Datasets:
Synthyra
/
PubmedProteinScience

Dataset card Viewer Files Community
2
text
stringlengths
35
50.6k
A method for measurement of the dynamic unfolding procedure of bovine insulin by reversed-phase HPLC has been established. Insulin contains 51 amino acids and two intrachain disulfide bridges. The denaturation of bovine insulin was carried in dithiothreitol solution at 100 degrees C, and the equilibrium products were examined by HPLC at different reaction time. The results show that the conformation of insulin has changed before cleavage of the disulfide bonds to A and B chains. Bovine insulin, two intermediates and the reduction products A and B chains were well separated on a C18 column (4.6 mm x 150 mm) with a linear gradient elution of acetonitrile containing 0.1% trifluoroacetic acid. The conformation of the unfolding intermediates of insulin was indicated by chromatographic method, and the results were verified by matrix-assisted laser desorption ionization time of flight mass spectrometry. The method is helpful to reveal the conformation changes in the procedures of protein unfolding.
This paper describes the analysis of anticancer drug hexamethylene bisacetamide (HMBA) in biological fluids and tissues by RP-HPLC. The samples of plasmas, urine and tissues from cancer mice and rabbits were first used with methanol for pretreatment to remove protein impurity, then analyzed by RP-HPLC on an ODS column. The mobile phase was methanol/water (70/30, V/V), UV detection is employed at 210 nm. 153 samples were analyzed and good results were obtained. The recoveries of 93.3%-104% with a relative standard deviation of 0.04%. The regression equation is: Y = 0.32X - 1.07, with a linear correlation coefficient of 0.998 and the linear range of HMBA is 0 to 1000 mg/L. A sample analysis can be completed within 13 minutes. This method could be satisfactorily applied not only for the analysis of HMBA but probably also for the analysis of other drugs in biological fluids and tissues.
To study the relationship between the expression of extracellular signal-regulated protein kinase (ERK) and the differentiation degree and lymphnode metastasis in oral squamous cell carcinoma.
To study the distribution of dentin matrix protein 1, osteopontin and bone sialoprotein during cementum formation and cementoblasts differentiation in mouse.
To investigate the roles of hTERT and p53 protein in malignant changes of oral mucosal precancerous lesions and the relations between hTERT and p53.
To investigate the anti-proliferation effect of tyrosine protein kinase inhibitor, genistein (4'-5,7-trihydroxyisoflavone), on human salivary adenoid cystic carcinoma cell line SACC-83 in vitro, and its effect on cell cycle.
To explore relationship between rat brain tissues hurts of gas explosion and the expression of Protein Kinase C alpha mRNA.
To study expression of mutant p53 protein in workers occupationally exposed to benzidine and bladder cancer patients.
Acridine orange can be oxidized with discoloring and fluorescence quenching by potassium bromate in phosphoric acid medium, but the reaction rate is very low. The presence of trace nitrite can catalyze this reaction to improve the sensitivity of it apparently and to make the net fluorescence value of the system decrease greatly. Based on the above investigation, a new catalysis-fluorescence determination method of trace nitrite has been proposed. The method described is very sensitive and selective. The catalysis reaction is under the conditions of lambdaex/lambdaem = 446/505 nm, 55 degrees C and 10 min for the reaction time. The method permits the existence of more than 20 common foreign ions. There isn't interference by the same quantity of Fe3+, Br- and I-. The detection limit is 0.012 ng x mL(-1). The linear range of determination is 0.05-5 ng x mL(-1). The method has been used for the determination of trace nitrite in water and soil samples with satisfactory results.
The nature of palladium (I) and copper (II) is very similar, so it is very difficult to determine trace palladium (II) in the coexistence of a great quantity of copper (II). This paper applied ion floatation-spectrophotometric principle, using 1-(2-pyridylazo)-2-naphthol (PAN) as collector, and through controlling pH of the solution and determination wavelength, without separation to determine palladium (II) content in acetaldehyde catalyst with a great quantity of copper (II). The relative error was 0.61%, and RSD was 2.33%. The results were satisfactory.
A review on recent applications of molecular absorption spectrophotometric method to the identification of the structures of biologic macromolecules, such as protein and nucleic acid, is presented. Molecular absorption spectrophotometric method is widely used in the structure determination of biologic macromolecules for its convenience and speed. Ultraviolet absorption spectrum (UV) can be used in the research on the mechanism of the interaction of anticancer drugs and DNA. UV can also be used to study the interaction of spectroscopic probe with biologic molecule and their binding mechanism. Protein secondary structure and conformation can be investigated by Fourier infrared spectroscopy (FTIR) deconvolution analysis. Molecular absorption spectrophotometric method is an important tool for structure study of biologic macromolecules.
Outlier diagnosis is a very important step in building near infrared calibration model. Data outlier includes spectral outlier and chemical value outlier. Mahalanobis' distance, ratio of spectral residual and spectral variable leverage test were used to evaluate sample spectral outlier. Cook's distance and the ratio of sample square error of chemical value and predict value to the mean square error of calibration set were used to test chemical value outlier. Three calibration models of protein content of 50 wheat samples, protein content of 90 corn samples and cyclohexane content of four compounds mixture were investigated. It is demonstrated that outlier test is very helpful for optimizing near infrared calibration model.
A new nanometer complex heteropoly acid with Keggin structure, H3PW12O40/SiO2, were prepared by sol-gel method, and were characterized with IR, UV, XRD and TEM techniques. By means of this nanometer catalytic materials, the optimum conditions of the n-butyl acrylate synthesis have been studied. The results show that the complex heteropoly acid H3PW12O40/SiO2 nanoparticles have the mean grain size of 40 nm and they are typical amorphous. A strong chemical interaction exists between H3PW12O40 and silica surface. The nanoparticles have high catalytic activity for synthesizing n-butyl acrylate. The optimum catalytic conditions are as follows: the mole ratio of acrylic acid and n-butyl alcohol is 1:1.2, the reaction temperature is approximately 90-96 degrees C, and the catalyst quantity in the reaction is 10% of the acid mass. The conversion proportion is 94.37% and product yield 91.2% in 5 h. Apparently, the unique structure of the Keggin anions and surface acid center and the high specific surface area and the pseudoliquid phase of H3PW12O40/SiO2 play an important role in the esterification reactions with the acid catalyst.
Conformational and activity changes of acid phosphatase from wheat germ in ethanol solutions of different concentrations were measured by fluorescence spectra and differential UV-absorption spectra. The effect of ethanol on kinetics of acid phosphatase was determined by using the double reciprocal plot. The results indicate the ethanol has a significant effect on the activity and conformation of acid phosphatase. The activity of acid phosphatase decreased linearly with increasing the concentration of ethanol. Differential UV-absorption spectra of the enzyme denatured in ethanol solutions showed two positive peaks at 213 and 234 nm, respectively. The peaks on the differential UV-absorption spectra suggested that the conformation of enzyme molecule changed from orderly structure to out-of-order crispation. The fluorescence emission peak intensity of the enzyme gradually strengthened with increasing ethanol concentration, which is in concordance with the conformational change of the microenvironments of tyrosine and tryptophan residues. The results indicate that the expression of the enzyme activity correlates with the stability and integrity of the enzyme conformation to a great degree. Ethanol is uncompetitive inhibitor of acid phosphatase.
Benzoic acid with weak fluorescence may react on *OH, and then products with intense fluorescence are made. Extractives of Chinese traditional medicine may eliminate *OH in solution, and reduce the amounts of the products. Then, the increased level of fluorescence of the products in solution will be lowered. Based on this principle, a novel catalysis kinetics fluorimetry system for the determination of eliminating ratio of Chinese traditional medicine for *OH was developed. When the concentration of traditional Chinese herbal drugs was 4.0 mg (dry weight) x mL(-1), the eliminating ratios of Viola yedoensis, Atrctylodes chinensis and Paeonia veitchii were 60.8%, 40.1% and 94.3%, respectively. The results obtained by this method are in good agreement with those obtained by spectrophotometry.
Short wave near-infrared spectrum of whole wheat was obtained by diffusion reflection. PLS method was used to analyze protein content of whole wheat. Different wavelength ranges were chosen for regression and information abstraction. The 3D curves were shown for different factors, prediction residual sum of squares (PRESS), and RMSECV. The best wavelength ranges and factors were determined. Analysis results for protein content of whole wheat were shown in three wavelength regions, and the predicted results were compared and discussed. The method of selecting advantageous wavelength ranges is feasible to obtain high prediction precision.
The localization of activity of immobilzed L-asparaginase by covalent binding was studied by X-ray microanalysis. Asparagine and MgCl2 served as substrate and capture agent respectively. Substrate was catalysed by immobilized L-asparaginase to produce NH3, and NH3 was captured by MgCl2 to form precipitate MgNH4PO4. Precipitae was deposited on active site of immobilized L-asparaginase. The results show that the macroporous resins of immobilized L-asparaginase has greater enzyme activity, while distribution of activated enzyme was uniform. Most of activated enzyme was immobilized on the macroporous resins. The optimum condition of localization of activity of immobilized L-asparaginase was studied.
The authors labeled bovine serum albumin (BSA) with a new europium chelator 4,7-bis(chlorosulfophenyl)-1,10-phenanthroline-2,9-dicarboxylic acid (BCPDA) which was synthesized by solid phase time-resolved fluorescence immunoassay (TRFIA) technology. The process of BCPDA-labeling-BSA reaction was studied. Using Coomassie brilliant blue method, concentrations of BSA and BCPDA were determined in BCPDA-BSA labeled sample. The labeling reaction condition was studied. Labeling ratio and protein labeling recovery were calculated. BCPDA-BSA-Eu3+ complex has a very large Stokes shift (270 nm) and can emit very strong fluorescence band at 611.2 nm which is very narrow (10 nm). BCPDA-BSA-Eu3+ complex exhibits very long fluorescence lifetimes by the experiment demonstration. Also, BCPDA and protein-BCPDA-Eu3+ complex is relatively stable.
