0 &# 34 ; × 16 ga . window braze target arm18 4 ea . @ 1 &# 34 ; × 1 &# 34 ; × 1 / 8 &# 34 ;× 4 &# 39 ; 0 &# 34 ; 43 1 ea . @ 10 &# 34 ; dia . × 16 ga target steel angle window frame19 8 ea . @ 1 &# 34 ; × 1 &# 34 ; × 1 / 8 &# 34 ; × 4 &# 34 ; 44 drain bushing ( 1 &# 34 ; tank adapter ) steel angle frame bracket20 4 ea . @ 1 &# 34 ; × 1 &# 34 ; × 16 ga . × 4 &# 39 ; 2 &# 34 ; 45 1 ea . @ 7 &# 39 ; 6 &# 34 ; × 4 &# 39 ; 6 &# 34 ; canopy steel tube21 3 ea . @ 1 &# 34 ; × 1 &# 34 ; × 16 ga . × 4 &# 39 ; 0 &# 34 ; 46 4 ea . @ 1 / 2 &# 34 ; × 3 / 16 &# 34 ; countersunk bolt steel tube22 8 ea . @ 1 &# 34 ; × 2 &# 34 ; 1 / 8 &# 34 ; × 4 &# 34 ; steel 47 1 ea . @ 1 &# 34 ; × 2 &# 34 ; × 1 &# 34 ; × 4 3 / 4 &# 34 ; × 1 / 4 &# 34 ; angle frame bracket steel channel23 1 ea . @ 1 &# 34 ; × 1 &# 34 ; × 16 ga . × 4 &# 39 ; 1 / 2 &# 34 ; 48 1 ea . @ 1 &# 34 ; × 41 / 2 &# 34 ; vertical shaft steel tube24 2 ea . @ 11 / 2 &# 34 ; × 11 / 2 &# 34 ; × 16 ga . × 9 &# 39 ; 2 &# 34 ; 49 1 ea . aluminum ladder steel tube 50 2 ea . rubber bumper25 1 ea . @ 11 / 2 &# 34 ; × 11 / 2 &# 34 ; × 16 ga . × 4 &# 39 ; 3 &# 34 ; 101 1 ea . 1 &# 34 ; × 3 &# 34 ; pipe nipple steel tube26 2 ea . @ 11 / 2 &# 34 ; × 11 / 2 &# 34 ; × 16 ga . × 47 103 &# 34 ; 1 ea . 1 &# 34 ; gate value steel tube * 606 - t6 tempered aluminum__________________________________________________________________________ as shown in fig8 the front of the target apparatus of the invention further includes a clear or transparent shield 12 of acrylic plastic , for example , for protecting a person sitting on seat 8 from being struck by an errant ball or like missile thrown at target 43 . one example of a method of mounting the shield 12 is via use of the hardware indicated , including window frame 18 and window brazes 17 . also , the front panel 13 of the water tank ( see fig9 ) is fabricated from a clear or transparent material such as acrylic plastic , for example . the transparent shield 12 and panel 13 permit observers to see a person sitting on the seat 8 , and falling into a tank of water subsequent to a missile striking target 43 , as will be described . the sides 2 &# 39 ; and back 2 , and the bottom 1 , of the water tank are fabricated from aluminum sheets , and assembled together , as shown in fig9 using aluminum tubing 3 , angle 4 , struts 39 , 39 &# 39 ;, and angles 40 . appropriate sealing material is used around the seams of the water tank to make it leak proof . a tank adapter 44 is mounted through the back panel of the tank near the bottom panel 1 , as shown . fig1 shows a pictorial of the drainage system 44 , 101 , 103 , that protrudes from the outside surface of the back panel 2 . rubber stops 50 are included on the upper inside surface of the back panel 2 for dampening the fall of the seat 8 . in fig1 , the seat assembly includes a seat 8 welded to a bar 10 ( also see fig2 and 3 ). the latch spindles 11 are welded to the spindle bar 10 proximate its ends , respectively , as shown . ballbearing pillow blocks 9 are used to rotationally secure the ends of the spindle bar 10 to the inside surface of the frame 24 . with reference to fig3 and 11 , latch teeth 30 are fabricated from steel members 30 &# 39 ;, 30 &# 34 ;, 30 &# 34 ;&# 39 ; via welds w as shown . an eyebolt 5 is welded to one of members 30 &# 34 ;&# 39 ; as shown , with the ends of members 30 &# 34 ;&# 39 ; being welded to latch bar 28 , and positioned as shown . with reference to fig1 , and 3 , a target 43 is rigidly mounted upon an extreme end of a target arm 42 . a vertical shaft 48 is rigidly attached to the underside of target arm 42 near the latter &# 39 ; s other end , with the end of the shaft 48 being rotationally mounted via a bushing 9 to a protruding end of a cross member 27 , as shown . the horizontally aligned portion of latch bar 28 is mounted via bushings or ballbearing pillow blocks 9 , and channels 16 to