channel_count
int64 1
1
| characteristics_ch1
stringlengths 6
9.77k
| contact_address
stringlengths 1
229
| contact_city
stringlengths 1
47
| contact_country
stringclasses 71
values | contact_institute
stringlengths 2
128
| contact_name
stringlengths 4
74
| contact_zip
stringclasses 1
value | data_processing
stringlengths 4
10.6k
| extract_protocol_ch1
stringlengths 6
14.3k
| geo_accession
stringlengths 9
10
| instrument_model
stringclasses 13
values | last_update_date
stringlengths 11
11
| library_selection
stringclasses 6
values | library_source
stringclasses 5
values | library_strategy
stringclasses 1
value | molecule_ch1
stringclasses 7
values | organism_ch1
stringclasses 1
value | platform_id
stringclasses 13
values | relation
stringlengths 0
2.61k
| sample
stringlengths 9
10
| series_id
stringlengths 8
29
| singlecellprobability
float64 0
1
| source_name_ch1
stringlengths 1
253
| status
stringlengths 21
21
| submission_date
stringlengths 11
11
| taxid_ch1
stringclasses 1
value | title
stringlengths 1
120
| type
stringclasses 1
value | sra
stringlengths 47
49
⌀ | biosample
stringlengths 51
51
⌀ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
1 | tissue: bone marrow,genotype: SF3B1 wildtype,disease: normal | 9500 Euclid Ave. | Cleveland | USA | Cleveland Clinic Foundation | John,,Barnard | 100-bp paired-end RNA-Seq reads were mapped to the hg19 RefSeq human transcriptome and spliceosome by DNAnexus (http://dnanexus.com) using a Bayesian method, in which a read was mapped when its posterior probability of mapping exceeded 0.9.,These filtered posterior probabilities were summed to generate fractional read counts per gene and per exon, with probabilities from splice-junction spanning reads counted for each relevant exon.,Genome_build: hg19,Supplementary_files_format_and_content: Mapped exon counts; Alternative Splicing format: type The type of element â either an exon or a junction; gene_id The unique identifier for the gene from the reference database; gene_name The reference gene name in the database; chromosome_name Chromosome name for the gene; strand Genomic strand for the gene; prev_exon_left If the element is a splice site, this represents the left boundary of the donor exon. If the element is an exon, this represents the left boundary; prev_exon_right If the element is a splice site, this represents the right boundary of the donor exon. If the element is an exon, this represents the right boundary; next_exon_left If the element is a splice site, this represents the left boundary of the acceptor exon. If the element is an exon, this field is not used; next_exon_right If the element is a splice site, this represents the right boundary of the acceptor exon. If the element is an exon, this field is not used; read_count The sum of the posterior probabilities for all confident reads that map to the element. | Isolated total RNA from bone marrow mononuclear cells,RNA libraries were prepared for sequencing using standard Illumina protocols | GSM1066118 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX218317,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01889224 | GSM1066118 | GSE43603 | 0.010406 | bone marrow mononuclear cells | Public on Jan 18 2013 | Jan 17 2013 | 9606 | Healthy patient #1 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX218317 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01889224 |
|
1 | tissue: bone marrow,genotype: SF3B1 somatic heterozygote, H666Q,disease: RARS-T, >15% ring sideroblasts | 9500 Euclid Ave. | Cleveland | USA | Cleveland Clinic Foundation | John,,Barnard | 100-bp paired-end RNA-Seq reads were mapped to the hg19 RefSeq human transcriptome and spliceosome by DNAnexus (http://dnanexus.com) using a Bayesian method, in which a read was mapped when its posterior probability of mapping exceeded 0.9.,These filtered posterior probabilities were summed to generate fractional read counts per gene and per exon, with probabilities from splice-junction spanning reads counted for each relevant exon.,Genome_build: hg19,Supplementary_files_format_and_content: Mapped exon counts; Alternative Splicing format: type The type of element â either an exon or a junction; gene_id The unique identifier for the gene from the reference database; gene_name The reference gene name in the database; chromosome_name Chromosome name for the gene; strand Genomic strand for the gene; prev_exon_left If the element is a splice site, this represents the left boundary of the donor exon. If the element is an exon, this represents the left boundary; prev_exon_right If the element is a splice site, this represents the right boundary of the donor exon. If the element is an exon, this represents the right boundary; next_exon_left If the element is a splice site, this represents the left boundary of the acceptor exon. If the element is an exon, this field is not used; next_exon_right If the element is a splice site, this represents the right boundary of the acceptor exon. If the element is an exon, this field is not used; read_count The sum of the posterior probabilities for all confident reads that map to the element. | Isolated total RNA from bone marrow mononuclear cells,RNA libraries were prepared for sequencing using standard Illumina protocols | GSM1066119 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX218318,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01889225 | GSM1066119 | GSE43603 | 0 | bone marrow mononuclear cells | Public on Jan 18 2013 | Jan 17 2013 | 9606 | SF3B1 mutant patient #1 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX218318 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01889225 |
|
1 | tissue: bone marrow,genotype: SF3B1 somatic heterozygote, K700E,disease: RARS, 50% ring sideroblasts | 9500 Euclid Ave. | Cleveland | USA | Cleveland Clinic Foundation | John,,Barnard | 100-bp paired-end RNA-Seq reads were mapped to the hg19 RefSeq human transcriptome and spliceosome by DNAnexus (http://dnanexus.com) using a Bayesian method, in which a read was mapped when its posterior probability of mapping exceeded 0.9.,These filtered posterior probabilities were summed to generate fractional read counts per gene and per exon, with probabilities from splice-junction spanning reads counted for each relevant exon.,Genome_build: hg19,Supplementary_files_format_and_content: Mapped exon counts; Alternative Splicing format: type The type of element â either an exon or a junction; gene_id The unique identifier for the gene from the reference database; gene_name The reference gene name in the database; chromosome_name Chromosome name for the gene; strand Genomic strand for the gene; prev_exon_left If the element is a splice site, this represents the left boundary of the donor exon. If the element is an exon, this represents the left boundary; prev_exon_right If the element is a splice site, this represents the right boundary of the donor exon. If the element is an exon, this represents the right boundary; next_exon_left If the element is a splice site, this represents the left boundary of the acceptor exon. If the element is an exon, this field is not used; next_exon_right If the element is a splice site, this represents the right boundary of the acceptor exon. If the element is an exon, this field is not used; read_count The sum of the posterior probabilities for all confident reads that map to the element. | Isolated total RNA from bone marrow mononuclear cells,RNA libraries were prepared for sequencing using standard Illumina protocols | GSM1066120 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX218319,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01889226 | GSM1066120 | GSE43603 | 0.022056 | bone marrow mononuclear cells | Public on Jan 18 2013 | Jan 17 2013 | 9606 | SF3B1 mutant patient #2 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX218319 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01889226 |
|
1 | cell line: HEK293,antibody: Nop58; goat polyclonal IgG; sc-23705,antibody vendor: Santa Cruz Biotechnology,3' adaptor: 5' TGGAATTCTCGGGTGCCAAGG 3' | Klingelbergstrasse 50-70 | Basel | Switzerland | University of Basel | Andreas,R,Gruber | The raw reads were processed on the CLIPZ server (www.clipz.unibas.ch; Khorshid et al., Nucleic Acids Research 2011, 39:D245 (PMID 21087992)).,For subsequent analyses only uniquely mapped reads were considered.,Genome_build: hg19 Feb 2009,Supplementary_files_format_and_content: bed files with genomic coordinates of reads mapped; scores represent the number of reads | PAR-CLIP samples were extracted following the PAR-CLIP method (Hafner et al. 2010; PMID: 20371350).,For HEK293 small RNA-seq samples total RNA was extracted with TRI Reagent, radiolabeled and size-selected on a PAA gel.,For HeLa Ago2-IP samples lysates were clarified and Ago2-RNA complexes isolated with an antibody, Ago2-associated RNA TRI Reagent-extracted, radiolabeled and size-selected on a PAA gel.,PAR-CLIP library preparation as described in (Hafner et al. 2010; PMID: 20371350).,Small RNA libraries for HEK293 cells were constructed as described in (Hafner et al. 2008; PMID: 18158127).,For HeLa Ago2 IP-seq samples Ago2-associated RNAs were extracted and used to prepare cDNA libraries as described in (Hafner et al. 2008; PMID: 18158127). | GSM1067861 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX218956,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01893944 | GSM1067861 | GSE43666 | 0.194614 | HEK293 | Public on May 08 2013 | Jan 22 2013 | 9606 | NOP58 rep A | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX218956 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01893944 |
|
1 | cell line: HEK293,antibody: Nop58; goat polyclonal IgG; sc-23705,antibody vendor: Santa Cruz Biotechnology,3' adaptor: 5' TGGAATTCTCGGGTGCCAAGG 3' | Klingelbergstrasse 50-70 | Basel | Switzerland | University of Basel | Andreas,R,Gruber | The raw reads were processed on the CLIPZ server (www.clipz.unibas.ch; Khorshid et al., Nucleic Acids Research 2011, 39:D245 (PMID 21087992)).,For subsequent analyses only uniquely mapped reads were considered.,Genome_build: hg19 Feb 2009,Supplementary_files_format_and_content: bed files with genomic coordinates of reads mapped; scores represent the number of reads | PAR-CLIP samples were extracted following the PAR-CLIP method (Hafner et al. 2010; PMID: 20371350).,For HEK293 small RNA-seq samples total RNA was extracted with TRI Reagent, radiolabeled and size-selected on a PAA gel.,For HeLa Ago2-IP samples lysates were clarified and Ago2-RNA complexes isolated with an antibody, Ago2-associated RNA TRI Reagent-extracted, radiolabeled and size-selected on a PAA gel.,PAR-CLIP library preparation as described in (Hafner et al. 2010; PMID: 20371350).,Small RNA libraries for HEK293 cells were constructed as described in (Hafner et al. 2008; PMID: 18158127).,For HeLa Ago2 IP-seq samples Ago2-associated RNAs were extracted and used to prepare cDNA libraries as described in (Hafner et al. 2008; PMID: 18158127). | GSM1067862 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX218957,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01893945 | GSM1067862 | GSE43666 | 0.082572 | HEK293 | Public on May 08 2013 | Jan 22 2013 | 9606 | NOP58 rep B | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX218957 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01893945 |
|
1 | cell line: HEK293,antibody: ANTI-FLAG M2; mouse monoclonal,antibody vendor: SIGMA,lot number: 088K6018,3' adaptor: 5' TGGAATTCTCGGGTGCCAAGG 3' | Klingelbergstrasse 50-70 | Basel | Switzerland | University of Basel | Andreas,R,Gruber | The raw reads were processed on the CLIPZ server (www.clipz.unibas.ch; Khorshid et al., Nucleic Acids Research 2011, 39:D245 (PMID 21087992)).,For subsequent analyses only uniquely mapped reads were considered.,Genome_build: hg19 Feb 2009,Supplementary_files_format_and_content: bed files with genomic coordinates of reads mapped; scores represent the number of reads | PAR-CLIP samples were extracted following the PAR-CLIP method (Hafner et al. 2010; PMID: 20371350).,For HEK293 small RNA-seq samples total RNA was extracted with TRI Reagent, radiolabeled and size-selected on a PAA gel.,For HeLa Ago2-IP samples lysates were clarified and Ago2-RNA complexes isolated with an antibody, Ago2-associated RNA TRI Reagent-extracted, radiolabeled and size-selected on a PAA gel.,PAR-CLIP library preparation as described in (Hafner et al. 2010; PMID: 20371350).,Small RNA libraries for HEK293 cells were constructed as described in (Hafner et al. 2008; PMID: 18158127).,For HeLa Ago2 IP-seq samples Ago2-associated RNAs were extracted and used to prepare cDNA libraries as described in (Hafner et al. 2008; PMID: 18158127). | GSM1067863 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX218958,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01893946 | GSM1067863 | GSE43666 | 0.201545 | HEK293 | Public on May 08 2013 | Jan 22 2013 | 9606 | NOP56 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX218958 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01893946 |
|
1 | cell line: HEK293,antibody: Fibrillarin; mouse monoclonal; AFB01,antibody vendor: Cytoskeleton, Inc.,lot number: 011,3' adaptor: 5' TGGAATTCTCGGGTGCCAAGG 3' | Klingelbergstrasse 50-70 | Basel | Switzerland | University of Basel | Andreas,R,Gruber | The raw reads were processed on the CLIPZ server (www.clipz.unibas.ch; Khorshid et al., Nucleic Acids Research 2011, 39:D245 (PMID 21087992)).,For subsequent analyses only uniquely mapped reads were considered.,Genome_build: hg19 Feb 2009,Supplementary_files_format_and_content: bed files with genomic coordinates of reads mapped; scores represent the number of reads | PAR-CLIP samples were extracted following the PAR-CLIP method (Hafner et al. 2010; PMID: 20371350).,For HEK293 small RNA-seq samples total RNA was extracted with TRI Reagent, radiolabeled and size-selected on a PAA gel.,For HeLa Ago2-IP samples lysates were clarified and Ago2-RNA complexes isolated with an antibody, Ago2-associated RNA TRI Reagent-extracted, radiolabeled and size-selected on a PAA gel.,PAR-CLIP library preparation as described in (Hafner et al. 2010; PMID: 20371350).,Small RNA libraries for HEK293 cells were constructed as described in (Hafner et al. 2008; PMID: 18158127).,For HeLa Ago2 IP-seq samples Ago2-associated RNAs were extracted and used to prepare cDNA libraries as described in (Hafner et al. 2008; PMID: 18158127). | GSM1067864 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX218959,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01893947 | GSM1067864 | GSE43666 | 0.078461 | HEK293 | Public on May 08 2013 | Jan 22 2013 | 9606 | FBL | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX218959 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01893947 |
|
1 | cell line: HEK293,antibody: Fibrillarin; mouse monoclonal; AFB01,antibody vendor: Cytoskeleton, Inc.,lot number: 011,3' adaptor: 5' TGGAATTCTCGGGTGCCAAGG 3' | Klingelbergstrasse 50-70 | Basel | Switzerland | University of Basel | Andreas,R,Gruber | The raw reads were processed on the CLIPZ server (www.clipz.unibas.ch; Khorshid et al., Nucleic Acids Research 2011, 39:D245 (PMID 21087992)).,For subsequent analyses only uniquely mapped reads were considered.,Genome_build: hg19 Feb 2009,Supplementary_files_format_and_content: bed files with genomic coordinates of reads mapped; scores represent the number of reads | PAR-CLIP samples were extracted following the PAR-CLIP method (Hafner et al. 2010; PMID: 20371350).,For HEK293 small RNA-seq samples total RNA was extracted with TRI Reagent, radiolabeled and size-selected on a PAA gel.,For HeLa Ago2-IP samples lysates were clarified and Ago2-RNA complexes isolated with an antibody, Ago2-associated RNA TRI Reagent-extracted, radiolabeled and size-selected on a PAA gel.,PAR-CLIP library preparation as described in (Hafner et al. 2010; PMID: 20371350).,Small RNA libraries for HEK293 cells were constructed as described in (Hafner et al. 2008; PMID: 18158127).,For HeLa Ago2 IP-seq samples Ago2-associated RNAs were extracted and used to prepare cDNA libraries as described in (Hafner et al. 2008; PMID: 18158127). | GSM1067865 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX218960,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01893948 | GSM1067865 | GSE43666 | 0.025758 | HEK293 | Public on May 08 2013 | Jan 22 2013 | 9606 | FBL (MNase) | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX218960 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01893948 |
|