The crystalline behaviors of PCL(poly(epsilon-caprolactone) )thin film on Si and KBr substrates have been studied in-situ using FTIR with a heat stage. In the crystalline process, due to the decrease in free volume and the increase in interaction among different molecules, the peak of C=O shifted to lower wave number and the crystalline peak of C-O-C and C-H appeared. The degree of crystallinity has been calculated through the comparison between the peaks of crystal and amorphous parts. FTIR study on the films cast from solution with different concentrations showed that the thicker the film is, the higher crystallinity it has. This may be due to the substrate effect or geometric confinement. It was also shown that under the same preparation condition, the film on KBr wafer had higher degree of crystallinity than that of film on Si wafer.
The adsorption and decomposition of methanol on gamma-Al2O3 and CeO2 supports, and Pd/Al2O3 and Pd/CeO2 catalysts were studied by in-situ FTIR technique. The possible pathway of methanol decomposition on Pd/Al2O3 and Pd/CeO2 catalysts was analyzed according to the interaction of Pd and the supports. Methanol was dehydrogenated into DME or decomposed towards CO and H2 over different active phase on Pd/Al2O2 catalyst. A synergistic effect between Pd and CeO2 on the activity of Pd/CeO2 catalyst for methanol decomposition was proved.
Pt nanoparticles (Pt(n)) were prepared by chemical reduction method. The average dimension of Pt(n) is about 2.5 nm in diameter determined from TEM studies. The Pt nanoparticles were then self-assembled on massive Au substrate. The process of self-assembly was investigated with Fe(CN)(4-/3-)(6) for redox probe reaction. The result showed that the dithiol assembled on Au surface is inactive for electron transfer. However after assembly of Pt nanoparticles on the dithiol, the Au/SS-Pt(n) electrode becomes conductive again for electron transfer. The adsorption of CO on the Pt nanoparticles self-assembled on Au substrate in 0.1 mol x L(-1) H2SO4 was studied by using in situ FTIR reflection spectroscopy. IR absorption of linear and bridge bonded CO species was observed around 2030 and 1845 cm(-1) respectively. IR absorption of twin bounded CO adsorbed on the Pt nanoparticles was also observed about 2100 cm(-1). The results illustrated that the IR absorption of CO adsorbed on the Pt nanoparticles has been significantly enhanced. The present study is devoted to revealing the intrinsic properties of self-assembly system of nanoparticles, and is of importance in applications of electrocatalysis as well.
The native beer yeast and esterified beer yeast were examined by infrared spectroscopy. The IR spectrum of beer yeast is mainly composed of the adsorption of carbohydrates, protein, etc. The dominating bands near 1652, 1532 and 1240 cm(-1) were assigned to amide I, amide II and amide III, and the characteristic IR absorption of protein could be one of the significant components of cell walls. The peak near 1 454 cm(-1) is attributable to the bending stretching of CH2- and CH3-. A substantial portion of the absorbance at 1160 cm(-1) is attributable to the stretching vibration of C-O on the structure of carbohydrates, the main components of the cell walls. The band present at 1080 cm(-1) was caused by the C-O stretching of carbohydrates and alcohols found in the RNA, the DNA and/or the cell envelop of the yeast. The peaks at 1744 cm(-1) (attributed to the carboxylate stretching) and 1454 cm(-1) confirmed the esterification process of carboxylate groups presented in the cell wall. After esterification with methanol-chloride hydride, the major components and the structures of the biomaterial remained intact.
The ultraviolet/visible spectra of TOP I were studied. It was proved that TOP I is an acid enzyme containing it hemochrome as an agon. When the pH reduced, the Soret absorption in UV-Vis region exhibited a blue shift, when pH increased exhibited a red shift. The result of the influence of carbamide, the denaturant, on the spectra showed that TOP I may have a unfolded structural change in the solution, which made the peptide chain completely extend. After adding Fe(III), Fe(II), Cu(II), Zn(II), Co(II), Ni(II) and Sn(II) to the apo-TOP I, the UV-Vis spectra changed except for Fe(III), which almost did not change at all. The strongest characteristic absorption peak of the Soret showed a blue shift to different extent and it became weak gradually. The situation of alpha-strip and beta-strip remained unchanged while the relative strength decreased.
The photochromic retinal protein bacteriorhodopsin (BR) was found in the cell membrane of the Archaean Halobacterium salinarium. The excellent photochromic and photocycle properties of the BR provide the possibility of many applications in the filed of optical information processing. In this paper, the spectrum response characteristic of the wild type bacteriorhodopsin molecule film was studied by using pump-probe method. After the samples was excited by 532 nm YAG laser beam, the absorption spectra were probed by an optical fiber spectrum analysis (OSA). The absorption peaks at the ground state (B state) of the two samples are all at 562 nm wavelength. At 562 nm wavelength, the optical densities (OD) of the samples are about OD (WT1) 562 nm = 2.04 and OD (WT2) 562 nm = 1.37 respectively. The experiment results show that BR(WT) films have absorption that appears to strengthen with the probe time increasing in wavelength 550-650 nm, and this change phenomenon is described by spectra measured at different probe time. Appling the theoretical plot-fit of two exponentials to analyze the process of the absorption change it is found that this change includes two processes-fast process and slow process. Their corresponse time constants of BR(WT1) are about 11 ms and 60 s, and those of BR(WT2) about 24 and 30 s respectively.
Diffusion Reflectance Spectroscopy (DRS) was employed to study the surface phase structure of ZrO2-based catalysts. The effect of calcining temperature, and the addition of Al2O3 and platinum on the surface and bulk phase structures of zirconia was studied by DRS combined with XRD, DTA and XPS. The same trend was observed that heating to higher temperatures results in the conversion to monoclinic zirconia in undoped samples, while incorporation of an appropriate amount of Al2O3 would stabilize the tetragonal phase zirconia. And the reduction processing of Pt/ZrO2 affects crystallization and phase transitions, resulting in certain fraction of tetragonal ZrO2 transferred to monoclinic ZrO2. The DRS shows an appreciable difference in the corresponding XRD spectra that more monoclinic zirconia formed on the surface of catalyst during the reduction processing of Pt/ZrO2, compared to the bulk of catalyst.
A method to share the information resource in the database of Fourier transform near-infrared(FTNIR) spectrum information of agricultural products and utilize the spectrum information sufficiently is explored in this paper. Mapping spectrum information from one instrument to another is studied to express the spectrum information accurately between the instruments. Then mapping spectrum information is used to establish a mathematical model of quantitative analysis without including standard samples. The analysis result is that the relative coefficient r is 0.941 and the relative error is 3.28% between the model estimate values and the Kjeldahl's value for the protein content of twenty-two wheat samples, while the relative coefficient r is 0.963 and the relative error is 2.4% for the other model, which is established by using standard samples. It is shown that the spectrum information can be shared by using the mapping spectrum information. So it can be concluded that the spectrum information in one FTNIR spectrum information database can be transformed to another instrument's mapping spectrum information, which makes full use of the information resource in the database of FTNIR spectrum information to realize the resource sharing between different instruments.
Calmodulin (CaM) is a ubiquitous Ca(2+) -binding protein of eukaryotes, and regulates a broad spectrum of fundamental cellular processes. CaM harbors four binding domains, among which domains I, II and III contain no tyrosine, only domain IV has one tyrosine for plant species. In contrast to mammals, plants express numerous CaM isoforms that exhibit differential activation or inhibition of CaM dependent enzymes in vitro. In the present study, the isoform II of Arabidopsis thaliana CaM was used to test the binding properties of metal ion to CaM by Tb3+ fluorescence. The increase in fluorescence was monitored at 545 nm as a function of the number of Tb3+ bound to CaM using direct (221 nm) and indirect (280 nm ) excitation. Upon direct excitation of Tb(3+) -CaM, the fluorescence of Tb3+ increased markedly, and one of the pathways of energy dissipation of the excited state of Tb3+ was energy transfer to the vibrational levels of water molecules in the hydration sphere around the Tb3+ ion. When waters of hydration were removed as a result of Tb3+ binding to CaM, an increase in rate constants of luminescence was observed. The titration curve with direct excitation increased up to 4 mol of Tb3+/mol of CaM before the onset of a plateau, in agreement with the expected maximum of four binding sites. Using indirect excitation at 280 nm, the resultant titration curve was sigmoid, albeit with less fluorescence intensity, also reached a maximum at a ratio of 4 mol of Tb3+/mol of CaM, in which the first phase exhibits an end at 2 : 1, and in this phase there was only a small increase in Tb3+ fluorescence. The fact that only the second pair of added Tb3+ shows a large enhancement in Tb3+ fluorescence suggests that it is Tb3+ bound to the low affinity sites that can accept energy from tyrosine group. The turning points of fluorescence titration curves were used to estimate the concentrations of CaM on the base of CTb3+ = 4c(CaM).
The contents of calcium and magnesium in urines were simultaneously determined by flame atomic absorption spectrometry. The optimized working conditions were ascertained. For the determination of calcium, the used wavelength was 422.8 nm, and the current of HCL(Hollow Cathode Lamp) was 3 mA; for the determination of magnesium, the used wavelength was 285.2 nm, and the current of HCL (Hollow Cathode Lamp) was 4 mA. The height of burner and the air-acetylene ratio were 8 mm and 6:1, respectively, for the determination of both calcium and magnesium. In order to remove the disturbance of phosphate, sulphate and silicate on the determination of calcium, a releasing reagent can be used. Lanthanum chloride (LaCl3) was tested as a better releasing reagent than strontium chloride (SrCl2). The disturbance of urinary substrate could be avoided after the urines were diluted to 1:100 with distilled water. The concentrations of Ca and Mg in 15 urines were determined under the optimized conditions. The obtained results were consistent with the archived data. The recovery was 96%-104%, the relative standard deviation for a sample was 1.8% with P < 0.05.
The existing of intermediate in the process of protein unfolding is necessary for studying the kinetic folding and unfolding pathway of protein. With trypsin as a model protein, the conformational changes of trypsin in the presence of different GuHCl concentrations were investigated by using fluorescence spectra (FR), and compared with the activity recovery of denatured trypsin. It was found that the maximum wavelength of FR of trypsin increases with the concentration of GuHCl increasing, and the maximum wavelength of FR of trypsin reaches the maximum when the concentration of GuHCl is 2 mol x L(-1), and then, the maximum wavelength of FR of trypsin decreases with the concentration of GuHCl increasing. There exists a intermediate state in the presence of low concentration of GuHCl. The conformation of the intermediate is different from the native and unfolding states. The maximum wavelength of FR of the intermediate is the maximum, and fluorescence intensity is the highest, while the bioactivity recovery is the lowest. The reasons for these were studied with the knowledge of the molecular structure.