vertical members 24 . one end of latch bar 28 is bent at about ninety degrees and oriented as shown for engaging an end portion of target arm 42 . a u - shaped bracket 41 is mounted to cross member 27 as shown , for providing a stop means for limiting the movement of target arm 42 and latch arm 28 which are moveable between the upright arms of bracket 41 . springs 6 are mounted between one arm of bracket 41 and eyelets 5 on either side of vertical shaft or pivot arm 48 , as shown , for urging target arm 42 against the end of the bent portion or vertically oriented portion of latch arm 28 . other springs 6 are mounted between eyelets 5 attached to latch spindles 11 and their associated latching teeth 30 , respectively , for urging the latching teeth 30 against their associated latch spindles 11 . such spring biasing ensures that the latching teeth 30 firmly engage the notch stops 7 ( see fig1 ) of latch spindles 11 , respectively , for ensuring that the seat 8 is firmly latched into its upright position in the ready or cocked state of the present target apparatus invention . also , the combination of the spring biasing of the target arm 42 , and latch spindles 11 with associated latch teeth 30 , provides for automatic resetting of the apparatus by merely raising the seat 8 to its latched position , as will be described below . in operation , water is placed in the water tank , and the seat 8 is latched into its upright position as shown in fig1 through 3 . a person climbs a ladder 49 ( partially shown in fig1 ) and sits on seat 8 above the water tank . when a ball or like missile strikes target 43 , the associated end of target arm 42 moves back , causing its other end to move foward and rotate latch arm 28 in a direction for lifting the latching teeth 30 away from the notch stops or surfaces 7 of the spindle latches 11 , respectively , permitting the seat 8 to swivel downward , dropping the person seated thereupon into the water . the spindle latches 11 will also rotate in the same direction as the seat . when seat 8 so swivels downward or drops it will strike the rubber stops or bumpers 50 mounted on the back of the tank , as previously mentioned . the present target apparatus is thereafter reset by raising up the seat 8 until the latching spindles 11 rotate back to a position permitting the latching teeth 30 to drop down against the notch stops 7 , respectively , thereby completing the latching or cocking operation . as the latching teeth 30 so drop into their respective latching positions with their associated latch spindles 11 , latch arm 28 is automatically rotated and moves the target arm 42 back into its cocked position . although particular embodiments of the present invention have been shown and described , other embodiments may occur to those of ordinary skill in the art which fall within the true spirit and scope of the appended claims .

a missile responsive amusement apparatus comprising a target mounted upon one end of an elongated target arm , the latter being pivotally mounted to a box - like frame , whereupon when a missile strikes the target , the target arm pivots in a direction causing its other end to engage and rotate a latch bar for lifting latching teeth out of notches located in a pair of spindle cams , thereby releasing a spindle bar to which a seat is attached for rotation in a direction causing the seat to swivel downward for dropping a person sitting thereupon into a tank of water below the seat . thereafter , via spring biasing of the spindle cams and target arm , the apparatus can be reset by rotating the seat upward until it latches in its upright position via the latching teeth engaging the notches of the spindle cams attached to the spindle bar , while concurrently causing the latching bar to rotate for pivoting the target arm back to its &# 34 ; cocked &# 34 ; or &# 34 ; ready &# 34 ; position .