1 | cell line: HEK293,antibody: Dyskerin; rabbit polyclonal IgG (C-15); sc-26982,antibody vendor: Santa Cruz Biotechnology,3' adaptor: 5' TGGAATTCTCGGGTGCCAAGG 3' | Klingelbergstrasse 50-70 | Basel | Switzerland | University of Basel | Andreas,R,Gruber | The raw reads were processed on the CLIPZ server (www.clipz.unibas.ch; Khorshid et al., Nucleic Acids Research 2011, 39:D245 (PMID 21087992)).,For subsequent analyses only uniquely mapped reads were considered.,Genome_build: hg19 Feb 2009,Supplementary_files_format_and_content: bed files with genomic coordinates of reads mapped; scores represent the number of reads | PAR-CLIP samples were extracted following the PAR-CLIP method (Hafner et al. 2010; PMID: 20371350).,For HEK293 small RNA-seq samples total RNA was extracted with TRI Reagent, radiolabeled and size-selected on a PAA gel.,For HeLa Ago2-IP samples lysates were clarified and Ago2-RNA complexes isolated with an antibody, Ago2-associated RNA TRI Reagent-extracted, radiolabeled and size-selected on a PAA gel.,PAR-CLIP library preparation as described in (Hafner et al. 2010; PMID: 20371350).,Small RNA libraries for HEK293 cells were constructed as described in (Hafner et al. 2008; PMID: 18158127).,For HeLa Ago2 IP-seq samples Ago2-associated RNAs were extracted and used to prepare cDNA libraries as described in (Hafner et al. 2008; PMID: 18158127). | GSM1067866 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX218961,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01893949 | GSM1067866 | GSE43666 | 0.183987 | HEK293 | Public on May 08 2013 | Jan 22 2013 | 9606 | DCK1 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX218961 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01893949 |
|
1 | cell line: HEK293,3' adaptor: 5' TGGAATTCTCGGGTGCCAAGG 3' | Klingelbergstrasse 50-70 | Basel | Switzerland | University of Basel | Andreas,R,Gruber | The raw reads were processed on the CLIPZ server (www.clipz.unibas.ch; Khorshid et al., Nucleic Acids Research 2011, 39:D245 (PMID 21087992)).,For subsequent analyses only uniquely mapped reads were considered.,Genome_build: hg19 Feb 2009,Supplementary_files_format_and_content: bed files with genomic coordinates of reads mapped; scores represent the number of reads | PAR-CLIP samples were extracted following the PAR-CLIP method (Hafner et al. 2010; PMID: 20371350).,For HEK293 small RNA-seq samples total RNA was extracted with TRI Reagent, radiolabeled and size-selected on a PAA gel.,For HeLa Ago2-IP samples lysates were clarified and Ago2-RNA complexes isolated with an antibody, Ago2-associated RNA TRI Reagent-extracted, radiolabeled and size-selected on a PAA gel.,PAR-CLIP library preparation as described in (Hafner et al. 2010; PMID: 20371350).,Small RNA libraries for HEK293 cells were constructed as described in (Hafner et al. 2008; PMID: 18158127).,For HeLa Ago2 IP-seq samples Ago2-associated RNAs were extracted and used to prepare cDNA libraries as described in (Hafner et al. 2008; PMID: 18158127). | GSM1067867 | Illumina HiSeq 2000 | May 15 2019 | size fractionation | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX218962,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01893950 | GSM1067867 | GSE43666 | 0.370807 | HEK293 | Public on May 08 2013 | Jan 22 2013 | 9606 | sdRNA-seq | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX218962 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01893950 |
|
1 | cell line: HEK293,3' adaptor: 5' TGGAATTCTCGGGTGCCAAGG 3' | Klingelbergstrasse 50-70 | Basel | Switzerland | University of Basel | Andreas,R,Gruber | The raw reads were processed on the CLIPZ server (www.clipz.unibas.ch; Khorshid et al., Nucleic Acids Research 2011, 39:D245 (PMID 21087992)).,For subsequent analyses only uniquely mapped reads were considered.,Genome_build: hg19 Feb 2009,Supplementary_files_format_and_content: bed files with genomic coordinates of reads mapped; scores represent the number of reads | PAR-CLIP samples were extracted following the PAR-CLIP method (Hafner et al. 2010; PMID: 20371350).,For HEK293 small RNA-seq samples total RNA was extracted with TRI Reagent, radiolabeled and size-selected on a PAA gel.,For HeLa Ago2-IP samples lysates were clarified and Ago2-RNA complexes isolated with an antibody, Ago2-associated RNA TRI Reagent-extracted, radiolabeled and size-selected on a PAA gel.,PAR-CLIP library preparation as described in (Hafner et al. 2010; PMID: 20371350).,Small RNA libraries for HEK293 cells were constructed as described in (Hafner et al. 2008; PMID: 18158127).,For HeLa Ago2 IP-seq samples Ago2-associated RNAs were extracted and used to prepare cDNA libraries as described in (Hafner et al. 2008; PMID: 18158127). | GSM1067868 | Illumina HiSeq 2000 | May 15 2019 | size fractionation | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX218963,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01893951 | GSM1067868 | GSE43666 | 0.160905 | HEK293 | Public on May 08 2013 | Jan 22 2013 | 9606 | sRNA-seq | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX218963 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01893951 |
|
1 | cell line: HeLa,antibody: monoclonal Ago2; 11A9,antibody vendor: From Gunter Meister; PMID:18430891,3' adaptor: 5' TGGAATTCTCGGGTGCCAAGG 3' | Klingelbergstrasse 50-70 | Basel | Switzerland | University of Basel | Andreas,R,Gruber | The raw reads were processed on the CLIPZ server (www.clipz.unibas.ch; Khorshid et al., Nucleic Acids Research 2011, 39:D245 (PMID 21087992)).,For subsequent analyses only uniquely mapped reads were considered.,Genome_build: hg19 Feb 2009,Supplementary_files_format_and_content: bed files with genomic coordinates of reads mapped; scores represent the number of reads | PAR-CLIP samples were extracted following the PAR-CLIP method (Hafner et al. 2010; PMID: 20371350).,For HEK293 small RNA-seq samples total RNA was extracted with TRI Reagent, radiolabeled and size-selected on a PAA gel.,For HeLa Ago2-IP samples lysates were clarified and Ago2-RNA complexes isolated with an antibody, Ago2-associated RNA TRI Reagent-extracted, radiolabeled and size-selected on a PAA gel.,PAR-CLIP library preparation as described in (Hafner et al. 2010; PMID: 20371350).,Small RNA libraries for HEK293 cells were constructed as described in (Hafner et al. 2008; PMID: 18158127).,For HeLa Ago2 IP-seq samples Ago2-associated RNAs were extracted and used to prepare cDNA libraries as described in (Hafner et al. 2008; PMID: 18158127). | GSM1067869 | Illumina HiSeq 2000 | May 15 2019 | size fractionation | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX218964,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01893952 | GSM1067869 | GSE43666 | 0.449273 | HeLa | Public on May 08 2013 | Jan 22 2013 | 9606 | Ago2 IP-seq (asynchronous cells) | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX218964 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01893952 |
|
1 | cell line: HeLa,antibody: monoclonal Ago2; 11A9,antibody vendor: From Gunter Meister; PMID:18430891,3' adaptor: 5' TGGAATTCTCGGGTGCCAAGG 3' | Klingelbergstrasse 50-70 | Basel | Switzerland | University of Basel | Andreas,R,Gruber | The raw reads were processed on the CLIPZ server (www.clipz.unibas.ch; Khorshid et al., Nucleic Acids Research 2011, 39:D245 (PMID 21087992)).,For subsequent analyses only uniquely mapped reads were considered.,Genome_build: hg19 Feb 2009,Supplementary_files_format_and_content: bed files with genomic coordinates of reads mapped; scores represent the number of reads | PAR-CLIP samples were extracted following the PAR-CLIP method (Hafner et al. 2010; PMID: 20371350).,For HEK293 small RNA-seq samples total RNA was extracted with TRI Reagent, radiolabeled and size-selected on a PAA gel.,For HeLa Ago2-IP samples lysates were clarified and Ago2-RNA complexes isolated with an antibody, Ago2-associated RNA TRI Reagent-extracted, radiolabeled and size-selected on a PAA gel.,PAR-CLIP library preparation as described in (Hafner et al. 2010; PMID: 20371350).,Small RNA libraries for HEK293 cells were constructed as described in (Hafner et al. 2008; PMID: 18158127).,For HeLa Ago2 IP-seq samples Ago2-associated RNAs were extracted and used to prepare cDNA libraries as described in (Hafner et al. 2008; PMID: 18158127). | GSM1067870 | Illumina HiSeq 2000 | May 15 2019 | size fractionation | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX218965,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01893953 | GSM1067870 | GSE43666 | 0.339654 | HeLa | Public on May 08 2013 | Jan 22 2013 | 9606 | Ago2 IP-seq (mitotic cells) | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX218965 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01893953 |
|
1 | cell line: MCF-7,cell type: epithelial breast cancer cells,genotype/variation: overexpression of miR-26a,transiently transfected with: miR-26a | Falmer, JMS Building | Brighton | United Kingdom | University of Sussex | Leandro,,Castellano | Basecalls performed using CASAVA version 1.4,Sequence reads were mapped to the hg19 genome assembly using Partek flow (Partek incorporated),Reads Per Kilobase of exon per Megabase of library size (RPKM) were calculated using Partek Genomic Suite (Partek Incorporated),Genome_build: hg19,Supplementary_files_format_and_content: tab-delimited text files include RPKM values for each Sample | Total RNA has been extracted using TRIzol (invitrigen). Libraries were prepared using the True-seq RNA preparation kit (Illumina) following the manufacturer instructions | GSM1069745 | Illumina HiSeq 2000 | Feb 21 2023 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX219947,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01902554 | GSM1069745 | GSE43726 | 0 | MCF-7_miR-26a | Public on Jun 30 2016 | Jan 24 2013 | 9606 | MCF-7-miR-26a_rep | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX219947 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01902554 |
|
1 | cell line: MCF-7,cell type: epithelial breast cancer cells,genotype/variation: control | Falmer, JMS Building | Brighton | United Kingdom | University of Sussex | Leandro,,Castellano | Basecalls performed using CASAVA version 1.4,Sequence reads were mapped to the hg19 genome assembly using Partek flow (Partek incorporated),Reads Per Kilobase of exon per Megabase of library size (RPKM) were calculated using Partek Genomic Suite (Partek Incorporated),Genome_build: hg19,Supplementary_files_format_and_content: tab-delimited text files include RPKM values for each Sample | Total RNA has been extracted using TRIzol (invitrigen). Libraries were prepared using the True-seq RNA preparation kit (Illumina) following the manufacturer instructions | GSM1069746 | Illumina HiSeq 2000 | Feb 21 2023 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX219948,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01902555 | GSM1069746 | GSE43726 | 0 | MCF-7_miR-nc | Public on Jun 30 2016 | Jan 24 2013 | 9606 | MCF-7-miR-nc rep | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX219948 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01902555 |
|
1 | cell line: MDA-MB-231,cell type: mesenchymal-like breast cancer cells,genotype/variation: reduced miR-26a activity,stably transfected with: miR-26a with specific sponge vector | Falmer, JMS Building | Brighton | United Kingdom | University of Sussex | Leandro,,Castellano | Basecalls performed using CASAVA version 1.4,Sequence reads were mapped to the hg19 genome assembly using Partek flow (Partek incorporated),Reads Per Kilobase of exon per Megabase of library size (RPKM) were calculated using Partek Genomic Suite (Partek Incorporated),Genome_build: hg19,Supplementary_files_format_and_content: tab-delimited text files include RPKM values for each Sample | Total RNA has been extracted using TRIzol (invitrigen). Libraries were prepared using the True-seq RNA preparation kit (Illumina) following the manufacturer instructions | GSM1069747 | Illumina HiSeq 2000 | Feb 21 2023 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX219949,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01902556 | GSM1069747 | GSE43726 | 0.003646 | MDA-MB-231_sponge-miR-26a | Public on Jun 30 2016 | Jan 24 2013 | 9606 | MDA-MB-231-sp-26a rep | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX219949 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01902556 |
|
1 | strain: C57Bl6/J,cell type: human pancreatic stellate cells,condition/treatment: primary PSCs from cancer patient | 10010 N Torrey Pines Rd | La Jolla | USA | Salk Institute | Ruth,T,Yu | Read alignment and junction mapping was accomplished using TopHat2 v2.0.4 using a 25 bp 5â segment seed for initial mapping followed by differential gene expression analysis using Cuffdiff v2.0.2 to map reads to the reference genome annotation.,BEDTools was used to generate bedGraphs from the bam files generated from TopHat2.,Bigwig files were generated from bedGraphs using the bedGraph to bigwig command from UCSC.,Genome_build: NCBI mouse build 37.2 and human build 37.2.,Supplementary_files_format_and_content: Bigwig files for UCSC browser viewing | RNA extraction was with Trizol per manufacturer's instructions. Standard Illumina RNA library construction with multiplexing | GSM1070765 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX219901,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01902509 | GSM1070765 | GSE43770 | 0 | human PSCs | Public on Oct 03 2014 | Jan 25 2013 | 9606 | PSC from PDA patient [CA2] | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX219901 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01902509 |
|
1 | strain: C57Bl6/J,cell type: human pancreatic stellate cells,condition/treatment: primary PSCs from cancer patient | 10010 N Torrey Pines Rd | La Jolla | USA | Salk Institute | Ruth,T,Yu | Read alignment and junction mapping was accomplished using TopHat2 v2.0.4 using a 25 bp 5â segment seed for initial mapping followed by differential gene expression analysis using Cuffdiff v2.0.2 to map reads to the reference genome annotation.,BEDTools was used to generate bedGraphs from the bam files generated from TopHat2.,Bigwig files were generated from bedGraphs using the bedGraph to bigwig command from UCSC.,Genome_build: NCBI mouse build 37.2 and human build 37.2.,Supplementary_files_format_and_content: Bigwig files for UCSC browser viewing | RNA extraction was with Trizol per manufacturer's instructions. Standard Illumina RNA library construction with multiplexing | GSM1070766 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX219902,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01902510 | GSM1070766 | GSE43770 | 0 | human PSCs | Public on Oct 03 2014 | Jan 25 2013 | 9606 | PSC from PDA patient [CA3] | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX219902 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01902510 |
|
1 | strain: C57Bl6/J,cell type: human pancreatic stellate cells,condition/treatment: primary PSCs from cancer patient | 10010 N Torrey Pines Rd | La Jolla | USA | Salk Institute | Ruth,T,Yu | Read alignment and junction mapping was accomplished using TopHat2 v2.0.4 using a 25 bp 5â segment seed for initial mapping followed by differential gene expression analysis using Cuffdiff v2.0.2 to map reads to the reference genome annotation.,BEDTools was used to generate bedGraphs from the bam files generated from TopHat2.,Bigwig files were generated from bedGraphs using the bedGraph to bigwig command from UCSC.,Genome_build: NCBI mouse build 37.2 and human build 37.2.,Supplementary_files_format_and_content: Bigwig files for UCSC browser viewing | RNA extraction was with Trizol per manufacturer's instructions. Standard Illumina RNA library construction with multiplexing | GSM1070767 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX219903,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01902511 | GSM1070767 | GSE43770 | 0.00074 | human PSCs | Public on Oct 03 2014 | Jan 25 2013 | 9606 | PSC from PDA patient [CA6] | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX219903 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01902511 |
|
1 | strain: C57Bl6/J,cell type: human pancreatic stellate cells,condition/treatment: primary PSCs from cancer patient | 10010 N Torrey Pines Rd | La Jolla | USA | Salk Institute | Ruth,T,Yu | Read alignment and junction mapping was accomplished using TopHat2 v2.0.4 using a 25 bp 5â segment seed for initial mapping followed by differential gene expression analysis using Cuffdiff v2.0.2 to map reads to the reference genome annotation.,BEDTools was used to generate bedGraphs from the bam files generated from TopHat2.,Bigwig files were generated from bedGraphs using the bedGraph to bigwig command from UCSC.,Genome_build: NCBI mouse build 37.2 and human build 37.2.,Supplementary_files_format_and_content: Bigwig files for UCSC browser viewing | RNA extraction was with Trizol per manufacturer's instructions. Standard Illumina RNA library construction with multiplexing | GSM1070768 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX219904,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01902512 | GSM1070768 | GSE43770 | 0.02515 | human PSCs | Public on Oct 03 2014 | Jan 25 2013 | 9606 | PSC from PDA patient [CA7] | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX219904 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01902512 |
|