Based on stepwise linear regression, and according to the theory of near infrared absorbption, spectrum (1000-2500 nm) obtained by detector was divided into three ranges, which were I (1000-1400 nm) and II (1400-1860 nm) and III (1860-2500 nm). In each range the regression wavelengths of different wavelength gaps were picked up stepwise. Regression coefficients and parameters were calculated by Matlab5.3 Program. Regression models were built up in different ranges with different wavelength gaps. Best models could be determined. Prediction results of protein content of ground wheat were displayed in scatter plots. Different results were discussed and compared, which has referencemeaning for application.
Stable and good quality of Surface-Enhanced Raman Scattering (SERS) signal from net rhodium electrode in the ultraviolet region was observed for the first time by our group recently. In this paper, both qualitative and quantitative analyses are given to interpret the new experimental results mainly based on the electromagnetic field theory. The mechanisms of SERS for rhodium electrode in the ultraviolet region are mainly attributed to the lightning rod effect together with the weak surface plasmon resonance. According to the calculation, the surface-averaged enhancement factor (SEF) for rhodium electrode in the ultraviolet region is about two orders of magnitude when the surface of the substrate is roughened properly, which is in good agreement with the experimental results. The authors also give a comparative study to show why silver, which is the best SERS active substrate in the visible and near infrared region, can't give any SERS signal when the 325 nm excitation line is used.
The composite nanoparticles of Ni-ferrite with coated gelatin were prepared with the gel-microemulsion chemical tailoring method. The gelatin FeCl2 and NiCl2 were used to prepare gel, which was tailored to be particles in micellar of microemulsion, and the particles were reduced, compounded and nucleated. Surveying by XRD, TEM, IR and EDS showed that the particles formed were coated by gelatin protein and their mean sizes are in the range of 10-100 nm, and particle sizes are 3.3-4.6 nm. There are about 3-22 NiFe2O4 particles on each spheroid. The measurement of magnetic parameters indicated that the specific saturation magnetization was sigma(s) = 36.31 x 10(3)/4pi(A x m(-1) x g(-1)), coercivity was H(c) = 6750 A x m(-1), and residual magnetism B(r) = 4.39 x 10(3)/4pi(A x m(-1) x g(-1)).
Near-infrared diffusion reflectance spectroscopy is a fast technique that can provide component information about intact soybean samples. We have combined this technique with partial least-squares (PLS) regression to perform a quantitative determination of protein and fat contents in soybean samples. In calibration set, the NIR model determination coefficient R2 of protein and fat is 0.9930 and 0.9752 respectively, and the relative standard deviation (RSD) is 0.76% and 1.3% respectively. The correlation coefficient r of validation set is 0.9473 and 0.8695 respectively. This NIR model is used to predict the contents of protein and fat in 264 soybean samples, using R-error to assess the deviation of analysis results. The minimum RSD of prediction of protein and fat is 0.04% and 2.46% respectively, and the maximum RSD of prediction of protein and fat is 2.45% and 4.25% respectively. These results are of great importance in early screening of crop breeding.
This study is based on the agriculture product near infrared spectra database, which is a foundation database. The database has very important effects on agriculture products quality analysis and agriculture breeding. What the NIR researchers and NIR users care about is how to utilize information of the foundation database fully. To share the NIR resource, unifying the scanning term to get high quality spectra is the first step. This article uses wheat powder as sample to study the influence of different resolution, different He-Ne frequency and sample granularity on the wheat powder protein model. The results show that scanning sample by 4, 8 or 16 cm(-1) resolution has little influence on the wheat powder protein math model. The change in He-Ne frequency has influence to wavenumber accuracy, but when the change is within 1 cm(-1), the influence is indistinctive. For FT-NIR instruments with He-Ne to have better stability, we needn't often adjust the He-Ne wavenumber. Sample granularity has more distinctive influence on the NIR math models.
DNA molecular constitution is damaged to result in the inductive variation of base structure in female breast tissue under the influence of physical factors and chemical factors. The present research indicated that the FTIR spectra can reflect sensitively the change in the constitution. Our findings indicated that normal, benign and cancerous breast tissues are different in constitution and content of protein, nucleic acid and sugar, comparing the FTIR spectra, deconvolution spectra and date analysis. The result indicated that the content of collagen protein and nucleic acid increased obviously in cancerous tissue, while the content of glycoprotein increased gradually except mucinous carcinoma. After extracting nucleic acid of breast tissue, we further investigated the difference of constitution and content of base and phosphate by comparing normal, benign and cancerous breast tissues. The spectra and spectral data showed that the degree of hydrogen-bonding of base ring guanine (Gue) increased in cancerous tissue, base ring adenine (Ade) presented mostly in oxydic 8-OH-Ade via the attack of the *OH in cancerous breast, the peak position shifted to higher wave number with enhancing of C=N vibration, and the content of phosphate increased. After deconvolution, the ratio A1080/A1050 showed that the amount of PO2- relative to C-O increased from normal to cancerous breast tissues. It provided a important basis to study the mechanism of cancerization from molecular biology and molecular medicine.
The resonance light scattering (RLS) of Solochrome Cyanine R(SCR) is greatly enhanced by proteins. Based on this phenomenon, a novel method for the determination of protein by using SCR as a labeling agent was developed. In the pH 4.0 solution the enhanced intensity of RLS at 400 nm is proportional to the concentration of protein. The linear range for bovine serum albumin (BSA) is 0-5.0 mg x L(-1) and the limit of detection is 44.4 microg x L(-1). The method is simple, rapid, sensitive, stable, and tolerant of many foreign substances. It has been used to determine proteins in human urine samples with satisfactory results.
An ICP-AES method for the determination of active components Mo and Bi in catalyst for acrylonitrile production was established and reported in this paper. 0.2 g of the sample was dissolved with 5 mL of aqua regia and 8 mL of HF at 75 degrees C on a water bath and evaporated till dry to expel SiF4. The residue was dissolved and made volume with 3% HCL up to 100 mL. The solution was prepared for Bi determnination. Successively diluted with 3% HCL for 10 times the solution was used for Mo determination. Spectral interferences were investigated in detail by means of profiling the analytical lines with wavelength scanning of the blank and coexisting elements in the vicinity of the lines. Three Mo lines, MoII 202.030, MoII 203.844 and MoII 204.598, and two Bi lines, BiII 190.241 and BiI 223.061 were selected as the analytical lines considered free of spectral interferences. Utilizing multiple lines in a full spectrum for simultaneous determination of one element is of benefit to the improvement of accuracy and precision of the analysis. The method has been successfully used for monitoring the activity of the catalyst in acrylonitrile production.
4-nitro-4'-chlorobenzophenone has been synthesized from p-nitrobenzol chloride and chlorobenzene in the presence of catalyst anhydrous AlCl3 and 4-amino-4'-chlorobenzophenone as an important organic intermediate was prepared by reduction of 4-nitro-4'-chlorobenzophenone with Na2S2. With the aid of orthogonal experiments the optimum reaction conditions were determined: reaction temperature 92 degrees C, time 2.5 h, 4-nitro-4'-chlorobenzophenone:Na2S2 = 1:1.7 (mol), yield 85.80%, purity 98.08%, m.p. 177-179 degrees C. The molecular structure of the title compound has been characterized by Elemental Analysis (EA), 1H and 13C Nuclear Magnetic Resonance Spectrometry (NMR), Infrared Spectroscopy (IR), and Mass Spectroscopy (MS), and the main infrared absorption peaks and nuclear magnetic spectral bands of this compound were assigned. The mass spectral fragmentations of the product's important fragment ions were elucidated. The result provides useful information for developing substitutes of non-cancer-causing forbidden dye intermediate.
Dubin-Johnson syndrome (DJS) is an inherited disorder characterized by chronic conjugated hyperbilirubinemia due to the absence or dysfunction of the multidrug resistance protein 2 (MRP2). We previously identified two distinct ancestral mutations causing DJS in 22 unrelated Iranian and five unrelated Moroccan Jewish patients, respectively. In this study we identified and characterized the mutation causing DJS in Ashkenazi Jewish patients and assessed a possible founder effect. Sequencing of all 32 exons of the MRP2 gene identified a novel IVS8+4A-->G mutation in three unrelated homozygotes. Haplotype analysis using four intragenic dimorphisms disclosed a founder effect for the mutation. RT-PCR and real time PCR analysis of mRNA from one patient revealed three splice variants all leading to frameshifts and predicting premature termination codons. The main splice variant was a consequence of the use of a cryptic donor splice site inside exon 8. Liver biopsy in one patient revealed complete absence of MRP2 from the canalicular membrane of hepatocytes. In conclusion, our results provide strong evidence that an ancestral IVS8+4A-->G mutation causes DJS in Ashkenazi Jewish patients by abolishing normal splicing of intron 8 leading to aberrantly spliced products that predict truncation of MRP2.
Through genetic transformation mediated by Agrobacterium tumefaciens, an antisense waxy gene was introduced into Longtefu B line, a male sterile maintainer line in indica (Oryza sativa L.). Thirty transgenic plants showed integration of antisense waxy gene into the genome as determined by PCR assay, and twenty eight were confirmed by Southern blotting. T1 seeds from twenty one transgenic plants showed a marked decrease of amylose content, ranging from 3%-13% less than control, and seeds from some transgenic lines exhibited typical waxy phenotype. Six transgenic lines were selected to examine the amylose content in different generations. In the T4 generation, two homozygous lines, Long 3-1-1-1 and Long 5-8-2-1, were selected, with amylose content of 15.9% and 8.4% respectively. The amylose content in these lines is in consistent with the decrease of the accumulation of Wx protein as determined by SDS-PAGE electrophoresis. Cross and subsequent backcross of Long 3-1-1-1 and Long 5-8-2-1 with the Longtefu mare sterile line were performed to determine the changes of amylose content in F1 and B1F1 seeds. The results showed an average amlyose content of 21.4% in F1 seeds with Long 3-1-1-1 as a parent, while only 13.6% with Long 5-8-2-1 as a parent. In addition, the average amylose contents in B1F1 seeds were 17.1% and 9.3% respectively. Our results indicated that during the fertility transfer in the male sterile line, stable transgenic lines with medium or low contents of amylose had direct effects on amylose content in F1 seeds.
A cDNA fragment that encodes auxin-binding protein 1 was amplified by, reverse polymerase chain reaction from ovary of cucumber. Its expression signals were weak in the ovary of 1 d before anthesis, while got strong in 2, 4 and 6 d after pollination. Among the unpollinated ovary of 2 d after anthesis, those that got enlarged had strong expression signals; the others that were wilting had weak signals. This indicated that auxin-binding protein 1 gene possibly play a role in cucumber fruit development. When auxin-binding protein 1 gene of Arabidopsis was transformed into cucumber, the parthenocarpic rate of transgenic plants was 31.7%, higher than the control. This result showed that the sensibility to auxin was increased in transgenic plants.
This multicenter study compared the effects of branched-chain amino acid granules (Livact((R)) Granules, LIV) and an enteral nutrient for chronic hepatic failure (Aminoleban((R)) EN, EN) on serum albumin in patients with decompensated liver cirrhosis. This study enrolled "patients with decompensated liver cirrhosis associated with hepatic encephalopathy who were suffering from hypoalbuminemia in spite of adequate food intake," a condition for which both drugs are indicated. Enrolled patients were randomized to the two groups according to the central registration method. This study continued for 24 weeks. Selected foods were supplied to each patient in principle so that caloric and protein intakes were standardized between the two groups. A total of 281 patients were enrolled. LIV was not inferior to EN concerning the primary efficacy endpoint changes in serum albumin.
To establish a methed of cleavage fragment length polymorphism (CFLP) analysis with a primer labeled at the 5'-end with digoxigenin for genotyping of Chlamydia trachomatis (Ct). The methods for detection of Ct by major outer membrane protein (MOMP) gene (ompl) with nested polymerase chain reaction (ompl-nPCR) were studied. The incidence of Ct infection in pregnant women, the common genotypes and vertical transmission rate of Ct in Chongqing area during the past one year was also investigated.
Attention deficit hyperactivity disorder (ADHD), a common behavior disorder of childhood, is a highly heterogeneous disease frequently accompanied by various mental disorders, including disruptive behavior disorder (DBD). Studies show that children suffering from ADHD with DBD are at higher risk of antisocial personality, substance abuse, and social adaptations disorder at their adulthood. The dopamine beta hydroxylase (DbetaH) is the key enzyme to ADHD since it catalyzes the conversion of dopamine to norepinephrine, and dysfunction there of is believed to be one of the causes of the disorder. To explore the association between DBH gene and ADHD complicated with or without DBD, the authors analyzed the transmission of a novel polymorphism DBH -1021C-->T, which is found associated with plasma DbetaH activity, in ADHD nuclear families using transmission disequilibrium test (TDT).
To clone the recombinant fusion gene of Escherichia coli heat-liable enterotoxin B subunit (Ltb) and Actinobacillus actinomycetemcomitans fimbria associative protein (Fap).
The sample is digested with 6% NaOH solution and an amount of 50 microl is used for protein content analysis by the method of Comassie Brilliant Blue G250, the residual is diluted with equal 0.4% Lathanurm-EDTA solution. Its Calcium magensium and potassium content are determined by AAS. With quick-pulsed nebulization technique. When a self-made micro-sampling device is used, 20microl of sample volume is needed and it is only the 1/10 approximately 1/20 of the sample volume required for conventional determination. Sensitivity, precision and rate of recovery agree well with those using regular wet ashing method.
In this article, method of determination of micro quantity of Mn with GFAAS and Pd have been researched, results of different additional methods of Pd were compared the combining energy of Pd in three heating steps were determined by X-ray Photoelectron Spectroscopy. The point was given that as a catalyst reduced Pd changed courses of Mn atomization, and when pre-reduced Pd was used because of its much larger surface area, method had much better RSD and had much stronger signal than other methods in those cases Pd was used too.
The untransparent substrates on the epitaxial layer need not be etched out from chemistry etching to prepare the "window" through light. The optical absorption, optical nonlinearities and optical bistabilities of the semiconductor thin films with the nanostructure grown on the untransparent substrates can be directly measured by the end face coupling method of optical waveguide. Meanwhile, the several experiment examples of II - VI single crystal thin films and superlattices grown on GaAs substrate are demonstrated in this paper.
The FTIR Microscope and Computer Aided Analysis were used to study not only the change of secondary structure of erythrocyte membrane protein attacked by the free radicals, but also the effect of oxygen centered free radicals on the membrane lipids in this paper. The results indicate that the content of alpha-helix in the secondary structure of protein clearly changed because of the attack of the free radicals. Damaged by free radicals in 30 minutes, the protein structure could not be restored after 3 hours. The number of the P=O (vp=0), C=O and C=C in the lipids of the membrane was changed. These changes were caused by the peroxidation of the oxygen centered free radicals.
The structure of tris- (2, 4-di-t-amylpheoxy) - (8-quinolinoxy) copper phthalocyanine (CuPc) thin solid films has been characterized by Fourier transform infrared (FTIR) transmission, polarized transmission and reflection absorption (RA) spectroscopy. The following conclusions can be obtained from the above measurements: (1)in LB films, the hydrocarbon chains of CuPc are in hexagonal or pseudohexagonal subcell packing, the CH2 asymmetric vibrational vector is oriented with respect to the substrate surface and the RA spectroscopy can distinguish the two CH2 streching modes of benzene cycle; (2)in sublimed films, the molecules of CuPc are out of order.
The film-forming properties of 5,10,15,20-tetra-(4-hexadecylpyridiniumyl)porphyrin bromide (TC16PyP) on the air/water interface were studied. LB films of the amphiphilic porphyrin were prepared on the glass, quartz and SnO2 OTE substrates. The morphology and structure of TC16PyP LB films were characterized by scanning tunnelling microscope, UV-Vis absorption spectra, fluorescence spectra and low-angle X-ray diffraction. The experimental results indicated that the amphiphilic porphyrin TC16PyP has good film-forming properties on the air/water interface, its LB films are stable, in TC16PyP monolayer or LB films the long alkyl chains are not straight and the porphyrin macroring is lying nearly parallel to the substrate surface.
Omega-mercaptohexanoic acid (6-MHA) self-assemble-modified gold electrode has been made by the authors. The SERS spectrum and the variations of double-layer capacitance (Cd) which occurred in the formation of 6-MHA self-assembled monolayers (SAM) on gold electrode surface were studied. The structure model of this SAM was deduced. The results show that 6-MHA can form stable SAM on gold electrode, and this 6-MHA SAM electrode has obvious catalysis for the redox reaction of chlorophylls.
Direct interaction of Cu2Zn2SOD with inorganic metal compound (CoCl2) and organic metal compound [Co(II)(His)n] was studied by ICP, VIS, NMR and measurement of enzyme activity. It has been found that in aqueous solution, there exists a direct interaction of the metal ions of the active center in the metalloenzyme (Cu2Zn2SOD) with external added CoCl2, Co(His)n. As a result, part of the metal ions in metalloenzyme were replaced and the corresponding metalloenzyme derivatives were produced and the catalytic activity of enzyme were affected. Moreover, the interaction of Co(II)(His)n with Cu2Zn2SOD is stronger and quicker, than that of CoCl2 with this enzyme, as well as the Co(II) from Co(II)(His)n is easier to enter the active center of enzyme.
The absorption spectral behavior of binding reaction of molybdenum(VI)-salicylfluoronate on bovine serum albumin was investigated. A novel method for the determination of protein in urine using Mo(VI)-salicylfluoronate complex as a spectroprobe was developed. The maximum binding number (n) of molybdenum complex to BSA was found to be 100. The molar absorptivity of binding product at 575 nm was 2.86 x 10(6) L x mol(-1) x cm(-1). The method possesses high sensitivity as well as high selectivity. It could be used to determine protein in human urine directly. The relative standard deviation for the determination is 1.5%.
In this work, proteins have been scanned by FT-Raman spectrometer. Deconvolved spectra, second derivative or fourth derivative spectra were employed to determine positions of individual components. Curve-fitting procedures were carried out to amide I band of original spectra. The broad band was resolved into several components. The resolved band components were assigned to specific protein conformations. The areas of individual components are used to estimate the percentage of the relative secondary structure. Results are in reasonable agreement with data obtained by other methods.
A new reagent N-Hexyl-N'-(sodium aminobenzenesulfonate) thiourea (HXPT) was synthesized. Its structure was also characterized. A new spectrophotometric method of determining Pd2+ was developed based on the new reagent. In the range of pH 5.4-5.8 Pd2+ forms a stable yellow complex with HXPT in the presence of CTMAB,and its apparent molar absorptivity is 2. 21 x 10(5) L x mol(-1) x cm(-1) at the maximum absorption wavelength 296.8 nm. Beer's law is obeyed in the range of 1-7 microg x 25 mL(-1) for Pd2+. This method has been used for the determination of trace Pd2+ in ores and catalyst with satisfactory results.
The effect of changing the amount of external added Co(His)n and phosphate on the interaction of Cu2Zn2SOD with organic metal compound (Cobalt (II)-Histidine) have been studied by means of ICP, VIS and measurement of enzyme activity. It has found that in aqueous solution, there exists a direct interaction of the metal ions of the active center in the metalloenzyme (Cu2Zn2SOD) with external added Co(His)n. As a result, part of the metal ions in metalloenzyme were replaced and the corresponding metalloenzyme derivatives (Co (II)-substituted derivatives of SOD) were produced and the catalytic activity of enzyme were affected. It has also studied the intensity of interactions in different molar ratios (Cobalt (II)-Histidine) and of the presence of phosphate and got some results under the effect of corresponding factors.
The direct interaction of Cu2Zn2SOD with organic metal compound (Cobalt (II)-Histidine) was studied by ICP, VIS and the measurement of enzyme activity, and also investigated the effect of pH values and different interaction times for this interaction. The results showed that with the increased in pH values and the more longer interaction times, the intensity of interaction were increased and the corresponding catalytic activity of enzyme were affected.