1 | strain: C57Bl6/J,cell type: human pancreatic stellate cells,condition/treatment: primary PSCs from control patient | 10010 N Torrey Pines Rd | La Jolla | USA | Salk Institute | Ruth,T,Yu | Read alignment and junction mapping was accomplished using TopHat2 v2.0.4 using a 25 bp 5â segment seed for initial mapping followed by differential gene expression analysis using Cuffdiff v2.0.2 to map reads to the reference genome annotation.,BEDTools was used to generate bedGraphs from the bam files generated from TopHat2.,Bigwig files were generated from bedGraphs using the bedGraph to bigwig command from UCSC.,Genome_build: NCBI mouse build 37.2 and human build 37.2.,Supplementary_files_format_and_content: Bigwig files for UCSC browser viewing | RNA extraction was with Trizol per manufacturer's instructions. Standard Illumina RNA library construction with multiplexing | GSM1070769 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX219905,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01902513 | GSM1070769 | GSE43770 | 0 | human PSCs | Public on Oct 03 2014 | Jan 25 2013 | 9606 | PSC from non-cancer control [DI1] | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX219905 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01902513 |
|
1 | strain: C57Bl6/J,cell type: human pancreatic stellate cells,condition/treatment: primary PSCs from control patient | 10010 N Torrey Pines Rd | La Jolla | USA | Salk Institute | Ruth,T,Yu | Read alignment and junction mapping was accomplished using TopHat2 v2.0.4 using a 25 bp 5â segment seed for initial mapping followed by differential gene expression analysis using Cuffdiff v2.0.2 to map reads to the reference genome annotation.,BEDTools was used to generate bedGraphs from the bam files generated from TopHat2.,Bigwig files were generated from bedGraphs using the bedGraph to bigwig command from UCSC.,Genome_build: NCBI mouse build 37.2 and human build 37.2.,Supplementary_files_format_and_content: Bigwig files for UCSC browser viewing | RNA extraction was with Trizol per manufacturer's instructions. Standard Illumina RNA library construction with multiplexing | GSM1070770 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX219906,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01902514 | GSM1070770 | GSE43770 | 0.004734 | human PSCs | Public on Oct 03 2014 | Jan 25 2013 | 9606 | PSC from non-cancer control [DI2] | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX219906 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01902514 |
|
1 | strain: C57Bl6/J,cell type: human pancreatic stellate cells,condition/treatment: primary PSCs from control patient | 10010 N Torrey Pines Rd | La Jolla | USA | Salk Institute | Ruth,T,Yu | Read alignment and junction mapping was accomplished using TopHat2 v2.0.4 using a 25 bp 5â segment seed for initial mapping followed by differential gene expression analysis using Cuffdiff v2.0.2 to map reads to the reference genome annotation.,BEDTools was used to generate bedGraphs from the bam files generated from TopHat2.,Bigwig files were generated from bedGraphs using the bedGraph to bigwig command from UCSC.,Genome_build: NCBI mouse build 37.2 and human build 37.2.,Supplementary_files_format_and_content: Bigwig files for UCSC browser viewing | RNA extraction was with Trizol per manufacturer's instructions. Standard Illumina RNA library construction with multiplexing | GSM1070771 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX219907,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01902515 | GSM1070771 | GSE43770 | 0.013536 | human PSCs | Public on Oct 03 2014 | Jan 25 2013 | 9606 | PSC from non-cancer control [DI3] | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX219907 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01902515 |
|
1 | strain: C57Bl6/J,cell type: human pancreatic stellate cells,condition/treatment: primary PSCs from control patient | 10010 N Torrey Pines Rd | La Jolla | USA | Salk Institute | Ruth,T,Yu | Read alignment and junction mapping was accomplished using TopHat2 v2.0.4 using a 25 bp 5â segment seed for initial mapping followed by differential gene expression analysis using Cuffdiff v2.0.2 to map reads to the reference genome annotation.,BEDTools was used to generate bedGraphs from the bam files generated from TopHat2.,Bigwig files were generated from bedGraphs using the bedGraph to bigwig command from UCSC.,Genome_build: NCBI mouse build 37.2 and human build 37.2.,Supplementary_files_format_and_content: Bigwig files for UCSC browser viewing | RNA extraction was with Trizol per manufacturer's instructions. Standard Illumina RNA library construction with multiplexing | GSM1070772 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX219908,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01902516 | GSM1070772 | GSE43770 | 0.002668 | human PSCs | Public on Oct 03 2014 | Jan 25 2013 | 9606 | PSC from non-cancer control [DI4] | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX219908 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01902516 |
|
1 | strain: C57Bl6/J,cell type: human pancreatic stellate cells,condition/treatment: primary PSCs from control patient | 10010 N Torrey Pines Rd | La Jolla | USA | Salk Institute | Ruth,T,Yu | Read alignment and junction mapping was accomplished using TopHat2 v2.0.4 using a 25 bp 5â segment seed for initial mapping followed by differential gene expression analysis using Cuffdiff v2.0.2 to map reads to the reference genome annotation.,BEDTools was used to generate bedGraphs from the bam files generated from TopHat2.,Bigwig files were generated from bedGraphs using the bedGraph to bigwig command from UCSC.,Genome_build: NCBI mouse build 37.2 and human build 37.2.,Supplementary_files_format_and_content: Bigwig files for UCSC browser viewing | RNA extraction was with Trizol per manufacturer's instructions. Standard Illumina RNA library construction with multiplexing | GSM1070773 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX219909,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01902517 | GSM1070773 | GSE43770 | 0.005941 | human PSCs | Public on Oct 03 2014 | Jan 25 2013 | 9606 | PSC from non-cancer control [DI5] | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX219909 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01902517 |
|
1 | strain: C57Bl6/J,cell type: human pancreatic adenocarcinoma cell line,condition/treatment: DMEM | 10010 N Torrey Pines Rd | La Jolla | USA | Salk Institute | Ruth,T,Yu | Read alignment and junction mapping was accomplished using TopHat2 v2.0.4 using a 25 bp 5â segment seed for initial mapping followed by differential gene expression analysis using Cuffdiff v2.0.2 to map reads to the reference genome annotation.,BEDTools was used to generate bedGraphs from the bam files generated from TopHat2.,Bigwig files were generated from bedGraphs using the bedGraph to bigwig command from UCSC.,Genome_build: NCBI mouse build 37.2 and human build 37.2.,Supplementary_files_format_and_content: Bigwig files for UCSC browser viewing | RNA extraction was with Trizol per manufacturer's instructions. Standard Illumina RNA library construction with multiplexing | GSM1070774 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX219910,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01902518 | GSM1070774 | GSE43770 | 0.050225 | MiaPaCa-2 | Public on Oct 03 2014 | Jan 25 2013 | 9606 | MiaPaCa-2 cells treated with DMEM [Mia-DMEM] | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX219910 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01902518 |
|
1 | strain: C57Bl6/J,cell type: human pancreatic adenocarcinoma cell line,condition/treatment: 100nM calcipotriol | 10010 N Torrey Pines Rd | La Jolla | USA | Salk Institute | Ruth,T,Yu | Read alignment and junction mapping was accomplished using TopHat2 v2.0.4 using a 25 bp 5â segment seed for initial mapping followed by differential gene expression analysis using Cuffdiff v2.0.2 to map reads to the reference genome annotation.,BEDTools was used to generate bedGraphs from the bam files generated from TopHat2.,Bigwig files were generated from bedGraphs using the bedGraph to bigwig command from UCSC.,Genome_build: NCBI mouse build 37.2 and human build 37.2.,Supplementary_files_format_and_content: Bigwig files for UCSC browser viewing | RNA extraction was with Trizol per manufacturer's instructions. Standard Illumina RNA library construction with multiplexing | GSM1070775 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX219911,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01902519 | GSM1070775 | GSE43770 | 0.00577 | MiaPaCa-2 | Public on Oct 03 2014 | Jan 25 2013 | 9606 | MiaPaCa-2 cells treated with calcipotriol [Mia-CAL] | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX219911 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01902519 |
|
1 | strain: C57Bl6/J,cell type: human pancreatic adenocarcinoma cell line,condition/treatment: conditioned media from untreated cells | 10010 N Torrey Pines Rd | La Jolla | USA | Salk Institute | Ruth,T,Yu | Read alignment and junction mapping was accomplished using TopHat2 v2.0.4 using a 25 bp 5â segment seed for initial mapping followed by differential gene expression analysis using Cuffdiff v2.0.2 to map reads to the reference genome annotation.,BEDTools was used to generate bedGraphs from the bam files generated from TopHat2.,Bigwig files were generated from bedGraphs using the bedGraph to bigwig command from UCSC.,Genome_build: NCBI mouse build 37.2 and human build 37.2.,Supplementary_files_format_and_content: Bigwig files for UCSC browser viewing | RNA extraction was with Trizol per manufacturer's instructions. Standard Illumina RNA library construction with multiplexing | GSM1070776 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX219912,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01902520 | GSM1070776 | GSE43770 | 0.007668 | MiaPaCa-2 | Public on Oct 03 2014 | Jan 25 2013 | 9606 | MiaPaCa-2 cells treated with conditioned media [Mia-CM] | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX219912 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01902520 |
|
1 | strain: C57Bl6/J,cell type: human pancreatic adenocarcinoma cell line,condition/treatment: conditioned media from calcipotriol-treated cells | 10010 N Torrey Pines Rd | La Jolla | USA | Salk Institute | Ruth,T,Yu | Read alignment and junction mapping was accomplished using TopHat2 v2.0.4 using a 25 bp 5â segment seed for initial mapping followed by differential gene expression analysis using Cuffdiff v2.0.2 to map reads to the reference genome annotation.,BEDTools was used to generate bedGraphs from the bam files generated from TopHat2.,Bigwig files were generated from bedGraphs using the bedGraph to bigwig command from UCSC.,Genome_build: NCBI mouse build 37.2 and human build 37.2.,Supplementary_files_format_and_content: Bigwig files for UCSC browser viewing | RNA extraction was with Trizol per manufacturer's instructions. Standard Illumina RNA library construction with multiplexing | GSM1070777 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX219913,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01902521 | GSM1070777 | GSE43770 | 0.00232 | MiaPaCa-2 | Public on Oct 03 2014 | Jan 25 2013 | 9606 | MiaPaCa-2 cells treated with conditioned media [Mia-CMS] | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX219913 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01902521 |
|
1 | agent: vehicle, control,cell line: LNCaP,tissue: Prostate adenocarcinoma,type: Androgen-sensitive,chip antibody: none | 318 Campus Dr. Room S240 | Stanford | USA | Stanford University | Xun,,Lan | ChIP-exo Alignment: Sequence reads were obtained and mapped to the human (hg19) genomes using the Bowtie. All reads mapping with two or fewer mismatches were retained. Only reads with unique mapping location is used for downstream analysis.,RNA-seq process: The RNA-seq data was aligned by RUM. Paired-end reads were mapped to the reference genome build (hg19). The RPKM (Reads Per Kilobase of exon model per Million mapped reads) count was calculated with RseQC. The reads count in exon regions was used to estimate the expression level of the genes. edgeR (empirical analysis of digital gene expression in R) was applied to conduct the differential expression analysis based on the count information. The differentially expressed genes were detected by a cut-off P-value < 0.01 between DHT treated and control data.,Genome_build: hg19,Supplementary_files_format_and_content: Bowtie alignment files and four column mapped reads information files for ChIP-exo data; edgeR differential expressed gene files for RNA-seq data. | For LNCaP AR ChIP-exo, after treatment with 10 nm DHT or vehicle for 4 h, LNCaP cells were crosslinked with 1% formaldehyde for 10 min. Sonicated chromatin was enriched by immunoprecipatation with an anti-AR antibody. For tissue AR ChIP-exo, the frozen samples were trimmed and chopped into small pieces on ice, and then fixed immediately in 1% formaldehyde for 20 min at room temperature. After additional incubation with glycine for 10 min, the pellets were washed and homogenized in 1x PBS containing proteinase inhibitor. With sufficient lysis, the samples were then processed according to ChIP-exo procedures. For RNA-seq, total RNA was isolated using an RNeasy kit (QIAGEN). Next, total RNA was mixed with the Ribo-Zero rRNA removal reagents (Epicentre Biotechnologies, Madison, WI) to remove all sizes of rRNA. After two rounds of removal processes, the rRNA-depleted RNA was recovered for library generation.,For AR ChIP-exo, T4 DNA polymerase, T4 PNK, and Klenow DNA Polymerase were used together for end polishing. The ligation step was performed with less reducing agent. Protein A Dynal magnetic beads were washed using modified RIPA buffer (50mM Tris-HCL pH 7.8, 1mM EDTA, 0.25% Na Deoxycholate, 1% NP-40, 0.5M LiCl). The library was amplified with only 10 or 12 PCR cycles, and prepared without gel-based size selection. For RNA-seq, the ScriptSeq library preparation was performed with ScripSeq RNA-Seq Library Preparation kit following the manufacturerâs instructions. The di-tagged cDNA molecules were amplified by 8 cycles of PCR. Non-size selection libraries were then sequenced for pair-end using Illumina HiSeq 2000 at the OSUCCC sequencing core. | GSM1071278 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX220077,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01906559 | GSM1071278 | GSE43785,GSE43791 | 0 | LNCaP cells | Public on Jan 01 2015 | Jan 27 2013 | 9606 | LNCaP control [RNA-seq replicate 1 ] | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX220077 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01906559 |
|
1 | agent: vehicle, control,cell line: LNCaP,tissue: Prostate adenocarcinoma,type: Androgen-sensitive,chip antibody: none | 318 Campus Dr. Room S240 | Stanford | USA | Stanford University | Xun,,Lan | ChIP-exo Alignment: Sequence reads were obtained and mapped to the human (hg19) genomes using the Bowtie. All reads mapping with two or fewer mismatches were retained. Only reads with unique mapping location is used for downstream analysis.,RNA-seq process: The RNA-seq data was aligned by RUM. Paired-end reads were mapped to the reference genome build (hg19). The RPKM (Reads Per Kilobase of exon model per Million mapped reads) count was calculated with RseQC. The reads count in exon regions was used to estimate the expression level of the genes. edgeR (empirical analysis of digital gene expression in R) was applied to conduct the differential expression analysis based on the count information. The differentially expressed genes were detected by a cut-off P-value < 0.01 between DHT treated and control data.,Genome_build: hg19,Supplementary_files_format_and_content: Bowtie alignment files and four column mapped reads information files for ChIP-exo data; edgeR differential expressed gene files for RNA-seq data. | For LNCaP AR ChIP-exo, after treatment with 10 nm DHT or vehicle for 4 h, LNCaP cells were crosslinked with 1% formaldehyde for 10 min. Sonicated chromatin was enriched by immunoprecipatation with an anti-AR antibody. For tissue AR ChIP-exo, the frozen samples were trimmed and chopped into small pieces on ice, and then fixed immediately in 1% formaldehyde for 20 min at room temperature. After additional incubation with glycine for 10 min, the pellets were washed and homogenized in 1x PBS containing proteinase inhibitor. With sufficient lysis, the samples were then processed according to ChIP-exo procedures. For RNA-seq, total RNA was isolated using an RNeasy kit (QIAGEN). Next, total RNA was mixed with the Ribo-Zero rRNA removal reagents (Epicentre Biotechnologies, Madison, WI) to remove all sizes of rRNA. After two rounds of removal processes, the rRNA-depleted RNA was recovered for library generation.,For AR ChIP-exo, T4 DNA polymerase, T4 PNK, and Klenow DNA Polymerase were used together for end polishing. The ligation step was performed with less reducing agent. Protein A Dynal magnetic beads were washed using modified RIPA buffer (50mM Tris-HCL pH 7.8, 1mM EDTA, 0.25% Na Deoxycholate, 1% NP-40, 0.5M LiCl). The library was amplified with only 10 or 12 PCR cycles, and prepared without gel-based size selection. For RNA-seq, the ScriptSeq library preparation was performed with ScripSeq RNA-Seq Library Preparation kit following the manufacturerâs instructions. The di-tagged cDNA molecules were amplified by 8 cycles of PCR. Non-size selection libraries were then sequenced for pair-end using Illumina HiSeq 2000 at the OSUCCC sequencing core. | GSM1071279 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX220078,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01906560 | GSM1071279 | GSE43785,GSE43791 | 0 | LNCaP cells | Public on Jan 01 2015 | Jan 27 2013 | 9606 | LNCaP control [RNA-seq replicate 2 ] | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX220078 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01906560 |
|
1 | agent: 10 nm DHT,cell line: LNCaP,tissue: Prostate adenocarcinoma,type: Androgen-sensitive,chip antibody: none | 318 Campus Dr. Room S240 | Stanford | USA | Stanford University | Xun,,Lan | ChIP-exo Alignment: Sequence reads were obtained and mapped to the human (hg19) genomes using the Bowtie. All reads mapping with two or fewer mismatches were retained. Only reads with unique mapping location is used for downstream analysis.,RNA-seq process: The RNA-seq data was aligned by RUM. Paired-end reads were mapped to the reference genome build (hg19). The RPKM (Reads Per Kilobase of exon model per Million mapped reads) count was calculated with RseQC. The reads count in exon regions was used to estimate the expression level of the genes. edgeR (empirical analysis of digital gene expression in R) was applied to conduct the differential expression analysis based on the count information. The differentially expressed genes were detected by a cut-off P-value < 0.01 between DHT treated and control data.,Genome_build: hg19,Supplementary_files_format_and_content: Bowtie alignment files and four column mapped reads information files for ChIP-exo data; edgeR differential expressed gene files for RNA-seq data. | For LNCaP AR ChIP-exo, after treatment with 10 nm DHT or vehicle for 4 h, LNCaP cells were crosslinked with 1% formaldehyde for 10 min. Sonicated chromatin was enriched by immunoprecipatation with an anti-AR antibody. For tissue AR ChIP-exo, the frozen samples were trimmed and chopped into small pieces on ice, and then fixed immediately in 1% formaldehyde for 20 min at room temperature. After additional incubation with glycine for 10 min, the pellets were washed and homogenized in 1x PBS containing proteinase inhibitor. With sufficient lysis, the samples were then processed according to ChIP-exo procedures. For RNA-seq, total RNA was isolated using an RNeasy kit (QIAGEN). Next, total RNA was mixed with the Ribo-Zero rRNA removal reagents (Epicentre Biotechnologies, Madison, WI) to remove all sizes of rRNA. After two rounds of removal processes, the rRNA-depleted RNA was recovered for library generation.,For AR ChIP-exo, T4 DNA polymerase, T4 PNK, and Klenow DNA Polymerase were used together for end polishing. The ligation step was performed with less reducing agent. Protein A Dynal magnetic beads were washed using modified RIPA buffer (50mM Tris-HCL pH 7.8, 1mM EDTA, 0.25% Na Deoxycholate, 1% NP-40, 0.5M LiCl). The library was amplified with only 10 or 12 PCR cycles, and prepared without gel-based size selection. For RNA-seq, the ScriptSeq library preparation was performed with ScripSeq RNA-Seq Library Preparation kit following the manufacturerâs instructions. The di-tagged cDNA molecules were amplified by 8 cycles of PCR. Non-size selection libraries were then sequenced for pair-end using Illumina HiSeq 2000 at the OSUCCC sequencing core. | GSM1071282 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX220081,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01906563 | GSM1071282 | GSE43785,GSE43791 | 0 | LNCaP cells | Public on Jan 01 2015 | Jan 27 2013 | 9606 | LNCaP DHT treated [RNA-seq replicate 1 ] | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX220081 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01906563 |
|
1 | cell type: endothelial cells,passage nr.: 4-5,treatment: PR infected | 621 Charles E. Young Dr. S. | Los Angeles | USA | University of California-Los Angeles | Lauren,,Goddard | Debarcoding of the multiplex runs was performed using in house shell script,Reads were then processed and aligned to the human genome (hg19) using TopHat v2.0.4 (Trapnell et al., 2009) with default parameters.,The aligned read files were further processed with Cufflinks v2.0.1 (Trapnell et al., 2010) to calculate RPKP values. Assemblies for PR and PR+P endothelial cells were merged using CuffMerge and differential expression was determined using Cuffdiff. Genes with a p-value smaller than 0.01 where considered as differentially expressed.,Genome_build: hg19,Supplementary_files_format_and_content: tab-delimited text files include RPKM values for each Sample and Excel table final lists of differentially expressed genes | Total RNA was extracted using RNeasy Kit (Qiagen, Valencia, CA) according to manufacturer instructions.,The library for sequencing was constructed using an Illumina Multiplex System according to manufacturer's instructions (Illumina, San Diego, CA). Libraries were sequenced using HIseq-2000 (Illumina, San Diego, CA) to obtain 50 bp long reads. | GSM1071304 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX220059,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01906474 | GSM1071304 | GSE43788,GSE43789 | 0.002169 | primary HUVECs | Public on Jan 01 2014 | Jan 27 2013 | 9606 | PR_PR_infected [RNA-Seq] | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX220059 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01906474 |
|
1 | cell type: endothelial cells,passage nr.: 4-5,treatment: PR infected + Progesterone | 621 Charles E. Young Dr. S. | Los Angeles | USA | University of California-Los Angeles | Lauren,,Goddard | Debarcoding of the multiplex runs was performed using in house shell script,Reads were then processed and aligned to the human genome (hg19) using TopHat v2.0.4 (Trapnell et al., 2009) with default parameters.,The aligned read files were further processed with Cufflinks v2.0.1 (Trapnell et al., 2010) to calculate RPKP values. Assemblies for PR and PR+P endothelial cells were merged using CuffMerge and differential expression was determined using Cuffdiff. Genes with a p-value smaller than 0.01 where considered as differentially expressed.,Genome_build: hg19,Supplementary_files_format_and_content: tab-delimited text files include RPKM values for each Sample and Excel table final lists of differentially expressed genes | Total RNA was extracted using RNeasy Kit (Qiagen, Valencia, CA) according to manufacturer instructions.,The library for sequencing was constructed using an Illumina Multiplex System according to manufacturer's instructions (Illumina, San Diego, CA). Libraries were sequenced using HIseq-2000 (Illumina, San Diego, CA) to obtain 50 bp long reads. | GSM1071305 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX220060,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01906475 | GSM1071305 | GSE43788,GSE43789 | 0.003186 | primary HUVECs | Public on Jan 01 2014 | Jan 27 2013 | 9606 | PR_PR_infected+Prog [RNA-Seq] | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX220060 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01906475 |
|
1 | cell line: HEK293T | 733 N. Broadway, MRB 439 | Baltimore | USA | Johns Hopkins University | Adam,D,Ewing | Remove Adapter: cutadapt -a GATCTCGTATGCCGTCTTCTGCTTG in.fastq > out.fastq,Align to reference genome: bowtie2 -x <indexed reference> -U in.fastq -S out.sam --quiet -p 3 -D 15 -R 2 -L 20 -N 1 --rdg 20,20 --rfg 20,20,Convert SAM to BAM (samtools view -b),Select all alignments with a T-to-C change relative to the top strand,Convert BAM to pileup (samtools mpileup),Normalize pileup depth by number of aligned reads in sample,Convert mpileup output to wiggle (wig): http://genome.ucsc.edu/goldenPath/help/wiggle.html,Convert wiggle to bigWig (wigToBigWig),Genome_build: GRCh37 (UCSC hg19),Supplementary_files_format_and_content: aligned sequence depth in bigWig (.bw) format: http://genome.ucsc.edu/goldenPath/help/bigWig.html | UV-irradiated cells were lysed, treated with RNAseT1, and the RNA-protein complex was immunoprecipitated with anti-FLAG agarose beads for 1 hour at 40C. RNA was labeled with gamma ATP and the crosslinked RNA-proteins were resolved in a SDS-PAGE gel. ORF1 and HuR RNA-protein complexes were cut from the gel.,Recovered RNA was converted into cDNA libraries using a small RNA cloning protocol described in Hafner et al (Methods, 2008, doi: 10.1016/j.ymeth.2007.09.009) | GSM1071439 | Illumina HiSeq 2000 | May 15 2019 | size fractionation | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX220095,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01906582 | GSM1071439 | GSE43801 | 0.138728 | HEK293T | Public on May 21 2013 | Jan 28 2013 | 9606 | ORF1p/RNP replicate 1 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX220095 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01906582 |
|
1 | cell line: HEK293T | 733 N. Broadway, MRB 439 | Baltimore | USA | Johns Hopkins University | Adam,D,Ewing | Remove Adapter: cutadapt -a GATCTCGTATGCCGTCTTCTGCTTG in.fastq > out.fastq,Align to reference genome: bowtie2 -x <indexed reference> -U in.fastq -S out.sam --quiet -p 3 -D 15 -R 2 -L 20 -N 1 --rdg 20,20 --rfg 20,20,Convert SAM to BAM (samtools view -b),Select all alignments with a T-to-C change relative to the top strand,Convert BAM to pileup (samtools mpileup),Normalize pileup depth by number of aligned reads in sample,Convert mpileup output to wiggle (wig): http://genome.ucsc.edu/goldenPath/help/wiggle.html,Convert wiggle to bigWig (wigToBigWig),Genome_build: GRCh37 (UCSC hg19),Supplementary_files_format_and_content: aligned sequence depth in bigWig (.bw) format: http://genome.ucsc.edu/goldenPath/help/bigWig.html | UV-irradiated cells were lysed, treated with RNAseT1, and the RNA-protein complex was immunoprecipitated with anti-FLAG agarose beads for 1 hour at 40C. RNA was labeled with gamma ATP and the crosslinked RNA-proteins were resolved in a SDS-PAGE gel. ORF1 and HuR RNA-protein complexes were cut from the gel.,Recovered RNA was converted into cDNA libraries using a small RNA cloning protocol described in Hafner et al (Methods, 2008, doi: 10.1016/j.ymeth.2007.09.009) | GSM1071440 | Illumina HiSeq 2000 | May 15 2019 | size fractionation | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX220096,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01906583 | GSM1071440 | GSE43801 | 0.09 | HEK293T | Public on May 21 2013 | Jan 28 2013 | 9606 | ORF1p/RNP replicate 2 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX220096 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01906583 |
|
1 | cell line: HEK293T | 733 N. Broadway, MRB 439 | Baltimore | USA | Johns Hopkins University | Adam,D,Ewing | Remove Adapter: cutadapt -a GATCTCGTATGCCGTCTTCTGCTTG in.fastq > out.fastq,Align to reference genome: bowtie2 -x <indexed reference> -U in.fastq -S out.sam --quiet -p 3 -D 15 -R 2 -L 20 -N 1 --rdg 20,20 --rfg 20,20,Convert SAM to BAM (samtools view -b),Select all alignments with a T-to-C change relative to the top strand,Convert BAM to pileup (samtools mpileup),Normalize pileup depth by number of aligned reads in sample,Convert mpileup output to wiggle (wig): http://genome.ucsc.edu/goldenPath/help/wiggle.html,Convert wiggle to bigWig (wigToBigWig),Genome_build: GRCh37 (UCSC hg19),Supplementary_files_format_and_content: aligned sequence depth in bigWig (.bw) format: http://genome.ucsc.edu/goldenPath/help/bigWig.html | UV-irradiated cells were lysed, treated with RNAseT1, and the RNA-protein complex was immunoprecipitated with anti-FLAG agarose beads for 1 hour at 40C. RNA was labeled with gamma ATP and the crosslinked RNA-proteins were resolved in a SDS-PAGE gel. ORF1 and HuR RNA-protein complexes were cut from the gel.,Recovered RNA was converted into cDNA libraries using a small RNA cloning protocol described in Hafner et al (Methods, 2008, doi: 10.1016/j.ymeth.2007.09.009) | GSM1071441 | Illumina HiSeq 2000 | May 15 2019 | size fractionation | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX220097,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01906584 | GSM1071441 | GSE43801 | 0.087483 | HEK293T | Public on May 21 2013 | Jan 28 2013 | 9606 | ORF1p replicate 1 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX220097 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01906584 |
|
1 | cell line: HEK293T | 733 N. Broadway, MRB 439 | Baltimore | USA | Johns Hopkins University | Adam,D,Ewing | Remove Adapter: cutadapt -a GATCTCGTATGCCGTCTTCTGCTTG in.fastq > out.fastq,Align to reference genome: bowtie2 -x <indexed reference> -U in.fastq -S out.sam --quiet -p 3 -D 15 -R 2 -L 20 -N 1 --rdg 20,20 --rfg 20,20,Convert SAM to BAM (samtools view -b),Select all alignments with a T-to-C change relative to the top strand,Convert BAM to pileup (samtools mpileup),Normalize pileup depth by number of aligned reads in sample,Convert mpileup output to wiggle (wig): http://genome.ucsc.edu/goldenPath/help/wiggle.html,Convert wiggle to bigWig (wigToBigWig),Genome_build: GRCh37 (UCSC hg19),Supplementary_files_format_and_content: aligned sequence depth in bigWig (.bw) format: http://genome.ucsc.edu/goldenPath/help/bigWig.html | UV-irradiated cells were lysed, treated with RNAseT1, and the RNA-protein complex was immunoprecipitated with anti-FLAG agarose beads for 1 hour at 40C. RNA was labeled with gamma ATP and the crosslinked RNA-proteins were resolved in a SDS-PAGE gel. ORF1 and HuR RNA-protein complexes were cut from the gel.,Recovered RNA was converted into cDNA libraries using a small RNA cloning protocol described in Hafner et al (Methods, 2008, doi: 10.1016/j.ymeth.2007.09.009) | GSM1071442 | Illumina HiSeq 2000 | May 15 2019 | size fractionation | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX220098,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01906585 | GSM1071442 | GSE43801 | 0.035778 | HEK293T | Public on May 21 2013 | Jan 28 2013 | 9606 | ORF1p replicate 2 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX220098 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01906585 |
|
1 | cell line: HEK293T | 733 N. Broadway, MRB 439 | Baltimore | USA | Johns Hopkins University | Adam,D,Ewing | Remove Adapter: cutadapt -a GATCTCGTATGCCGTCTTCTGCTTG in.fastq > out.fastq,Align to reference genome: bowtie2 -x <indexed reference> -U in.fastq -S out.sam --quiet -p 3 -D 15 -R 2 -L 20 -N 1 --rdg 20,20 --rfg 20,20,Convert SAM to BAM (samtools view -b),Select all alignments with a T-to-C change relative to the top strand,Convert BAM to pileup (samtools mpileup),Normalize pileup depth by number of aligned reads in sample,Convert mpileup output to wiggle (wig): http://genome.ucsc.edu/goldenPath/help/wiggle.html,Convert wiggle to bigWig (wigToBigWig),Genome_build: GRCh37 (UCSC hg19),Supplementary_files_format_and_content: aligned sequence depth in bigWig (.bw) format: http://genome.ucsc.edu/goldenPath/help/bigWig.html | UV-irradiated cells were lysed, treated with RNAseT1, and the RNA-protein complex was immunoprecipitated with anti-FLAG agarose beads for 1 hour at 40C. RNA was labeled with gamma ATP and the crosslinked RNA-proteins were resolved in a SDS-PAGE gel. ORF1 and HuR RNA-protein complexes were cut from the gel.,Recovered RNA was converted into cDNA libraries using a small RNA cloning protocol described in Hafner et al (Methods, 2008, doi: 10.1016/j.ymeth.2007.09.009) | GSM1071443 | Illumina HiSeq 2000 | May 15 2019 | size fractionation | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX220099,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01906586 | GSM1071443 | GSE43801 | 0.333983 | HEK293T | Public on May 21 2013 | Jan 28 2013 | 9606 | HuR | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX220099 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01906586 |
|
1 | tissue: Hematopoietic,tumor stage: Acute myeloid leukemia,gene knockdown: AML1-ETO | 413 E. 69th St. BB1462 | New York | USA | Weill Cornell Medical College | Yanwen,,Jiang | Raw sequence reads were aligned with TopHat to the reference genome (hg19).,The aligned reads were processed with an in-house program to remove PCR duplicates.,The RPKM value for each gene were calculated following published methods (http://woldlab.caltech.edu/~alim/RNAseq/).,Genome_build: hg19,Supplementary_files_format_and_content: tab-delimited text files include RPKM values for each Sample | RNA was extracted with TRIzol Reagent according to the manufacturerâs protocol (Invitrogen). One μg of total RNA was treated with DNase I (Qiagen), purified and tested for integrity on the Agilent 2100 Bioanalyzer (Agilent Technologies).,Libraries were generated using the TruSeq RNA Sample Preparation Kit (Illumina). Briefly, mRNA was selected by using magnetic polydT beads and then fragmented. First-strand synthesis was performed using Superscipt II (Invitrogen). After second-strand synthesis a paired-end library was prepared following the Illumina protocol including end-repair, A-tailing, adaptor ligation, and library enrichment. Final products were verified using the Agilent 2100 Bioanalyzer. Each library was loaded onto an Illimina pair-end flowcell at a concentation of 7.5 pM (one library per lane), and sequenced for 50 cycles at each end with Illumina HiSeq2000. | GSM1071852 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX220340,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01906646 | GSM1071852 | GSE43834 | 0.115602 | Kasumi-1 cells | Public on Jun 20 2013 | Jan 28 2013 | 9606 | shAML1-ETO | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX220340 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01906646 |