Statins reduce cholesterol levels through competitive inhibition of 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase, the key enzyme that regulates cholesterol synthesis. The cholesterol-lowering effect of statins is also due to an increase in the uptake of cholesterol by cells as a result of intracellular cholesterol depletion and enhanced expression of low-density lipoprotein (LDL) receptors. The use of statins as lipid-lowering agents has lead to remarkable changes in the treatment and prevention of ischemic heart disease. Results of large clinical trials of patients with ischemic heart disease have demonstrated that statins reduce inflammatory markers such as C-reactive protein, an independent risk factor in the disease. Statins exhibit properties that are beyond their lipid-lowering effects. These non-lipid-lowering properties involve the inhibition of the isoprenoid pathway through decreased synthesis of many nonsteroidal isoprenoid compounds. The focus on the immunomodulatory effect of statins is the result of the positive outcome of pravastatin treatment in cardiac transplantation patients, as well as angiographic regression studies showing insignificant changes in the degree of coronary stenosis despite a large reduction in cardiac events. Statin treatment reduces the risk of ischemic stroke despite the fact that LDL cholesterol is not directly associated with the risk of stroke. This observation lead to the investigation of the role of statins in inflammation and the immune system. Recent research data demonstrated that statins inhibit the induction of the major histocompatibility (MHC) class II expression by interferon-gamma (IFN-gamma), leading to repression of MHC II-mediated T-cell activation. Furthermore, statins inhibit the expression of specific cell surface receptors on monocytes, adhesion molecules and also integrin-dependent leucocyte adhesion. While statins may stimulate the secretion of caspase-1, IL-1beta and IL-18 in peripheral mononuclear cells in response to Mycobacterium tuberculosis, they exhibit additional effects on inflammation by decreasing IL-6 synthesis in human vascular smooth muscle cells (VSMC) in vitro. The focus of this monograph is to highlight the role of statins in the modulation of the immune system and inflammatory processes.
A method for the determination of micro amount of Co in serum of cancer patients by GFAAS has been established. The effect of protein in serum was eliminated by adding (1+1) HNO3. The blood serum was determined directly by adding Triton X-100 and NH4VO3 as matrix modifier. The method is handy and fast. The rate of recovery is 97.60-102.21% with RSD < 7.21.
Series of cancer tissues and corresponding normal tissues of gastrointestinal tract (stomach, colon, esophagus) were studied by FTIR technique and the results showed the analogy of the spectra for the cancer tissues, while the spectra of normal tissues can be classified into three kinds. The secondary structures of protein were obtained by using deconvolution and curve-fitting techniques with Amide I bands and the results showed that the contents of alpha -helix and beta-sheet are different between the normal and cancer tissues.
Spectroscopic data of samples recorded by spectroscopic instruments are confused by a series of noises, and interferences, therefore the proper data preprocessing is the basis of the following spectroscopic calibration, model establishment and transference, which is very important for the achievement of accurate analytical results. This paper reports our research work, combined with NIR spectroscopic analyses of the protein contents of wheat, that is the preprocessing of NIR spectral data recorded for 66 different wheat samples by a NIR grating spectrophotometer and a NIR Fourier transform spectrometer, respectively. The preprocessing algorithm is wavelet transform with the Gaussian first and second order derivatives. Compared with the result of preprocessing by normal first order difference algorithm, the wavelet transform algorithm by Gaussian derivatives was proved to be very effective and applicable, the spectra were smoothed perfectly, noises were eliminated obviously, and the spectral sections, which include all useful information for spectral analyses, were displayed clearly. So, it is very beneficial to the following spectral calibration, model establishment and transference.
This paper describes optimal conditions for HBsAbIgG labeling with a new fluorescence probe, 4,7-bis-chorosulfophenyl-1,10-phenanthroline-2,9-dicarboxylic acid (BCPDA) for the solid phase time-resolved fluorimmunoassay (TRFIA). The result of experiment under states clearly that BCPDA may react with protein under relative mild condition. The relative bioactivity of reacted protein was more than 80%. The labeling molar ratio of BCPDA for HBsAbIgG was 45-70. The recovery was higher than 80%. Protein-BCPDA-Eu3+ complex is stable. It can emit very high fluorescence intensity with very long fluorescence life times. The fluorescence of Protein-BCPDA-Eu3+ complex has a very large stokes shift (270 nm). The emission band at 611.2 nm is very narrow. The research provides the base for developing non-isotopic immunoassay technique and clinical medical diagnosis.
The characteristic properties of GFP make this protein a good candidate for use as a molecular reporter to monitor patterns of protein localization, gene expression, and intracellular protein trafficking in living cells. In this study, the dicistronic expression vector (pEGFP-C1) was used to be transfected into human lung cancer cell line (ASTC-a-1) and a positive clone which stably expressed GFP in high level was obtained. The results showed that the green fluorescent protein expressed in tumor cells was also photobleached under intense irradiation (-488 nm) and the degree of photobleaching varied with the intensity of the excitation. In order to analyze the effect of low temperature on the fluorescent sample, the photobleaching of tumor cell slice stored at -20 degrees C was observed additionally.
Arteriosclerosis and its complications, such as heart attack and stroke, are the major causes of death in developed countries. It was believed that age, hyperlipidemia, hypertension, diabetes and smoking are common risk factors for cardiovascular disease. In addition, overwhelming clinical and epidemiological studies have identified homocysteine (Hcy) as a significant and independent risk factor for cardiovascular disease. In healthy individuals, plasma Hcy is between 5 and 10 micromol/L. One cause of severe hypehomocys- teinemia (HHcy) is the deficiency of cystathionine beta-synthase (CBS), which converts Hcy to cystathionine. CBS homozygous deficiency results in severe HHcy with Hcy levels up to 100 to 500 micromol/L. Patients with severe HHcy usually present with neurological abnormalities, premature arteriosclerosis. It has been reported that lowering plasma Hcy improved endothelial dysfunction and reduced incidence of major adverse events after percutaneous coronary intervention. The mechanisms by which Hcy induces atherosclerosis are largely unknown. Several biological mechanisms have been proposed to explain cardiovascular pathological changes associated with HHcy. These include: (1) endothelial cell damage and impaired endothelial function; (2) dysregulation of cholesterol and triglyceride biosynthesis; (3) stimulation of vascular smooth muscle cell proliferation; (4) thrombosis activation and (5) activation of monocytes. Four major biochemical mechanisms have been proposed to explain the vascular pathology of Hcy. These include: (1) autooxidation through the production of reactive oxygen species; (2) hypomethylation by forming SAH, a potent inhibitor of biological transmethylations; (3) nitrosylation by binding to nitric oxide or (4) protein homocysteinylation by incorporating into protein. In summary, our studies, as well as data from other laboratories support the concept that Hcy is causally linked to atherosclerosis, and is not merely associated with the disease. Although folic acid, vitamin B12 and B6 can lower plasma Hcy levels, the long-term effects on cardiovascular disease risk are still unknown and judgments about therapeutic benefits await the findings of ongoing clinical trials.
We have previously established a culture method to isolate and cultivate neural stem cells (NSCs) derived from the rat embryonic brain and spinal cord. In the present study, we demonstrate that the spinal cord-derived NSCs can be induced to differentiate into oligodendrocyte precursor cells (OPCs) with a combined treatment composed of (1) conditioned medium collected from B104 neuroblastoma cells (B104CM) and (2) basic fibroblast growth factor (bFGF, 10 ng/ml). After induction, over 95% of the cells displayed bipolar or tri-polar morphology and expressed A2B5 and platelet derived growth factor receptor-alpha (PDGFR-alpha), markers that are specific for OPCs. Among PDGFR-alpha positive OPCs, only a few cells expressed glia fibrillary acidic protein (GFAP) and none expressed beta-tubulin III. In the presence of B104CM and bFGF, OPCs proliferated rapidly, formed spheres, expanded for multiple passages, and maintained their phenotypic properties. Upon withdrawal of B104CM and bFGF, these cells differentiated into either O4/GlaC-positive oligodendrocytes (OLs) or GFAP- and A2B5-positive type-2 astrocytes. Our results indicate that NSCs can be induced to differentiate into OPCs that possess properties of self-renewal and differentiation into oligodendrocytes and type-2 astrocytes, a property similar to that of O-2A progenitor cells. The OPCs can be maintained in an undifferentiated state over multiple divisions as long as both B104CM and bFGF are present in the medium. Thus, large quantity of OPCs can be obtained through this method for potential therapeutical interventions for various neurological degenerative diseases.
It has been reported that extracellular signal-regulate kinase (ERK) is involved in the modulation of nociceptive information and central sensitization produced by intense noxious stimuli and/or peripheral tissue inflammation. Few studies have explored the relationship between ERK and cAMP response-element binding protein (CREB) in neuropathic pain after nerve injury, such as chronic constriction injury (CCI) of the sciatic nerve. In the present study, CCI model was employed to investigate the activation of ERK on the expression of phosphorylated CREB (pCREB) in chronic neuropathic pain. Lumbar intrathecal catheters were chronically implanted in male Sprague-Dawley rats. The left sciatic nerve was loosely ligated proximal to the sciatica's trifurcation at around 1.0- mm intervals with 4-0 silk suture. Mitogen-activated protein kinase kinase (MEK) inhibitor U0126 and phosphorothioate-modified antisense oligonucleotides (ODN) were intrathecally administered one day before and three consecutive days after CCI. Thermal and mechanical nociceptive thresholds were assessed with the paw withdrawal lantency (PWL) to radiant heat and von Frey filaments respectively. The expression of pCREB and Fos were assessed by both Western blot and immunohistochemical analysis. The results showed that intrathecal injection of U0126 or ERK antisense ODN attenuated significantly CCI-induced mechanical and thermal hyperalgesia. Correlating with behavior results, the injection also markedly suppressed the increase of CCI-induced pCREB and c-Fos expression. The results obtained suggest that CREB participates in the pERK-mediated neuropathic pain.