|
1 | tissue: Hematopoietic,tumor stage: Acute myeloid leukemia,gene knockdown: E2A/TCF3 | 413 E. 69th St. BB1462 | New York | USA | Weill Cornell Medical College | Yanwen,,Jiang | Raw sequence reads were aligned with TopHat to the reference genome (hg19).,The aligned reads were processed with an in-house program to remove PCR duplicates.,The RPKM value for each gene were calculated following published methods (http://woldlab.caltech.edu/~alim/RNAseq/).,Genome_build: hg19,Supplementary_files_format_and_content: tab-delimited text files include RPKM values for each Sample | RNA was extracted with TRIzol Reagent according to the manufacturerâs protocol (Invitrogen). One μg of total RNA was treated with DNase I (Qiagen), purified and tested for integrity on the Agilent 2100 Bioanalyzer (Agilent Technologies).,Libraries were generated using the TruSeq RNA Sample Preparation Kit (Illumina). Briefly, mRNA was selected by using magnetic polydT beads and then fragmented. First-strand synthesis was performed using Superscipt II (Invitrogen). After second-strand synthesis a paired-end library was prepared following the Illumina protocol including end-repair, A-tailing, adaptor ligation, and library enrichment. Final products were verified using the Agilent 2100 Bioanalyzer. Each library was loaded onto an Illimina pair-end flowcell at a concentation of 7.5 pM (one library per lane), and sequenced for 50 cycles at each end with Illumina HiSeq2000. | GSM1071853 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX220341,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01906647 | GSM1071853 | GSE43834 | 0.094786 | Kasumi-1 cells | Public on Jun 20 2013 | Jan 28 2013 | 9606 | shE2A | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX220341 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01906647 |
|
1 | tissue: Hematopoietic,tumor stage: Acute myeloid leukemia,gene knockdown: LYL1 | 413 E. 69th St. BB1462 | New York | USA | Weill Cornell Medical College | Yanwen,,Jiang | Raw sequence reads were aligned with TopHat to the reference genome (hg19).,The aligned reads were processed with an in-house program to remove PCR duplicates.,The RPKM value for each gene were calculated following published methods (http://woldlab.caltech.edu/~alim/RNAseq/).,Genome_build: hg19,Supplementary_files_format_and_content: tab-delimited text files include RPKM values for each Sample | RNA was extracted with TRIzol Reagent according to the manufacturerâs protocol (Invitrogen). One μg of total RNA was treated with DNase I (Qiagen), purified and tested for integrity on the Agilent 2100 Bioanalyzer (Agilent Technologies).,Libraries were generated using the TruSeq RNA Sample Preparation Kit (Illumina). Briefly, mRNA was selected by using magnetic polydT beads and then fragmented. First-strand synthesis was performed using Superscipt II (Invitrogen). After second-strand synthesis a paired-end library was prepared following the Illumina protocol including end-repair, A-tailing, adaptor ligation, and library enrichment. Final products were verified using the Agilent 2100 Bioanalyzer. Each library was loaded onto an Illimina pair-end flowcell at a concentation of 7.5 pM (one library per lane), and sequenced for 50 cycles at each end with Illumina HiSeq2000. | GSM1071854 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX220342,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01906648 | GSM1071854 | GSE43834 | 0.168244 | Kasumi-1 cells | Public on Jun 20 2013 | Jan 28 2013 | 9606 | shLYL1 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX220342 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01906648 |
|
1 | tissue: Hematopoietic,tumor stage: Acute myeloid leukemia,gene knockdown: none | 413 E. 69th St. BB1462 | New York | USA | Weill Cornell Medical College | Yanwen,,Jiang | Raw sequence reads were aligned with TopHat to the reference genome (hg19).,The aligned reads were processed with an in-house program to remove PCR duplicates.,The RPKM value for each gene were calculated following published methods (http://woldlab.caltech.edu/~alim/RNAseq/).,Genome_build: hg19,Supplementary_files_format_and_content: tab-delimited text files include RPKM values for each Sample | RNA was extracted with TRIzol Reagent according to the manufacturerâs protocol (Invitrogen). One μg of total RNA was treated with DNase I (Qiagen), purified and tested for integrity on the Agilent 2100 Bioanalyzer (Agilent Technologies).,Libraries were generated using the TruSeq RNA Sample Preparation Kit (Illumina). Briefly, mRNA was selected by using magnetic polydT beads and then fragmented. First-strand synthesis was performed using Superscipt II (Invitrogen). After second-strand synthesis a paired-end library was prepared following the Illumina protocol including end-repair, A-tailing, adaptor ligation, and library enrichment. Final products were verified using the Agilent 2100 Bioanalyzer. Each library was loaded onto an Illimina pair-end flowcell at a concentation of 7.5 pM (one library per lane), and sequenced for 50 cycles at each end with Illumina HiSeq2000. | GSM1071857 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX220345,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01906651 | GSM1071857 | GSE43834 | 0.13653 | Kasumi-1 cells | Public on Jun 20 2013 | Jan 28 2013 | 9606 | shControl for shAML1-ETO, shE2A, shLYL1, shLDB1 and shLMO2 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX220345 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01906651 |
|
1 | tissue: Hematopoietic,tumor stage: Acute myeloid leukemia,gene knockdown: none | 413 E. 69th St. BB1462 | New York | USA | Weill Cornell Medical College | Yanwen,,Jiang | Raw sequence reads were aligned with TopHat to the reference genome (hg19).,The aligned reads were processed with an in-house program to remove PCR duplicates.,The RPKM value for each gene were calculated following published methods (http://woldlab.caltech.edu/~alim/RNAseq/).,Genome_build: hg19,Supplementary_files_format_and_content: tab-delimited text files include RPKM values for each Sample | RNA was extracted with TRIzol Reagent according to the manufacturerâs protocol (Invitrogen). One μg of total RNA was treated with DNase I (Qiagen), purified and tested for integrity on the Agilent 2100 Bioanalyzer (Agilent Technologies).,Libraries were generated using the TruSeq RNA Sample Preparation Kit (Illumina). Briefly, mRNA was selected by using magnetic polydT beads and then fragmented. First-strand synthesis was performed using Superscipt II (Invitrogen). After second-strand synthesis a paired-end library was prepared following the Illumina protocol including end-repair, A-tailing, adaptor ligation, and library enrichment. Final products were verified using the Agilent 2100 Bioanalyzer. Each library was loaded onto an Illimina pair-end flowcell at a concentation of 7.5 pM (one library per lane), and sequenced for 50 cycles at each end with Illumina HiSeq2000. | GSM1071859 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX220347,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01906653 | GSM1071859 | GSE43834 | 0.160072 | Kasumi-1 cells | Public on Jun 20 2013 | Jan 28 2013 | 9606 | shControl for shHEB | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX220347 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01906653 |
|
1 | tissue: Hematopoietic,tumor stage: Acute myeloid leukemia,gene knockdown: HEB/TCF12 and E2A/TCF3 | 413 E. 69th St. BB1462 | New York | USA | Weill Cornell Medical College | Yanwen,,Jiang | Raw sequence reads were aligned with TopHat to the reference genome (hg19).,The aligned reads were processed with an in-house program to remove PCR duplicates.,The RPKM value for each gene were calculated following published methods (http://woldlab.caltech.edu/~alim/RNAseq/).,Genome_build: hg19,Supplementary_files_format_and_content: tab-delimited text files include RPKM values for each Sample | RNA was extracted with TRIzol Reagent according to the manufacturerâs protocol (Invitrogen). One μg of total RNA was treated with DNase I (Qiagen), purified and tested for integrity on the Agilent 2100 Bioanalyzer (Agilent Technologies).,Libraries were generated using the TruSeq RNA Sample Preparation Kit (Illumina). Briefly, mRNA was selected by using magnetic polydT beads and then fragmented. First-strand synthesis was performed using Superscipt II (Invitrogen). After second-strand synthesis a paired-end library was prepared following the Illumina protocol including end-repair, A-tailing, adaptor ligation, and library enrichment. Final products were verified using the Agilent 2100 Bioanalyzer. Each library was loaded onto an Illimina pair-end flowcell at a concentation of 7.5 pM (one library per lane), and sequenced for 50 cycles at each end with Illumina HiSeq2000. | GSM1071860 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX220348,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01906654 | GSM1071860 | GSE43834 | 0.108568 | Kasumi-1 cells | Public on Jun 20 2013 | Jan 28 2013 | 9606 | shHEB+shE2A | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX220348 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01906654 |
|
1 | cell type: Human umbilical vein endothelial cell,passages: 15 | O&N I Herestraat 49 - bus 913 | Leuven | Belgium | KU Leuven | Marc,,Jacquemin | Basecalls performed using CASAVA version 1.8.2,RNA-seq reads were aligned to the hg19 genome assembly using TopHat version 2.0.6 with default settings,The abundance data was generated with cufflinks v.2.0.2 using the tool cuffcompare.,Genome_build: hg19 (NCBI Homo sapiens build 37.2),Supplementary_files_format_and_content: the tmap files (output of cufflinks) with abundance measurements. | To prepare cell extracts, the cells were pelleted by centrifugation and immediately lysed in variable amounts of CelLytic M cell lysis reagent (lysis buffer; Sigma-Aldrich) containing 1x protease inhibitor (Halt Protease inhibitor Single-use Cocktail; Thermo Scientific; Belgium) for 15 minutes on ice followed by 5 minutes centrifugation at 18,000g (13,000 rpm) at 4°C to remove the debris. The lysate was then used for further analysis.,Libraries were prepared according to Illumina's instructions accompanying the TruSeq RNA Sample Preparation Kits v2 RS-122-2001 | GSM1076106 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX221669,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01908941 | GSM1076106 | GSE43984 | 0.010782 | HUVEC | Public on Jan 01 2015 | Feb 01 2013 | 9606 | HUVEC | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX221669 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01908941 |
|
1 | cell type: hepatocyte,passages: 0 | O&N I Herestraat 49 - bus 913 | Leuven | Belgium | KU Leuven | Marc,,Jacquemin | Basecalls performed using CASAVA version 1.8.2,RNA-seq reads were aligned to the hg19 genome assembly using TopHat version 2.0.6 with default settings,The abundance data was generated with cufflinks v.2.0.2 using the tool cuffcompare.,Genome_build: hg19 (NCBI Homo sapiens build 37.2),Supplementary_files_format_and_content: the tmap files (output of cufflinks) with abundance measurements. | To prepare cell extracts, the cells were pelleted by centrifugation and immediately lysed in variable amounts of CelLytic M cell lysis reagent (lysis buffer; Sigma-Aldrich) containing 1x protease inhibitor (Halt Protease inhibitor Single-use Cocktail; Thermo Scientific; Belgium) for 15 minutes on ice followed by 5 minutes centrifugation at 18,000g (13,000 rpm) at 4°C to remove the debris. The lysate was then used for further analysis.,Libraries were prepared according to Illumina's instructions accompanying the TruSeq RNA Sample Preparation Kits v2 RS-122-2001 | GSM1076107 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX221670,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01908942 | GSM1076107 | GSE43984 | 0.008775 | hepatocyte | Public on Jan 01 2015 | Feb 01 2013 | 9606 | Hepatocyte | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX221670 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01908942 |
|
1 | cell type: Liver sinusoidal endothelial cells,passages: 0 | O&N I Herestraat 49 - bus 913 | Leuven | Belgium | KU Leuven | Marc,,Jacquemin | Basecalls performed using CASAVA version 1.8.2,RNA-seq reads were aligned to the hg19 genome assembly using TopHat version 2.0.6 with default settings,The abundance data was generated with cufflinks v.2.0.2 using the tool cuffcompare.,Genome_build: hg19 (NCBI Homo sapiens build 37.2),Supplementary_files_format_and_content: the tmap files (output of cufflinks) with abundance measurements. | To prepare cell extracts, the cells were pelleted by centrifugation and immediately lysed in variable amounts of CelLytic M cell lysis reagent (lysis buffer; Sigma-Aldrich) containing 1x protease inhibitor (Halt Protease inhibitor Single-use Cocktail; Thermo Scientific; Belgium) for 15 minutes on ice followed by 5 minutes centrifugation at 18,000g (13,000 rpm) at 4°C to remove the debris. The lysate was then used for further analysis.,Libraries were prepared according to Illumina's instructions accompanying the TruSeq RNA Sample Preparation Kits v2 RS-122-2001 | GSM1076108 | Illumina HiSeq 2000 | Aug 10 2020 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | Reanalyzed by: GSE156009,SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX221671,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01908943 | GSM1076108 | GSE43984 | 0 | LSEC | Public on Jan 01 2015 | Feb 01 2013 | 9606 | LSEC | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX221671 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01908943 |
|
1 | cell line: human erythroleukemia cell line, HEL,genotype/variation: KAP1 KD,activation: not activated | Station 15 | Lausanne | Switzerland | EPFL | Adamandia,,Kapopoulou | Raw reads were mapped to the mouse genome and human transcriptome using Bowtie,Peaks were called using MACS,RPKM values were calculated using R/Bioconductor,Genome_build: hg19 (human),Supplementary_files_format_and_content: .txt file include RPKM values for each Sample (linked as supplementary file on Series record) | RNA was extracted using TZrizol according to Manufacturer protocol.,The library was generated from 250 ng total RNA using the TruSeq RNA Sample Preparation Kit v2, | GSM1077428 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX225203,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01911262 | GSM1077428 | GSE44061,GSE44065 | 0.000626 | HEL cells | Public on Apr 03 2013 | Feb 05 2013 | 9606 | RNA-seq:KAP1 KD not activated | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX225203 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01911262 |
|
1 | cell line: human erythroleukemia cell line, HEL,genotype/variation: KAP1 WT,activation: not activated | Station 15 | Lausanne | Switzerland | EPFL | Adamandia,,Kapopoulou | Raw reads were mapped to the mouse genome and human transcriptome using Bowtie,Peaks were called using MACS,RPKM values were calculated using R/Bioconductor,Genome_build: hg19 (human),Supplementary_files_format_and_content: .txt file include RPKM values for each Sample (linked as supplementary file on Series record) | RNA was extracted using TZrizol according to Manufacturer protocol.,The library was generated from 250 ng total RNA using the TruSeq RNA Sample Preparation Kit v2, | GSM1077430 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX225205,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01911264 | GSM1077430 | GSE44061,GSE44065 | 0.001791 | HEL cells | Public on Apr 03 2013 | Feb 05 2013 | 9606 | RNA-seq:KAP1 WT not activated | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX225205 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01911264 |
|
1 | cell line: human erythroleukemia cell line, HEL,genotype/variation: KAP1 WT,activation: hemin | Station 15 | Lausanne | Switzerland | EPFL | Adamandia,,Kapopoulou | Raw reads were mapped to the mouse genome and human transcriptome using Bowtie,Peaks were called using MACS,RPKM values were calculated using R/Bioconductor,Genome_build: hg19 (human),Supplementary_files_format_and_content: .txt file include RPKM values for each Sample (linked as supplementary file on Series record) | RNA was extracted using TZrizol according to Manufacturer protocol.,The library was generated from 250 ng total RNA using the TruSeq RNA Sample Preparation Kit v2, | GSM1077431 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX225206,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01911265 | GSM1077431 | GSE44061,GSE44065 | 0.001749 | HEL cells | Public on Apr 03 2013 | Feb 05 2013 | 9606 | RNA-seq:KAP1 WT activated | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX225206 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01911265 |
|