The present study was aimed to investigate the effects of ginsenoside Rb1 on okadaic acid (OA)-induced Tau hyperphosphorylation in hippocampal neurons of Sparague-Dawley rat and to explore its possible mechanism. Animals were randomly divided into four groups. Group 1 received dimethysulphoxide (DMSO) injection (vehicle group), group 2 only received OA injection (OA group), group 3 was pretreated with Rb1 and then received OA injection (Rb1 pretreatment group), and the group 4 was an intact control group. The animals in group 3 were injected intraperitoneally with various doses of Rb1 at 5, 10, and 20 mg/kg (once a day for 14 d). On the thirteen day of pretreatment, animals in Rb1 pretreatment group as well as animals in OA group received a bolus injection of 0.483 microg of OA (1.5 microl of solution in DMSO) at right dorsal aspect of hippocampus to induce Tau hyperphosphrylation. The brains were harvested one day after the last treatment. In all groups, the morphology of neurofibrils, phosphorylation of Tau protein, and the activity of phosphatase 2A (PP2A) were investigated. In OA group, the Bielschowski's assay revealed darkened and uneven neurofibrils staining in the hippocampus. The immunohistochemistry results showed a significant increase in Thr(231) phosphorylation of Tau protein in OA group relative to the control group (P<0.01). OA injection also markedly decreased PP2A activity (P<0.01). Western blot confirmed Thr(231) phosphorylation of Tau protein and it also detected phosphorylation of Ser(396) of Tau protein. The animals with Rb1 pretreatment displayed even staining of neurofibrils and normal pattern of fiber organization. Rb1 pretreatment also attenuated Thr(231) and Ser(396) hyperphosphorylations of Tau protein, and restored PP2A activity compared to the OA group (P<0.01). These results indicate that OA-induced hyperphosphorylation of Tau protein in rat hippocampal neurons can be attenuated by the pretreatment of ginsenoside Rb1. These data also implicate that Rb1 has potential neuroprotective effects on Tau-related neuropathology.
Our previous studies showed that spinal neurons sensitization was involved in morphine withdrawal response. This study was to investigate the roles of spinal protein kinase C (PKC) alpha, gamma in morphine dependence and naloxone-precipitated withdrawal response. To set up morphine dependence model, rats were subcutaneously injected with morphine (twice a day, for 5 d). The dose of morphine was 10 mg/kg in the first day and was increased by 10 mg/kg each day. On day 6, 4 h after the injection of morphine (50 mg/kg), morphine withdrawal syndrome was precipitated by an injection of naloxone (4 mg/kg, i.p.). Chelerythrine chloride (CHE), a PKC inhibitor, was intrathecally injected 30 min before the administration of naloxone. The scores of morphine withdrawal symptom and morphine withdrawal-induced allodynia were observed. One hour after naloxone-precipitated withdrawal, Fos protein expression was assessed by immunohistochemical analysis and Western blot was used to detect the expression of cytosol and membrane fraction of PKC alpha and gamma in the rat spinal cord. The results showed that intrathecal administration of CHE decreased the scores of morphine withdrawal, attenuated morphine withdrawal-induced allodynia and also inhibited the increase of Fos protein expression in the spinal cord of morphine withdrawal rats. The expression of cytosol and membrane fraction of PKC alpha was significantly increased in the spinal cord of rats with morphine dependence. Naloxone-precipitated withdrawal induced PKC alpha translocation from cytosol to membrane fraction, which was prevented by intrathecal administration of CHE. During morphine dependence, but not naloxone-precipitated withdrawal, PKC gamma in the spinal cord translocated from cytosol to membrane fraction, and intrathecal administration of CHE did not change the expression of PKC gamma in the spinal cord of naloxone-precipitated withdrawal rats. It is suggested that up-regulation and translocation of PKC in the spinal cord contribute to morphine dependence and naloxone-precipitated withdrawal in rats and that PKC alpha and gamma play different roles in the above-mentioned effect.
Cell cycle progression is tightly regulated in hematopoietic stem cells. The cycle state decides cells' fates, which includes self-renewal, proliferation and differentiation. Proper cell cycle regulation is a pivotal element for the maintenance of hematopoiesis homeostasis. HTm4 is a newly identified specific cell cycle regulator of the hematopoietic cell. Through interacting with KAP-CDK2 complex, it arrests cells in G(0)/G(1) phase. K562 is a human chronic myelogenous leukemia cell; it could be induced to megakaryoblast by phorbol 12-myristate 13-acetate (PMA). Such differentiation must be associated with cell cycle change. To further clarify HTm4's function in hematopoietic cell cycle regulation, K562 cells were treated with PMA. Cell cycle change was analysed using flow cytometric system. And during the induction process gene expression of HTm4 as well as CycleE and CDK2, which are responsible for G(1) to S transition, were analysed using semi-quantitative RT-PCR. The C-terminal domain of HTm4 protein has been shown to be important for HTm4's binding with KAP-CDK2 complex. To determine its impact on HTm4's function, HTm4 and C-terminal truncated HTm4 (HTm4-ct) were transfected into K562 cells using Tet-Off regulation expression system. Their influence on cell cycle was observed. The results showed that PMA induced both expansion and differentiation of K562 cells as measured by cell number count and NBT staining respectively. During PMA treatment, G(0)/G(1) cell proportion and HTm4 expression displayed coordinated change, which suggested that HTm4 might drive K562 cells out of cell cycle but was not involved in the quiescence maintenance. Additionally, transfection of HTm4 caused G(0)/G(1) arrest in K562 cells, while transfection of HTm4-ct did not. It is therefore suggested that the C-terminal domain is important for the function of HTm4 in cell cycle regulation.
To study the effects of serum-free murine bone marrow endothelial cell conditioned medium (mBMEC-CM) on the growth of bone marrow endothelial cells, mBMEC-CM was collected and ultrafiltrated by Centriprep-10. The retentate of mBMEC-CM [molecular weight (MW)>10 kDa] and the filtrate of mBMEC-CM (MW<10 kDa) were obtained. The effect of bone marrow conditioned media, their components and exogenous cytokines on the formation of endothelial cell colonies were observed. The effect of bone marrow conditioned media, their components and exogenous cytokines on the proliferation of murine bone marrow endothelial cells were determined by [(3)H]-thymidine incorporation. The method of hybridizing to the Atlas cDNA array was used to determine the expression of cytokine mRNAs in bone marrow endothelial cells. The results obtained are as follows: vWF was expressed in bone marrow endothelial cells. The original mBMEC-CM and MW>10 kDa component of mBMEC-CM promoted the proliferation of bone marrow endothelial cell colonies and increased [(3)H]-thymidine incorporation of bone marrow endothelial cells. The MW<10 kDa component did not affect the production of endothelial cell colonies and did not increase [(3)H]-thymidine incorporation of endothelial cells. Six cytokines (IL-6, IL-11, SCF, GM-CSF, VEGF, bFGF) promoted the proliferation of bone marrow endothelial cell colonies. VEGF, bFGF and SCF increased [(3)H]-thymidine incorporation of bone marrow endothelial cells. According to the results of the Atlas cDNA array, GM-CSF,TGF-beta,BMP-2, bFGF, SCF, endothelin-2, thymosin beta10, MSP-1, connective tissue GF, PDGF-A chain, MIP-2 alpha, PlGF, neutrophil activating protein ENA-78, INF-gamma, IL-1, IL-6, IL-13, IL-11, inhibin-alpha mRNAs were expressed in endothelial cells. These results suggest that murine bone marrow endothelial cell conditioned medium promotes the proliferation of bone marrow endothelial cells.
The purpose of the present study was to investigate the effects of advanced glycation end products (AGEs) modified protein on the permeability of endothelium monolayers and morphological changes of actin cytoskeleton. The roles of receptor for AGEs (RAGE), oxidant stress and the activation of p38 MAPK pathway in this pathological procedure were elucidated. Human umbilical vein endothelial cells (HUVECs)-derived cell line (ECV304) were incubated with AGEs modified human serum albumin (AGE-HSA) in concentrations of 12.5, 25, 50, and 100 microg/ml respectively, for 2, 4, 8, 12 and 24 h. As control, HSA of the same concentration was administered to cells. Then TRITC-albumin was added to evaluate Pa value that reflects the permeability of endothelial monolayer. Furthermore, to visualize the morphological changes of actin cytoskeleton, the treated cells were incubated with rhodamine-phalloidin to stain F-actin. The results showed that the trans-endothelial membrane flux of albumin was significantly increased in a concentration- and time-dependent manner upon the stimulation of AGE-HSA, accompanying with actin reorganization. The blockage of AGE and RAGE binding with anti-RAGE IgG and the pharmacological inhibition of NADPH oxidase or p38 MAP kinase greatly attenuated the AGE-induced hyperpermeability response, respectively. These results indicate that RAGE, NADPH oxidase and p38 MAPK are possibly involved in the mediation of AGEs-induced barrier dysfunction and actin cytoskeleton reorganization in endothelial cells.
We have previously shown that the vasodilator effect of protopine (Pro) on rabbit aorta is related to the elevations of cAMP and cGMP. In the present study, the vasodilator mechanisms of Pro were further explored by recording the isotonic contraction of the rat aortic strips, detecting directly the intracellular free Ca(2+) concentration ([Ca(2+)](i)) with Fura-2/AM loaded vascular smooth muscle cells (VSMCs) of rat aorta, and determining the activity of protein kinase C (PKC) in rat aortic tissue with radioactive isotope gamma-32P -ATP-catalyzing assay. By recording the aortic strips contraction induced by noradrenaline (NA) and high potassium (K(+)), Pro shifted nonparallelly the concentration-response curves of NA and high K(+) to right, in which the maximal response was depressed in the presence of Pro (30 and 100 micromol/L), and the values of pD'(2) were 3.70-/+0.25 and 3.97-/+0.15 for NA and high K(+), respectively. In the Fura-2/AM loaded VSMCs, Pro (50 and 100 micromol/L) could not produce any significant change on the resting [Ca(2+)](i), but significantly decreased the [Ca(2+)](i) elevated by NA and high K(+). Pro (30 and 100 micromol/L) had no significant effect on the activity of the cytosolic and membrane PKC in the aortic strips inpretreated by NA. However, in the aortic strips pretreated by NA, the activity of membrane PKC was significantly increased and the activity of cytosolic PKC tended to be decreased by Pro, while the activity of total PKC did not change. These results suggest that Pro seems to promote the translocation of PKC from the cytosol to the membrane in the presence of NA, its vasodilator effect may be the comprehensive result of its decreasing effect on the [Ca(2+)](i) and the increasing effect on cAMP and cGMP, as well as its influence on the PKC.