1 | cell line: HEK293T RAD21cv | 10010 N. Torrey Pines Rd. | La Jolla | USA | Salk Institute for Biological Studies | Jesse,R,Dixon | fastq: Illumina's HiSeq Control Software,Hi-C reads were aligned as single end reads using BWA with default parameters. Uniquely mapping reads were manually paired using in an in house pipeline. PCR duplicate reads were removed using Picard MarkDuplicates.,RNA-seq data were mapped as paired-end reads using tophat with the following parameters: -g 1 -p 12 --solexa1.3-quals --library-type fr-firststrand --segment-length 25 --bowtie1,RNA-seq bigWig files were generated through an in house pipeline that includes performing trimmed mean of M (TMM) normalization (Robinson et al. Genome Biology 2010),ChIP-seq data were mapping with bowtie using the following parameters: -v 3 -m 1 --best --strata -S --time -p 8. Data was filtered for uniquely mapping reads. PCR duplicates were removed using Picard MarkDuplicates,ChIP-seq bigWig files were generated through an in house pipeline,Genome_build: hg18,Supplementary_files_format_and_content: ChIP-seq and RNA-seq processed files are in bigWig format. As the RNA-seq experiment was strand specific, bigWig files for both the positive and negative strands are included,Supplementary_files_format_and_content: Hi-C processed files are in a modified bed format. Each row lists the chromosome and the start and end coordiates of two interacting bins as well as the normalized interaction frequency between these two bins,Supplementary_files_format_and_content: Processed mRNA-seq data include information for each gene and its count and rpkm values. Each line includes chromosome, start position, end position, strand, gene name, read counts, and rpkm values,Genome Build:,TEV1.pos.norm.bw: hg18,TEV1.neg.norm.bw: hg18,TEV_r1.rpkm: hg18 | Total RNA was extract using Trizol (Invitrogen) according to manufacturer's instructions. polyA RNA was isolated using Dynalbeads mRNA purification kit (Invitrogen) according to the manufacturer's instructions.,Strand Specific libraries were constructed according to Parkhomchuk et al. 2009, Nucleic Acids Res | GSM1081534 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | polyA RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX235600,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01919645 | GSM1081534 | GSE44267 | 0.089735 | mRNA-seq, RAD21cv HEK293, TEV treated | Public on Dec 16 2013 | Feb 12 2013 | 9606 | mRNA-seq, RAD21cv HEK293, TEV treated, replicate one | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX235600 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01919645 |
|
1 | cell line: HEK293T RAD21cv | 10010 N. Torrey Pines Rd. | La Jolla | USA | Salk Institute for Biological Studies | Jesse,R,Dixon | fastq: Illumina's HiSeq Control Software,Hi-C reads were aligned as single end reads using BWA with default parameters. Uniquely mapping reads were manually paired using in an in house pipeline. PCR duplicate reads were removed using Picard MarkDuplicates.,RNA-seq data were mapped as paired-end reads using tophat with the following parameters: -g 1 -p 12 --solexa1.3-quals --library-type fr-firststrand --segment-length 25 --bowtie1,RNA-seq bigWig files were generated through an in house pipeline that includes performing trimmed mean of M (TMM) normalization (Robinson et al. Genome Biology 2010),ChIP-seq data were mapping with bowtie using the following parameters: -v 3 -m 1 --best --strata -S --time -p 8. Data was filtered for uniquely mapping reads. PCR duplicates were removed using Picard MarkDuplicates,ChIP-seq bigWig files were generated through an in house pipeline,Genome_build: hg18,Supplementary_files_format_and_content: ChIP-seq and RNA-seq processed files are in bigWig format. As the RNA-seq experiment was strand specific, bigWig files for both the positive and negative strands are included,Supplementary_files_format_and_content: Hi-C processed files are in a modified bed format. Each row lists the chromosome and the start and end coordiates of two interacting bins as well as the normalized interaction frequency between these two bins,Supplementary_files_format_and_content: Processed mRNA-seq data include information for each gene and its count and rpkm values. Each line includes chromosome, start position, end position, strand, gene name, read counts, and rpkm values,Genome Build:,TEV2.pos.norm.bw: hg18,TEV2.neg.norm.bw: hg18,TEV_r2.rpkm: hg18 | Total RNA was extract using Trizol (Invitrogen) according to manufacturer's instructions. polyA RNA was isolated using Dynalbeads mRNA purification kit (Invitrogen) according to the manufacturer's instructions.,Strand Specific libraries were constructed according to Parkhomchuk et al. 2009, Nucleic Acids Res | GSM1081535 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | polyA RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX235601,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01919646 | GSM1081535 | GSE44267 | 0.050678 | mRNA-seq, RAD21cv HEK293, TEV treated | Public on Dec 16 2013 | Feb 12 2013 | 9606 | mRNA-seq, RAD21cv HEK293, TEV treated, replicate two | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX235601 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01919646 |
|
1 | cell line: HEK293T RAD21cv | 10010 N. Torrey Pines Rd. | La Jolla | USA | Salk Institute for Biological Studies | Jesse,R,Dixon | fastq: Illumina's HiSeq Control Software,Hi-C reads were aligned as single end reads using BWA with default parameters. Uniquely mapping reads were manually paired using in an in house pipeline. PCR duplicate reads were removed using Picard MarkDuplicates.,RNA-seq data were mapped as paired-end reads using tophat with the following parameters: -g 1 -p 12 --solexa1.3-quals --library-type fr-firststrand --segment-length 25 --bowtie1,RNA-seq bigWig files were generated through an in house pipeline that includes performing trimmed mean of M (TMM) normalization (Robinson et al. Genome Biology 2010),ChIP-seq data were mapping with bowtie using the following parameters: -v 3 -m 1 --best --strata -S --time -p 8. Data was filtered for uniquely mapping reads. PCR duplicates were removed using Picard MarkDuplicates,ChIP-seq bigWig files were generated through an in house pipeline,Genome_build: hg18,Supplementary_files_format_and_content: ChIP-seq and RNA-seq processed files are in bigWig format. As the RNA-seq experiment was strand specific, bigWig files for both the positive and negative strands are included,Supplementary_files_format_and_content: Hi-C processed files are in a modified bed format. Each row lists the chromosome and the start and end coordiates of two interacting bins as well as the normalized interaction frequency between these two bins,Supplementary_files_format_and_content: Processed mRNA-seq data include information for each gene and its count and rpkm values. Each line includes chromosome, start position, end position, strand, gene name, read counts, and rpkm values,Genome Build:,HRV1.pos.norm.bw: hg18,HRV1.neg.norm.bw: hg18,HRV_r1.rpkm: hg18 | Total RNA was extract using Trizol (Invitrogen) according to manufacturer's instructions. polyA RNA was isolated using Dynalbeads mRNA purification kit (Invitrogen) according to the manufacturer's instructions.,Strand Specific libraries were constructed according to Parkhomchuk et al. 2009, Nucleic Acids Res | GSM1081536 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | polyA RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX235602,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01919647 | GSM1081536 | GSE44267 | 0.080603 | mRNA-seq, RAD21cv HEK293, HRV treated | Public on Dec 16 2013 | Feb 12 2013 | 9606 | mRNA-seq, RAD21cv HEK293, HRV treated, replicate one | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX235602 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01919647 |
|
1 | cell line: HEK293T RAD21cv | 10010 N. Torrey Pines Rd. | La Jolla | USA | Salk Institute for Biological Studies | Jesse,R,Dixon | fastq: Illumina's HiSeq Control Software,Hi-C reads were aligned as single end reads using BWA with default parameters. Uniquely mapping reads were manually paired using in an in house pipeline. PCR duplicate reads were removed using Picard MarkDuplicates.,RNA-seq data were mapped as paired-end reads using tophat with the following parameters: -g 1 -p 12 --solexa1.3-quals --library-type fr-firststrand --segment-length 25 --bowtie1,RNA-seq bigWig files were generated through an in house pipeline that includes performing trimmed mean of M (TMM) normalization (Robinson et al. Genome Biology 2010),ChIP-seq data were mapping with bowtie using the following parameters: -v 3 -m 1 --best --strata -S --time -p 8. Data was filtered for uniquely mapping reads. PCR duplicates were removed using Picard MarkDuplicates,ChIP-seq bigWig files were generated through an in house pipeline,Genome_build: hg18,Supplementary_files_format_and_content: ChIP-seq and RNA-seq processed files are in bigWig format. As the RNA-seq experiment was strand specific, bigWig files for both the positive and negative strands are included,Supplementary_files_format_and_content: Hi-C processed files are in a modified bed format. Each row lists the chromosome and the start and end coordiates of two interacting bins as well as the normalized interaction frequency between these two bins,Supplementary_files_format_and_content: Processed mRNA-seq data include information for each gene and its count and rpkm values. Each line includes chromosome, start position, end position, strand, gene name, read counts, and rpkm values,Genome Build:,HRV2.pos.norm.bw: hg18,HRV2.neg.norm.bw: hg18,HRV_r2.rpkm: hg18 | Total RNA was extract using Trizol (Invitrogen) according to manufacturer's instructions. polyA RNA was isolated using Dynalbeads mRNA purification kit (Invitrogen) according to the manufacturer's instructions.,Strand Specific libraries were constructed according to Parkhomchuk et al. 2009, Nucleic Acids Res | GSM1081537 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | polyA RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX235603,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01919648 | GSM1081537 | GSE44267 | 0.062986 | mRNA-seq, RAD21cv HEK293, HRV treated | Public on Dec 16 2013 | Feb 12 2013 | 9606 | mRNA-seq, RAD21cv HEK293, HRV treated, replicate two | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX235603 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01919648 |
|
1 | cell line: HEK293T | 10010 N. Torrey Pines Rd. | La Jolla | USA | Salk Institute for Biological Studies | Jesse,R,Dixon | fastq: Illumina's HiSeq Control Software,Hi-C reads were aligned as single end reads using BWA with default parameters. Uniquely mapping reads were manually paired using in an in house pipeline. PCR duplicate reads were removed using Picard MarkDuplicates.,RNA-seq data were mapped as paired-end reads using tophat with the following parameters: -g 1 -p 12 --solexa1.3-quals --library-type fr-firststrand --segment-length 25 --bowtie1,RNA-seq bigWig files were generated through an in house pipeline that includes performing trimmed mean of M (TMM) normalization (Robinson et al. Genome Biology 2010),ChIP-seq data were mapping with bowtie using the following parameters: -v 3 -m 1 --best --strata -S --time -p 8. Data was filtered for uniquely mapping reads. PCR duplicates were removed using Picard MarkDuplicates,ChIP-seq bigWig files were generated through an in house pipeline,Genome_build: hg18,Supplementary_files_format_and_content: ChIP-seq and RNA-seq processed files are in bigWig format. As the RNA-seq experiment was strand specific, bigWig files for both the positive and negative strands are included,Supplementary_files_format_and_content: Hi-C processed files are in a modified bed format. Each row lists the chromosome and the start and end coordiates of two interacting bins as well as the normalized interaction frequency between these two bins,Supplementary_files_format_and_content: Processed mRNA-seq data include information for each gene and its count and rpkm values. Each line includes chromosome, start position, end position, strand, gene name, read counts, and rpkm values,Genome Build:,CONTROL2.pos.norm.bw: hg18,CONTROL2.neg.norm.bw: hg18,CTRL_r2.rpkm: hg18 | Total RNA was extract using Trizol (Invitrogen) according to manufacturer's instructions. polyA RNA was isolated using Dynalbeads mRNA purification kit (Invitrogen) according to the manufacturer's instructions.,Strand Specific libraries were constructed according to Parkhomchuk et al. 2009, Nucleic Acids Res | GSM1081539 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | polyA RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX235605,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01919650 | GSM1081539 | GSE44267 | 0.006061 | mRNA-seq, HEK293 siRNA Control | Public on Dec 16 2013 | Feb 12 2013 | 9606 | mRNA-seq, HEK293 siRNA Control, replicate two | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX235605 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01919650 |
|
1 | cell line: HEK293T | 10010 N. Torrey Pines Rd. | La Jolla | USA | Salk Institute for Biological Studies | Jesse,R,Dixon | fastq: Illumina's HiSeq Control Software,Hi-C reads were aligned as single end reads using BWA with default parameters. Uniquely mapping reads were manually paired using in an in house pipeline. PCR duplicate reads were removed using Picard MarkDuplicates.,RNA-seq data were mapped as paired-end reads using tophat with the following parameters: -g 1 -p 12 --solexa1.3-quals --library-type fr-firststrand --segment-length 25 --bowtie1,RNA-seq bigWig files were generated through an in house pipeline that includes performing trimmed mean of M (TMM) normalization (Robinson et al. Genome Biology 2010),ChIP-seq data were mapping with bowtie using the following parameters: -v 3 -m 1 --best --strata -S --time -p 8. Data was filtered for uniquely mapping reads. PCR duplicates were removed using Picard MarkDuplicates,ChIP-seq bigWig files were generated through an in house pipeline,Genome_build: hg18,Supplementary_files_format_and_content: ChIP-seq and RNA-seq processed files are in bigWig format. As the RNA-seq experiment was strand specific, bigWig files for both the positive and negative strands are included,Supplementary_files_format_and_content: Hi-C processed files are in a modified bed format. Each row lists the chromosome and the start and end coordiates of two interacting bins as well as the normalized interaction frequency between these two bins,Supplementary_files_format_and_content: Processed mRNA-seq data include information for each gene and its count and rpkm values. Each line includes chromosome, start position, end position, strand, gene name, read counts, and rpkm values,Genome Build:,CTCF2.pos.norm.bw: hg18,CTCF2.neg.norm.bw: hg18,CTCF_r2.rpkm: hg18 | Total RNA was extract using Trizol (Invitrogen) according to manufacturer's instructions. polyA RNA was isolated using Dynalbeads mRNA purification kit (Invitrogen) according to the manufacturer's instructions.,Strand Specific libraries were constructed according to Parkhomchuk et al. 2009, Nucleic Acids Res | GSM1081541 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | polyA RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX235607,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01919652 | GSM1081541 | GSE44267 | 0.008364 | mRNA-seq, HEK293 siRNA CTCF | Public on Dec 16 2013 | Feb 12 2013 | 9606 | mRNA-seq, HEK293 siRNA CTCF, replicate two | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX235607 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01919652 |
|
1 | treatment: no treatment (control),cell line: 293S | 900 University Ave | Riverside | USA | UC Riverside | Fedor,,Karginov | Basecalling with Illumina RTA 1.13.48,Reads were processed as for RNA-seq in subseries1-3, with an added initial mapping step to the ERCC spike-in sequences. ERCC scaling factors were calculated by linear regression of length-corrected counts for each ERCC RNA between samples. Non-ERCC reads were then mapped further as above. Exonic read counts were collapsed by gene, filtered for genes with 10 or more counts across all fractions for each condition (+/- arsenite), normalized to ERCC scaling factors, and further normalized to a total abundance of 1 across all fractions within a condition.,hg19,tab-delimited text file containing, per gene, normalized abundances in sucrose gradient fractions +/- arsenite, and the center-of-mass (COM) and COM shift upon arsenite | Trizol and NSR method | GSM1084088 | Illumina HiSeq 1000 | Mar 04 2023 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL15433 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX241878,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01922235 | GSM1084088 | GSE44379,GSE44404 | 0 | 293S cells | Public on Jul 15 2013 | Feb 18 2013 | 9606 | RNAseq_Sucrose_Gradient_noarsenite_fraction1 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX241878 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01922235 |
|
1 | treatment: no treatment (control),cell line: 293S | 900 University Ave | Riverside | USA | UC Riverside | Fedor,,Karginov | Basecalling with Illumina RTA 1.13.48,Reads were processed as for RNA-seq in subseries1-3, with an added initial mapping step to the ERCC spike-in sequences. ERCC scaling factors were calculated by linear regression of length-corrected counts for each ERCC RNA between samples. Non-ERCC reads were then mapped further as above. Exonic read counts were collapsed by gene, filtered for genes with 10 or more counts across all fractions for each condition (+/- arsenite), normalized to ERCC scaling factors, and further normalized to a total abundance of 1 across all fractions within a condition.,hg19,tab-delimited text file containing, per gene, normalized abundances in sucrose gradient fractions +/- arsenite, and the center-of-mass (COM) and COM shift upon arsenite | Trizol and NSR method | GSM1084089 | Illumina HiSeq 1000 | Mar 04 2023 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL15433 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX241879,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01922236 | GSM1084089 | GSE44379,GSE44404 | 0.014775 | 293S cells | Public on Jul 15 2013 | Feb 18 2013 | 9606 | RNAseq_Sucrose_Gradient_noarsenite_fraction2 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX241879 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01922236 |
|
1 | treatment: no treatment (control),cell line: 293S | 900 University Ave | Riverside | USA | UC Riverside | Fedor,,Karginov | Basecalling with Illumina RTA 1.13.48,Reads were processed as for RNA-seq in subseries1-3, with an added initial mapping step to the ERCC spike-in sequences. ERCC scaling factors were calculated by linear regression of length-corrected counts for each ERCC RNA between samples. Non-ERCC reads were then mapped further as above. Exonic read counts were collapsed by gene, filtered for genes with 10 or more counts across all fractions for each condition (+/- arsenite), normalized to ERCC scaling factors, and further normalized to a total abundance of 1 across all fractions within a condition.,hg19,tab-delimited text file containing, per gene, normalized abundances in sucrose gradient fractions +/- arsenite, and the center-of-mass (COM) and COM shift upon arsenite | Trizol and NSR method | GSM1084090 | Illumina HiSeq 1000 | Mar 04 2023 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL15433 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX241880,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01922237 | GSM1084090 | GSE44379,GSE44404 | 0.013656 | 293S cells | Public on Jul 15 2013 | Feb 18 2013 | 9606 | RNAseq_Sucrose_Gradient_noarsenite_fraction3 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX241880 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01922237 |
|
1 | treatment: no treatment (control),cell line: 293S | 900 University Ave | Riverside | USA | UC Riverside | Fedor,,Karginov | Basecalling with Illumina RTA 1.13.48,Reads were processed as for RNA-seq in subseries1-3, with an added initial mapping step to the ERCC spike-in sequences. ERCC scaling factors were calculated by linear regression of length-corrected counts for each ERCC RNA between samples. Non-ERCC reads were then mapped further as above. Exonic read counts were collapsed by gene, filtered for genes with 10 or more counts across all fractions for each condition (+/- arsenite), normalized to ERCC scaling factors, and further normalized to a total abundance of 1 across all fractions within a condition.,hg19,tab-delimited text file containing, per gene, normalized abundances in sucrose gradient fractions +/- arsenite, and the center-of-mass (COM) and COM shift upon arsenite | Trizol and NSR method | GSM1084091 | Illumina HiSeq 1000 | Mar 04 2023 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL15433 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX241881,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01922238 | GSM1084091 | GSE44379,GSE44404 | 0.143255 | 293S cells | Public on Jul 15 2013 | Feb 18 2013 | 9606 | RNAseq_Sucrose_Gradient_noarsenite_fraction4 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX241881 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01922238 |
|
1 | treatment: no treatment (control),cell line: 293S | 900 University Ave | Riverside | USA | UC Riverside | Fedor,,Karginov | Basecalling with Illumina RTA 1.13.48,Reads were processed as for RNA-seq in subseries1-3, with an added initial mapping step to the ERCC spike-in sequences. ERCC scaling factors were calculated by linear regression of length-corrected counts for each ERCC RNA between samples. Non-ERCC reads were then mapped further as above. Exonic read counts were collapsed by gene, filtered for genes with 10 or more counts across all fractions for each condition (+/- arsenite), normalized to ERCC scaling factors, and further normalized to a total abundance of 1 across all fractions within a condition.,hg19,tab-delimited text file containing, per gene, normalized abundances in sucrose gradient fractions +/- arsenite, and the center-of-mass (COM) and COM shift upon arsenite | Trizol and NSR method | GSM1084092 | Illumina HiSeq 1000 | Mar 04 2023 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL15433 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX241882,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01922239 | GSM1084092 | GSE44379,GSE44404 | 0.177496 | 293S cells | Public on Jul 15 2013 | Feb 18 2013 | 9606 | RNAseq_Sucrose_Gradient_noarsenite_fraction5 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX241882 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01922239 |
|
1 | treatment: no treatment (control),cell line: 293S | 900 University Ave | Riverside | USA | UC Riverside | Fedor,,Karginov | Basecalling with Illumina RTA 1.13.48,Reads were processed as for RNA-seq in subseries1-3, with an added initial mapping step to the ERCC spike-in sequences. ERCC scaling factors were calculated by linear regression of length-corrected counts for each ERCC RNA between samples. Non-ERCC reads were then mapped further as above. Exonic read counts were collapsed by gene, filtered for genes with 10 or more counts across all fractions for each condition (+/- arsenite), normalized to ERCC scaling factors, and further normalized to a total abundance of 1 across all fractions within a condition.,hg19,tab-delimited text file containing, per gene, normalized abundances in sucrose gradient fractions +/- arsenite, and the center-of-mass (COM) and COM shift upon arsenite | Trizol and NSR method | GSM1084093 | Illumina HiSeq 1000 | Mar 04 2023 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL15433 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX241883,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01922240 | GSM1084093 | GSE44379,GSE44404 | 0.073835 | 293S cells | Public on Jul 15 2013 | Feb 18 2013 | 9606 | RNAseq_Sucrose_Gradient_noarsenite_fraction6 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX241883 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01922240 |
|
1 | treatment: no treatment (control),cell line: 293S | 900 University Ave | Riverside | USA | UC Riverside | Fedor,,Karginov | Basecalling with Illumina RTA 1.13.48,Reads were processed as for RNA-seq in subseries1-3, with an added initial mapping step to the ERCC spike-in sequences. ERCC scaling factors were calculated by linear regression of length-corrected counts for each ERCC RNA between samples. Non-ERCC reads were then mapped further as above. Exonic read counts were collapsed by gene, filtered for genes with 10 or more counts across all fractions for each condition (+/- arsenite), normalized to ERCC scaling factors, and further normalized to a total abundance of 1 across all fractions within a condition.,hg19,tab-delimited text file containing, per gene, normalized abundances in sucrose gradient fractions +/- arsenite, and the center-of-mass (COM) and COM shift upon arsenite | Trizol and NSR method | GSM1084094 | Illumina HiSeq 1000 | Mar 04 2023 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL15433 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX241884,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01922241 | GSM1084094 | GSE44379,GSE44404 | 0 | 293S cells | Public on Jul 15 2013 | Feb 18 2013 | 9606 | RNAseq_Sucrose_Gradient_noarsenite_fraction7 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX241884 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01922241 |
|
1 | treatment: no treatment (control),cell line: 293S | 900 University Ave | Riverside | USA | UC Riverside | Fedor,,Karginov | Basecalling with Illumina RTA 1.13.48,Reads were processed as for RNA-seq in subseries1-3, with an added initial mapping step to the ERCC spike-in sequences. ERCC scaling factors were calculated by linear regression of length-corrected counts for each ERCC RNA between samples. Non-ERCC reads were then mapped further as above. Exonic read counts were collapsed by gene, filtered for genes with 10 or more counts across all fractions for each condition (+/- arsenite), normalized to ERCC scaling factors, and further normalized to a total abundance of 1 across all fractions within a condition.,hg19,tab-delimited text file containing, per gene, normalized abundances in sucrose gradient fractions +/- arsenite, and the center-of-mass (COM) and COM shift upon arsenite | Trizol and NSR method | GSM1084095 | Illumina HiSeq 1000 | Mar 04 2023 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL15433 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX241885,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01922242 | GSM1084095 | GSE44379,GSE44404 | 0.061803 | 293S cells | Public on Jul 15 2013 | Feb 18 2013 | 9606 | RNAseq_Sucrose_Gradient_noarsenite_fraction8 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX241885 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01922242 |
|
1 | treatment: arsenite,cell line: 293S | 900 University Ave | Riverside | USA | UC Riverside | Fedor,,Karginov | Basecalling with Illumina RTA 1.13.48,Reads were processed as for RNA-seq in subseries1-3, with an added initial mapping step to the ERCC spike-in sequences. ERCC scaling factors were calculated by linear regression of length-corrected counts for each ERCC RNA between samples. Non-ERCC reads were then mapped further as above. Exonic read counts were collapsed by gene, filtered for genes with 10 or more counts across all fractions for each condition (+/- arsenite), normalized to ERCC scaling factors, and further normalized to a total abundance of 1 across all fractions within a condition.,hg19,tab-delimited text file containing, per gene, normalized abundances in sucrose gradient fractions +/- arsenite, and the center-of-mass (COM) and COM shift upon arsenite | Trizol and NSR method | GSM1084096 | Illumina HiSeq 1000 | Mar 04 2023 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL15433 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX241886,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01922243 | GSM1084096 | GSE44379,GSE44404 | 0.158314 | 293S cells | Public on Jul 15 2013 | Feb 18 2013 | 9606 | RNAseq_Sucrose_Gradient_arsenite_fraction1 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX241886 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01922243 |
|
1 | treatment: arsenite,cell line: 293S | 900 University Ave | Riverside | USA | UC Riverside | Fedor,,Karginov | Basecalling with Illumina RTA 1.13.48,Reads were processed as for RNA-seq in subseries1-3, with an added initial mapping step to the ERCC spike-in sequences. ERCC scaling factors were calculated by linear regression of length-corrected counts for each ERCC RNA between samples. Non-ERCC reads were then mapped further as above. Exonic read counts were collapsed by gene, filtered for genes with 10 or more counts across all fractions for each condition (+/- arsenite), normalized to ERCC scaling factors, and further normalized to a total abundance of 1 across all fractions within a condition.,hg19,tab-delimited text file containing, per gene, normalized abundances in sucrose gradient fractions +/- arsenite, and the center-of-mass (COM) and COM shift upon arsenite | Trizol and NSR method | GSM1084097 | Illumina HiSeq 1000 | Mar 04 2023 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL15433 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX241887,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01922244 | GSM1084097 | GSE44379,GSE44404 | 0.046501 | 293S cells | Public on Jul 15 2013 | Feb 18 2013 | 9606 | RNAseq_Sucrose_Gradient_arsenite_fraction2 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX241887 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01922244 |
|
1 | treatment: arsenite,cell line: 293S | 900 University Ave | Riverside | USA | UC Riverside | Fedor,,Karginov | Basecalling with Illumina RTA 1.13.48,Reads were processed as for RNA-seq in subseries1-3, with an added initial mapping step to the ERCC spike-in sequences. ERCC scaling factors were calculated by linear regression of length-corrected counts for each ERCC RNA between samples. Non-ERCC reads were then mapped further as above. Exonic read counts were collapsed by gene, filtered for genes with 10 or more counts across all fractions for each condition (+/- arsenite), normalized to ERCC scaling factors, and further normalized to a total abundance of 1 across all fractions within a condition.,hg19,tab-delimited text file containing, per gene, normalized abundances in sucrose gradient fractions +/- arsenite, and the center-of-mass (COM) and COM shift upon arsenite | Trizol and NSR method | GSM1084098 | Illumina HiSeq 1000 | Mar 04 2023 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL15433 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX241888,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01922245 | GSM1084098 | GSE44379,GSE44404 | 0.027334 | 293S cells | Public on Jul 15 2013 | Feb 18 2013 | 9606 | RNAseq_Sucrose_Gradient_arsenite_fraction3 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX241888 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01922245 |
|
1 | treatment: arsenite,cell line: 293S | 900 University Ave | Riverside | USA | UC Riverside | Fedor,,Karginov | Basecalling with Illumina RTA 1.13.48,Reads were processed as for RNA-seq in subseries1-3, with an added initial mapping step to the ERCC spike-in sequences. ERCC scaling factors were calculated by linear regression of length-corrected counts for each ERCC RNA between samples. Non-ERCC reads were then mapped further as above. Exonic read counts were collapsed by gene, filtered for genes with 10 or more counts across all fractions for each condition (+/- arsenite), normalized to ERCC scaling factors, and further normalized to a total abundance of 1 across all fractions within a condition.,hg19,tab-delimited text file containing, per gene, normalized abundances in sucrose gradient fractions +/- arsenite, and the center-of-mass (COM) and COM shift upon arsenite | Trizol and NSR method | GSM1084099 | Illumina HiSeq 1000 | Mar 04 2023 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL15433 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX241889,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01922246 | GSM1084099 | GSE44379,GSE44404 | 0.063947 | 293S cells | Public on Jul 15 2013 | Feb 18 2013 | 9606 | RNAseq_Sucrose_Gradient_arsenite_fraction4 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX241889 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01922246 |
|
1 | treatment: arsenite,cell line: 293S | 900 University Ave | Riverside | USA | UC Riverside | Fedor,,Karginov | Basecalling with Illumina RTA 1.13.48,Reads were processed as for RNA-seq in subseries1-3, with an added initial mapping step to the ERCC spike-in sequences. ERCC scaling factors were calculated by linear regression of length-corrected counts for each ERCC RNA between samples. Non-ERCC reads were then mapped further as above. Exonic read counts were collapsed by gene, filtered for genes with 10 or more counts across all fractions for each condition (+/- arsenite), normalized to ERCC scaling factors, and further normalized to a total abundance of 1 across all fractions within a condition.,hg19,tab-delimited text file containing, per gene, normalized abundances in sucrose gradient fractions +/- arsenite, and the center-of-mass (COM) and COM shift upon arsenite | Trizol and NSR method | GSM1084100 | Illumina HiSeq 1000 | Mar 04 2023 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL15433 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX241890,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01922247 | GSM1084100 | GSE44379,GSE44404 | 0.036147 | 293S cells | Public on Jul 15 2013 | Feb 18 2013 | 9606 | RNAseq_Sucrose_Gradient_arsenite_fraction5 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX241890 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01922247 |
|