Type III glycogen storage disease (GSD-III, McKusick 232400), is a rare autosomal recessive disorder, also known as Cori's or Forbe's disease. The affected enzyme is amylo-1,6-glucosidase, 4-alpha-glucanotransferase (glycogen debrancher enzyme, GDE or amylogluco-sidase, AGL), which is responsible for the debranching of the glycogen molecule during catabolism. The AGL gene is located on chromosome 1p21 and contains 35 exons translated in a monomeric protein product. The clinical manifestations of GSD-III are represented by hepatomegaly, recurrent hypoglycemia, seizures, growth failure, dysmorphism, hyperlipidemia, raised transaminases and creatine kinase concentrations and, in a number of subjects, myopathy and cardiomyopathy. The hepatocellular adenoma, hepatocellular carcinoma, diabetes mellitus and liver fibrosis remain rare events. The diagnosis of debrancher deficiency was established by laboratory tests, electromyography (EMG), and muscle and liver biopsy.
To analyze the effect of hyperoxia on the proliferation and surfactant associated protein messenger RNA levels of type II alveolar epithelial cells (AECIIs) of premature rat, and to investigate the effect of amygdalin on the change resulted from hyperoxia in AECIIs isolated from premature rat lung in vitro.
To observe the osteoblasts transfected with green fluorescent protein (GFP)by adenovirus vector expressed in vitro and traced it in vivo in order to research the feasibility of GFP as a tracer of seeding cells for tissue engineering.
Changes of lipid peroxidation reaction and NK cell activity in spleen of CCl4-induced liver injury mice with adding orgnoselenium from Se-enriched lactobacillus were studied to discuss the protective effect of orgnoselenium and its mechanism. Sixty healthy mice (female: male=1:1) were chosen and divided randomly into four groups: control group (group C), orgnoselenium group (group Se), CCl4-injection group (group CCl4) and CCl4-injection plus orgnoselenium group (group CCl4-Se). The liver injury was induced by abdominal injection of CCl4 (0.07ml/100g body weight) on every other day over four weeks. The spleens were collected at the 2nd and 4th week, and spleen NK cell activity, spleen homogenate GSH-Px, SOD, CAT activities and MDA concentration were determined. The results showed that during the entire experimental period, spleen homogenate GSH-Px, SOD and CAT activities in groups C, Se and CCl4-Se were higher or significantly higher than that in group CCl4, and three antioxidant enzyme activities in groups Se and CCl4-Se had no apparent differences from that in group C except that there were significant increases of SOD activity at the 4th week. Spleen homogenate MDA content of group CCl4 increased markedly compared with that of groups C, Se and CCl4-Se, MDA level of group CCl4-Se was close to that of group C, and that of group Se was lower. During the entire experimental period, NK cell activity of group Se was the highest and significantly higher than that of group C at the 4th week, a lowest value was observed in group CCl4, which was lower or markedly lower than that of groups C, Se and CCl4-Se, there were no significant differences between group CCl4-Se and group C. It is suggested that orgnoselenium from Se-enriched lactobacillus can enhance antioxidation ability in normal mice and play an effective role by means of improving and enhancing the spleen antioxidation enzymes and NK cell activities in the process of intervening liver injury.
The ultracytochemical localizations of ATPase activity on amyloplasts and protein bodies were studied by using a lead precipitation technique at middle and late developmental stage of endosperm in rice (Oryza sativa L. cv. Minghui 63). The results showed that the inner and outer plasma membrane of amyloplasts, the web-like passages among starch grains and the amorphous substance surrounding the amyloplasts exhibited high ATPase activity. ATPase activity products were present on the membranes of protein body I and protein body II, and on the vacuoles and vesicle-like structures surrounding protein bodies. Active products of ATPase were also located on the plasma membrane and cell wall of starchy endosperm cells, on the cell wall, plasma membrane, nucleus and plasmodesma of aleurone and subaleurone layer cells. According to the distribution pattern of active products of ATPase, we infer that the web-like passage in amyloplast may be the transporting channel for nutrients flowing into the amyloplast. The ATPase on amyloplasts and protein bodies can supply the power for nutrients passing through the plasma membranes.
The aim of this study was to evaluate the outcome of treatment of pregnancy--induced hypertension (PIH) in rats by Ligustrazine collaborated with magnesium sulfate. PIH rat models were induced with Nomega-nitro-L-arginine methyl ester (L-NAME) infusing at 7 mg/kg per day via caudal vein for four days, then treated with Ligustrazine, magnesium sulfate, or both for three days. Rat blood pressure level was measured by the tail-cuff method, 24 hours urine protein was also assayed. The blood pressure and urine proteins of grouped PIH rats were recorded before the start and after the termination of therapy. The body length and the weight of fetal rats, the weight of placentals from pregnant rats were measured. The placental tissues, livers, kidneys of rats were investigated with integrated methods such as histopathologic observation with light microscopy, ultrastructural observation with transmission electron microscopy. L-NAME administration in pregnancy rats during the late pregnancy period had resulted in an rise of blood pressure, an increasing of urine protein, death rate of rat fetus, incidence of teratogenesis, and so on. Three groups of PIH rats treated with single magnesium sulfate, Ligustrazine, or Ligustrazine combined with magnesium sulfate showed an obvious dropping of the proteinuria, decompression of blood pressure (p<0.01, p<0.001), especially the treatment efficacy in the group of Ligustrazine combined with magnesium sulfate was more significant effective than other two groups (p<0.01, p<0.001). The treatment with both Ligustrazine and magnesium sulfate could increase the body length of newly born rats, the body weight of tomites and the placental weight, furthermore, reduce the rate of the teratosis of hindlimb-shortness (p<0.001). There were diffuse focal necrosis areas in the livers of PIH rats, their glomerular basement membrane had thickened extensively, the glomerular endothelium had swelled, extensive edema in the epithelia of renal tubule was demonstrated. The decidua and basal zone of the placentae of PIH rats all thickened, the microvilli of trophoblasts decreased. After treatment with ligustrazine especially with both Ligustrazine and magnesium sulfate, the necrosis of hepatocytes disappeared. The thickening of glomerular basement membrane in the group of ligustrazine or both Ligustrazine and magnesium sulfate treatment reduced; Moreover in the latter group the morphology of glomerular endothelium essentially recovered, the edema in cytoplasms of renal tubular epithelium reduced. The placental lesions were also relieved. The present results indicated the therapeutic effect by Ligustrazine collaborated with magnesium sulfate was better than a single use of Ligustrazine or magnesium sulfate. There were pathological alteration involved ischemia and anoxic in the placental tissues of PIH rats, resembled the placental pathological alteration of the human cases with PIH. The treatment with ligustrazine, and especially both Ligustrazine and magnesium sulfate in PIH rats could obviously relieve the lesions in lives, kidneys and placentae.
Salt stress induced Gamma-aminobutyric acid (GABA) accumulation in maize plants. The germination of maize seeds was inhibited seriously by NaCl treatment, while exogenous GABA reduced the inhibition of NaCl on the seeds germination. Effects on SOD, POD and CAT activity of GABA were detected. 1-2 mmol/L GABA induced the increase of the activity of SOD, POD and CAT about 20%. Because of SOD, CAT and POD are important protective enzymes which can eliminate active oxygen, so GABA can alleviate the damage of salt stress through promoting the activity of the protective enzyme system.
The expression of c-fos protein was examined in the brain of reproduction termite (Reticulitermes aculabialis) with immunocytochemical localization method. The results showed c-fos protein immunoreactivity was found in the procerebrum, deutocerebrum and tritocerebrum of termites at all stages. At last instar nymph and after flying stage, c-fos immunoreactivity of procerebrum was weak, but the female and male termites displayed significantly increased the number of c-fos labeled cells in the protocerebrum at flying stage. On the other hand, previous studies have demonstrated neural cells of procerebrum could strongly secrete FSH (Follicle Stimulating Hormone) and LH (Luteinizing Hormone) which maintained libido and stimulated mating flight. This meaned that c-fos expression of procerebrum involved in hormone regulation in sexual behavior,as have been shown in mammal. In conclusion, we demonstrated here for the first time that c-fos expression of procerebrum of termites involved in sexual behavior. These resulats provided a new morphological proof that neural activation of procerebrum participated in the regulation of sexual behavior of termites.
To study the signal roles of protein tyrosine kinase (PTK) on proliferation and collagen synthesis of fibroblasts derived from hypertrophic scar(HS-FB) and normal skin (NS-FB) by interferon-gamma (IFN-gamma) or transforming growth factor beta1 (TGF-beta1).
To investigate the expression of p73 and c-fos protein and its significance in the development of children hemangioma.
To construct eukaryotic expression vector of ribosomal protein sl5(RPs15) gene and study its effect on mouse skin fibroblasts in vitro.
InGaN/GaN multiquantum well, grown by MOCVD on a sapphire substrate and annealed under the conditions of 700 and 900 degrees C x (20 min)(-1), was studied by means of mirco-Raman spectroscopy and photoluminescence. The Raman peak of E2, A1 showed red shift after multiquantum were wells annealed, and the HWHM of Raman peakdecreased imperceptibly. Moreover,the photoluminescence peak of the sample annealed under the condition of 700 degrees x (20 min)(-1) showed a red shift, then appeared a blue shift under the condition of 900 degrees C x (20 min)(-1). These results clearly showed that the sample annealed induced strain stress relief that could explain Raman peak shift, but the piezoelectric field induced the quantum-confined Stark effect, which can't agree with the photoluminescence experiment. Sample annealed could change the width of quantum well and InGa phase segregated; these factors influencing structure of quantum well could explain the results of photoluminescence spectra.
A new method for the determination of albumin in human serum and mouse serum has been developed by spectrophotometry coupled with acid brown SR(ASR) as probe molecule. The maximum absorption wavelength of ASR was at 445 nm, while the maximum absorption wavelength of their product was at 610 nm. However, the reaction of ASR with albumin such as BSA or HSA was so strong that parts of their product were undissoluble in water. The addition of gum water into the system effectively eliminated the deposition. Under optimum reaction conditions, the ranges of working lines for BSA and HSA were 0-91.0 mg x L(-1) and 0-95.2 mg x L(-1), respectively. The detection limits were 5.72 mg x L(-1) for BSA and 5.15 mg x L(-1) for HSA. The relative standard derivation and the recovery of the method for the determination of total proteins in 6 human serum samples were 1.8%-4.4% and 93.6% - 109.1%, respectively. The proposed method has been employed in the assay of protein of human serum and mouse serum. The results of this work were in agreement with those obtained by Biuret method.
2-octyl-1, 3-diphenol-1, 3-propdione was synthesized by phase transfer catalysis and its Sm complexes were prepared. These compounds were characterized by IR, EA, UV and 1H NMR; Sm complex and its mixture doped with PE and PVC show photoluminescence at 650 nm. There is excellent compatibility between Sm complex and plastics by the addition of long carbon chain. Therefore, Sm complex with long carbon chain is a superior light conversion agent with good compatibility in resins with emission wavelength suitable to the 643 and 660 nm for plants' photosynthesis.
To study the cell viability, activities of enzyme and ultrastructure changes induced by sodium fluoride in primary cultured rat hepatocytes.
To investigate the protective effects of Lovastatin on renal function in experimental diabetic nephropathy in rats. and the function of cAMP-responsive element binding protein (CREB1) in this duration.
Protein-protein interactions are essential in every aspect of cellular activity. Multiprotein complexes form and dissociate constantly in a specifically tuned manner, often by conserved mechanisms. Protein domains that bind proline-rich motifs (PRMs) are frequently involved in signaling events. The unique properties of proline provide a mechanism for highly discriminatory recognition without requiring high affinities. We present herein a detailed, quantitative assessment of the structural features that define the interfaces between PRM-binding domains and their target PRMs, and investigate the specificity of PRM recognition. Together with the analysis of peptide-library screens, this approach has allowed the identification of several highly conserved key interactions found in all complexes of PRM-binding domains. The inhibition of protein-protein interactions by using small-molecule agents is very challenging. Therefore, it is important to first pinpoint the critical interactions that must be considered in the design of inhibitors of PRM-binding domains.
High-speed counter-current chromatography (HSCCC) is a continuous liquid-liquid partition chromatography, with remarkable advantages of high separation efficiency and no adsorption or denaturation by solid phase. The retention of stationary phase and the separation of proteins in polyethylene glycol 1000 (PEG1000)-phosphate aqueous two-phase system (ATPs) were studied with a multi-column high speed-counter-current chromatograph. The flow direction and speed of the mobile phase, and the rotation direction and speed of the apparatus showed different effects on the retention of the stationary phase, which reached the maximum at 33.3% with a flow rate of 0.6 mL/min and a rotation speed of 900 r/min in 14.0% PEG1000-16.0% phosphate ATPs. Distinct differences in partition coefficients among cytochrome C, lysozyme and hemoglobin were found at pH 9.2 and these three proteins were successfully separated in 14.0% PEG1000-16.0% phosphate ATPs at pH 9.2 by HSCCC with the apparatus rotating at 850 r/min and the mobile phase flow rate of 1.0 mL/min. The major protein components in hen egg white, including ovaltransferrin, ovalbumin and lysozyme also show distinct differences of partition coefficients in PEG1000-phosphate ATPs at pH 9.2. Ovalbumin and lysozyme were successfully purified to homogeneity and ovaltransferrin to ca 60% purity from the hen egg white sample with yields over 90% in 15.0% PEG1000-17.0% phosphate ATPs at pH 9.2 with the apparatus rotating at 850 r/min and mobile phase flow rate of 1.0 mL/min.
A high performance liquid chromatographic method to determine angiotensin-converting enzyme inhibitor activity in vitro was established by using N-hippuryl-His-Leu tetrahydrate as the reaction substrate and hippuric acid as the reaction product. The chromatographic conditions were as follows: column, ZORBAX SB-C18 (4.6 mm i. d. x 150 mm, 5 microm); column temperature, 25 degrees C; mobile phase, acetonitrile-distilled water (25:75, v/v, both containing 0.05% (v/v) trifluoroacetic acid and 0.1% (v/v) triethylamine); flow rate, 0.5 mL/min; detection wavelength, 228 nm. An excellent linearity over the range of 0.005-1.000 mmol/L (r = 0.9999) was observed. The detection limit was 0.50 micromol/L. The recoveries of hippuric acid ware 99.48%-105.64%, with a relative standard deviation (RSD) of 2.20% (n = 6). It is a simple, precise and reliable assay method for developing antihypertension drugs.
A new method for rapidly detecting restriction enzyme pattern of mycobacterium deoxyribonucleic acid (DNA) by capillary electrophoresis with laser induced fluorescence detection (CE-LIFD) was developed. Polymerase chain reaction was used to amplify a 439 bp fragment of 65,000 (Mr) heat shock protein gene (hsp65) of mycobacterium. After digesting the amplification products by BstE II and Hae III respectively, the patterns of enzyme cleavaged products were detected by both CE-LIFD and agarose gel electrophoresis (AGE). The experimental parameters of CE were optimized. The restriction enzyme patterns of mycobacterium DNA can be detected under the optimum electrophoresis conditions: a coated capillary column with the length of 50 cm and 100 microm i. d., electrophoresis buffer of 45 mmol/L TBE (trihydroxymethyl aminomethane (Tris)-boric acid-ethylenediaminetetraacetic acid (EDTA)) and 11 kV running voltage. The restriction enzyme patterns for eight species of mycobacteria were studied. Relative standard deviations of the relative migration times of the DNA segments were less than 3.6%. Compared with AGE, CE is more outstanding in resolution and detection time, and it can be applied as a more effective means for DNA restriction enzyme pattern analysis.
Angiotensin II (ANG-II) and its receptor (AT1) have been potential targets of therapy for liver cirrhosis. However, AT1 expression in human cirrhotic livers has not been clarified. We studied AT1 and ANG-II generating enzymes in human autopsy (20 cirrhotics and 20 normal controls) and biopsy (10 cirrhotics) livers. AT1 immunoreactivity in tissue sections was quantified by computer-aided morphometry. AT1 protein and mRNA levels were assessed by Western blotting and real-time polymerase chain reaction. Concerning ANG-II generating system, angiotensin-converting enzyme (ACE) and mast cell chymase were examined. AT1 expression was seen not only in vascular smooth muscle cells, but also in activated stellate cells/myofibroblasts and liver parenchymal cells. AT1-positive vessels and myofibroblasts were significantly increased in fibrous septa of cirrhosis, although overall hepatic AT1 expression was reduced in the cirrhotic livers compared with the controls. Augmentation of AT1-positive vessels was related to severity of portal hypertension. Expressions of ACE and chymase were enhanced in the cirrhotic livers. These results suggest that hepatic AT1 expression is shifted to and concentrated in vessels and myofibroblasts in cirrhotic settings, and increased ANG-II generation by ACE and chymase contributes to portal hypertension and liver fibrosis via binding to AT1 expressed on vessels and myofibroblasts.
Lipoxin A(4) is formed by the metabolism of arachidonic acid. Anti-inflammatory and anti-proliferative effect of lipoxin A(4) has been shown in many human diseases. Recently, as a novel high affinity receptor for ligand lipoxin A(4), Lipoxin A(4) receptor-like protein (LRLP) has been identified. Currently close attention is paid to the important contribution of connective tissue growth factor (CTGF) in lung fibrosis. The purpose of the study was to transfect LRLP gene into human lung fibroblasts and investigate the mechanism of its enhancing antagonistic effect of Lipoxin A(4) on human lung fibroblasts proliferation induced by connective tissue growth factor.
To distinguish patients with hypertensive disorder complicating pregnancy from healthy pregnant women by examining serum protein fingerprinting.
The concept of atherosclerosis as an inflammatory disorder has led to the exploration of new pathogeneses of this disease. In this regard, the levels of several inflammatory molecules are frequently increased in subjects at high risk of developing an acute coronary event. With a simple analysis we can characterize the circulating levels of a marker and its therapeutic modulation with various drugs. In this review we have analyzed different inflammatory markers currently used, such as C-reactive protein (CRP), CD40 ligand, adhesion molecules and chemokines, and their possible modulation by therapeutic intervention with 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase inhibitors. Moreover, in the future, new technologies will allow us to discover new markers, or sets of them, that could indicate the direction to be taken in the prevention and treatment of cardiovascular diseases.
To investigate the dynamic expression of hypoxia-inducible factor 1alpha (HIF-1alpha) and mitogen-activated protein kinase (MAPK) in pulmonary arteries of rats with hypoxia-induced pulmonary hypertension.
To study the multi-lineage potential of bone marrow mesenchymal stem cells (MSCs) derived from transgenic mice with green fluorescent protein (GFP) gene in vitro.
Vascular-resided bacterial and fungal diseases have caused a great deal of yield loss and quality reduction in crop production world-wide. For genetic engineering of crops resistant to these diseases, it is disirable to have a strong and vascular-specific promoter. This article reviews the progress in identification of vascular-specific promoters and its function. To date, roughly twenty vascular-specific promoters have been documented. The cis-elements and motifs have been studied in detail for the promoters of bean phenylalanine ammonia lyase (PAL2), bean glycine-rich protein (grp 1.8) and Arabidopsis profilin2 (pfn2) in particular.The motif of vs-1 (CATGCTCCGTTGGATGTGGAAGACAGCA) found in grp 1.8 promoter was a cis-element that specificically bind to a transcription activation factor VSF-1 protein (one of the bZIP proteins). Mutation of vs-1 prevented it from binding to VSF-1 that resulted in abolishing the vascular-specific expresson of gus gene. Motifs of AC-I and AC-II found in PAL2 promoter were also found to be essential for vascular-specific expression. In our laboratory we have dissected pfn2 promoter into three domains (A, B, C) through 5'-deletion analysis. In this promoter we have identified two core sequences of ACGT that is commonly found in the binding sites of bZIP protein, the most abundent transcription factor existed in plants. In additon, the pfn2 promoter also contains an AC- I like sequence (CCACCTAC) that is similar to the AC- I motif (CCCACCTACC) found in PAL2 promoter. These promoters and cis-elements may have a wide range of potential applications to the genetic improvement of crops resistant to vascular diseases.