1 | treatment: arsenite,cell line: 293S | 900 University Ave | Riverside | USA | UC Riverside | Fedor,,Karginov | Basecalling with Illumina RTA 1.13.48,Reads were processed as for RNA-seq in subseries1-3, with an added initial mapping step to the ERCC spike-in sequences. ERCC scaling factors were calculated by linear regression of length-corrected counts for each ERCC RNA between samples. Non-ERCC reads were then mapped further as above. Exonic read counts were collapsed by gene, filtered for genes with 10 or more counts across all fractions for each condition (+/- arsenite), normalized to ERCC scaling factors, and further normalized to a total abundance of 1 across all fractions within a condition.,hg19,tab-delimited text file containing, per gene, normalized abundances in sucrose gradient fractions +/- arsenite, and the center-of-mass (COM) and COM shift upon arsenite | Trizol and NSR method | GSM1084101 | Illumina HiSeq 1000 | Mar 04 2023 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL15433 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX241891,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01922248 | GSM1084101 | GSE44379,GSE44404 | 0.084679 | 293S cells | Public on Jul 15 2013 | Feb 18 2013 | 9606 | RNAseq_Sucrose_Gradient_arsenite_fraction6 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX241891 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01922248 |
|
1 | treatment: arsenite,cell line: 293S | 900 University Ave | Riverside | USA | UC Riverside | Fedor,,Karginov | Basecalling with Illumina RTA 1.13.48,Reads were processed as for RNA-seq in subseries1-3, with an added initial mapping step to the ERCC spike-in sequences. ERCC scaling factors were calculated by linear regression of length-corrected counts for each ERCC RNA between samples. Non-ERCC reads were then mapped further as above. Exonic read counts were collapsed by gene, filtered for genes with 10 or more counts across all fractions for each condition (+/- arsenite), normalized to ERCC scaling factors, and further normalized to a total abundance of 1 across all fractions within a condition.,hg19,tab-delimited text file containing, per gene, normalized abundances in sucrose gradient fractions +/- arsenite, and the center-of-mass (COM) and COM shift upon arsenite | Trizol and NSR method | GSM1084102 | Illumina HiSeq 1000 | Mar 04 2023 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL15433 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX241892,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01922249 | GSM1084102 | GSE44379,GSE44404 | 0.067478 | 293S cells | Public on Jul 15 2013 | Feb 18 2013 | 9606 | RNAseq_Sucrose_Gradient_arsenite_fraction7 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX241892 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01922249 |
|
1 | treatment: arsenite,cell line: 293S | 900 University Ave | Riverside | USA | UC Riverside | Fedor,,Karginov | Basecalling with Illumina RTA 1.13.48,Reads were processed as for RNA-seq in subseries1-3, with an added initial mapping step to the ERCC spike-in sequences. ERCC scaling factors were calculated by linear regression of length-corrected counts for each ERCC RNA between samples. Non-ERCC reads were then mapped further as above. Exonic read counts were collapsed by gene, filtered for genes with 10 or more counts across all fractions for each condition (+/- arsenite), normalized to ERCC scaling factors, and further normalized to a total abundance of 1 across all fractions within a condition.,hg19,tab-delimited text file containing, per gene, normalized abundances in sucrose gradient fractions +/- arsenite, and the center-of-mass (COM) and COM shift upon arsenite | Trizol and NSR method | GSM1084103 | Illumina HiSeq 1000 | Mar 04 2023 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL15433 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX241893,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01922250 | GSM1084103 | GSE44379,GSE44404 | 0.065461 | 293S cells | Public on Jul 15 2013 | Feb 18 2013 | 9606 | RNAseq_Sucrose_Gradient_arsenite_fraction8 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX241893 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01922250 |
|
1 | cell line: MRC-5,cell type: human fetal lung fibroblast Cell | NO. 7 Beitucheng West Road | Beijing | China | Beijing Institute of Genomics | Zechen,,Chong | ChIP-seq reads were aligned to the hg19 genome assembly using BWA version 0.5.9-r16,Peaks were called using MACS version 1.4.2 with default parameter,We aligned those high quality reads to the masked Homo sapiens reference genome (hg19) genome and junction sequences using BWA 0.5.8 software allowing up to four mismatches. All the uniquely mapped reads were used to define gene expression level based on our developed method. We modified the RPKM (measured in reads per kilobase of exon per million mapped sequence reads, which is a normalized measure of exonic read density) calculation described by Mortazavi and colleagues to include junction fragments. By including reads that map to junction fragments, we ensure that genes with many introns are not under represented in the RPKM estimate. To examine differential expression, we used a MARS (MA-plot-based method with Random Sampling model) method to identify differentially expressed genes which described in DEGseq. For each gene, the P-value and Q-value were computed, and the fold changes were also calculated. Those genes with p < 0.001 and q-value < 0.05 were defined as DEGs.,Genome_build: hg19,Supplementary_files_format_and_content: The files are generated by MACS version 1.4.2, including chr, start, end, length, summit, tags, -10*log10(pvalue),fold_enrichment. The file of differitially expressed genes includes Gene, GeneNames, value1, value2, log2(Fold_change), log2(Fold_change) normalized, z-score, p-value, q-value(Benjamini et al. 1995), q-value(Storey et al. 2003), Signature(p-value < 0.001). | Total RNA was isolated from TCBQ/DMSO treated MRC-5 cells using RNAzol (Molecular Research Center, Inc.),Poly(A) RNA from 1 ug of total RNA was used to generate the cDNA library according to TruSeq RNA Sample Prep Kit protocol which was then sequenced using the Illumina system. | GSM1085706 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | polyA RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX243745,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01923907 | GSM1085706 | GSE44457 | 0.03255 | MRC-5_transcriptome_TCBQ | Public on Dec 05 2013 | Feb 21 2013 | 9606 | transcriptome_TCBQ | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX243745 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01923907 |
|
1 | cell line: MRC-5,cell type: human fetal lung fibroblast Cell | NO. 7 Beitucheng West Road | Beijing | China | Beijing Institute of Genomics | Zechen,,Chong | ChIP-seq reads were aligned to the hg19 genome assembly using BWA version 0.5.9-r16,Peaks were called using MACS version 1.4.2 with default parameter,We aligned those high quality reads to the masked Homo sapiens reference genome (hg19) genome and junction sequences using BWA 0.5.8 software allowing up to four mismatches. All the uniquely mapped reads were used to define gene expression level based on our developed method. We modified the RPKM (measured in reads per kilobase of exon per million mapped sequence reads, which is a normalized measure of exonic read density) calculation described by Mortazavi and colleagues to include junction fragments. By including reads that map to junction fragments, we ensure that genes with many introns are not under represented in the RPKM estimate. To examine differential expression, we used a MARS (MA-plot-based method with Random Sampling model) method to identify differentially expressed genes which described in DEGseq. For each gene, the P-value and Q-value were computed, and the fold changes were also calculated. Those genes with p < 0.001 and q-value < 0.05 were defined as DEGs.,Genome_build: hg19,Supplementary_files_format_and_content: The files are generated by MACS version 1.4.2, including chr, start, end, length, summit, tags, -10*log10(pvalue),fold_enrichment. The file of differitially expressed genes includes Gene, GeneNames, value1, value2, log2(Fold_change), log2(Fold_change) normalized, z-score, p-value, q-value(Benjamini et al. 1995), q-value(Storey et al. 2003), Signature(p-value < 0.001). | Total RNA was isolated from TCBQ/DMSO treated MRC-5 cells using RNAzol (Molecular Research Center, Inc.),Poly(A) RNA from 1 ug of total RNA was used to generate the cDNA library according to TruSeq RNA Sample Prep Kit protocol which was then sequenced using the Illumina system. | GSM1085707 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | polyA RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX243746,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01923908 | GSM1085707 | GSE44457 | 0 | MRC-5_transcriptome_DMSO | Public on Dec 05 2013 | Feb 21 2013 | 9606 | transcriptome_DMSO | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX243746 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01923908 |
|
1 | cell type: in vitro cultured primary coronary artery smooth muscle cells,transfection: non-silencing control siRNA | 3400 Civic Center Blvd | Philadelphia | USA | University of Pennsylvania | Sylvia,T,Nurnberg | alignment: tophat,alignment: bowtie,transcript assembly: cufflinks,differential assembly: cuffdiff,genome build: Hg19 male,processed data files format and content: bed | Total RNA from cultured HCASMCs was obtained by direct lysis using the QIAGEN miRNeasy Mini Kit (Qiagen #217004) according to manufacturerâs instructions.,Total RNA of 3 samples each either siTCF21 or siControl treated samples was depleted for ribosomal RNA with the Ribo-Zero magnetic kit from epicentre (Illumina #MRZH116), libraries generated with the epicentre ScriptSeq v2 RNA-Seq library preparation kit (Illumina #SSV21106).,Libraries were sequenced as 100bp paired-end reads on an Illumina HiSeq 2000 instrument. | GSM1085736 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX243750,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01923909 | GSM1085736 | GSE44461 | 0.005068 | in vitro cultured primary coronary artery smooth muscle cells | Public on Mar 19 2015 | Feb 21 2013 | 9606 | non-silencing control siRNA technical replicate 1 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX243750 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01923909 |
|
1 | cell type: in vitro cultured primary coronary artery smooth muscle cells,transfection: non-silencing control siRNA | 3400 Civic Center Blvd | Philadelphia | USA | University of Pennsylvania | Sylvia,T,Nurnberg | alignment: tophat,alignment: bowtie,transcript assembly: cufflinks,differential assembly: cuffdiff,genome build: Hg19 male,processed data files format and content: bed | Total RNA from cultured HCASMCs was obtained by direct lysis using the QIAGEN miRNeasy Mini Kit (Qiagen #217004) according to manufacturerâs instructions.,Total RNA of 3 samples each either siTCF21 or siControl treated samples was depleted for ribosomal RNA with the Ribo-Zero magnetic kit from epicentre (Illumina #MRZH116), libraries generated with the epicentre ScriptSeq v2 RNA-Seq library preparation kit (Illumina #SSV21106).,Libraries were sequenced as 100bp paired-end reads on an Illumina HiSeq 2000 instrument. | GSM1085737 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX243751,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01923910 | GSM1085737 | GSE44461 | 0.003387 | in vitro cultured primary coronary artery smooth muscle cells | Public on Mar 19 2015 | Feb 21 2013 | 9606 | non-silencing control siRNA technical replicate 2 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX243751 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01923910 |
|
1 | cell type: in vitro cultured primary coronary artery smooth muscle cells,transfection: non-silencing control siRNA | 3400 Civic Center Blvd | Philadelphia | USA | University of Pennsylvania | Sylvia,T,Nurnberg | alignment: tophat,alignment: bowtie,transcript assembly: cufflinks,differential assembly: cuffdiff,genome build: Hg19 male,processed data files format and content: bed | Total RNA from cultured HCASMCs was obtained by direct lysis using the QIAGEN miRNeasy Mini Kit (Qiagen #217004) according to manufacturerâs instructions.,Total RNA of 3 samples each either siTCF21 or siControl treated samples was depleted for ribosomal RNA with the Ribo-Zero magnetic kit from epicentre (Illumina #MRZH116), libraries generated with the epicentre ScriptSeq v2 RNA-Seq library preparation kit (Illumina #SSV21106).,Libraries were sequenced as 100bp paired-end reads on an Illumina HiSeq 2000 instrument. | GSM1085738 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX243752,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01923911 | GSM1085738 | GSE44461 | 0.003007 | in vitro cultured primary coronary artery smooth muscle cells | Public on Mar 19 2015 | Feb 21 2013 | 9606 | non-silencing control siRNA technical replicate 3 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX243752 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01923911 |
|
1 | cell type: in vitro cultured primary coronary artery smooth muscle cells,transfection: TCF21 knockdown siRNA | 3400 Civic Center Blvd | Philadelphia | USA | University of Pennsylvania | Sylvia,T,Nurnberg | alignment: tophat,alignment: bowtie,transcript assembly: cufflinks,differential assembly: cuffdiff,genome build: Hg19 male,processed data files format and content: bed | Total RNA from cultured HCASMCs was obtained by direct lysis using the QIAGEN miRNeasy Mini Kit (Qiagen #217004) according to manufacturerâs instructions.,Total RNA of 3 samples each either siTCF21 or siControl treated samples was depleted for ribosomal RNA with the Ribo-Zero magnetic kit from epicentre (Illumina #MRZH116), libraries generated with the epicentre ScriptSeq v2 RNA-Seq library preparation kit (Illumina #SSV21106).,Libraries were sequenced as 100bp paired-end reads on an Illumina HiSeq 2000 instrument. | GSM1085739 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX243753,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01923912 | GSM1085739 | GSE44461 | 0.003921 | in vitro cultured primary coronary artery smooth muscle cells | Public on Mar 19 2015 | Feb 21 2013 | 9606 | TCF21 knockdown siRNA technical replicate 1 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX243753 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01923912 |
|
1 | cell type: in vitro cultured primary coronary artery smooth muscle cells,transfection: TCF21 knockdown siRNA | 3400 Civic Center Blvd | Philadelphia | USA | University of Pennsylvania | Sylvia,T,Nurnberg | alignment: tophat,alignment: bowtie,transcript assembly: cufflinks,differential assembly: cuffdiff,genome build: Hg19 male,processed data files format and content: bed | Total RNA from cultured HCASMCs was obtained by direct lysis using the QIAGEN miRNeasy Mini Kit (Qiagen #217004) according to manufacturerâs instructions.,Total RNA of 3 samples each either siTCF21 or siControl treated samples was depleted for ribosomal RNA with the Ribo-Zero magnetic kit from epicentre (Illumina #MRZH116), libraries generated with the epicentre ScriptSeq v2 RNA-Seq library preparation kit (Illumina #SSV21106).,Libraries were sequenced as 100bp paired-end reads on an Illumina HiSeq 2000 instrument. | GSM1085740 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX243754,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01923913 | GSM1085740 | GSE44461 | 0.003023 | in vitro cultured primary coronary artery smooth muscle cells | Public on Mar 19 2015 | Feb 21 2013 | 9606 | TCF21 knockdown siRNA technical replicate 2 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX243754 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01923913 |
|
1 | cell type: in vitro cultured primary coronary artery smooth muscle cells,transfection: TCF21 knockdown siRNA | 3400 Civic Center Blvd | Philadelphia | USA | University of Pennsylvania | Sylvia,T,Nurnberg | alignment: tophat,alignment: bowtie,transcript assembly: cufflinks,differential assembly: cuffdiff,genome build: Hg19 male,processed data files format and content: bed | Total RNA from cultured HCASMCs was obtained by direct lysis using the QIAGEN miRNeasy Mini Kit (Qiagen #217004) according to manufacturerâs instructions.,Total RNA of 3 samples each either siTCF21 or siControl treated samples was depleted for ribosomal RNA with the Ribo-Zero magnetic kit from epicentre (Illumina #MRZH116), libraries generated with the epicentre ScriptSeq v2 RNA-Seq library preparation kit (Illumina #SSV21106).,Libraries were sequenced as 100bp paired-end reads on an Illumina HiSeq 2000 instrument. | GSM1085741 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX243755,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01923914 | GSM1085741 | GSE44461 | 0.003387 | in vitro cultured primary coronary artery smooth muscle cells | Public on Mar 19 2015 | Feb 21 2013 | 9606 | TCF21 knockdown siRNA technical replicate 3 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX243755 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01923914 |
|
1 | cell line: HEK293 | 1230 York Ave Box 186 | New York | USA | The Rockefeller University | Miguel,,Brown | Reads are assigned to their respective samples using custom perl scripts. Requirements are that the barcode in its entirety must be found, and the first 5 nt of the 3' adapter sequence allowing for one error (mismatch, indel). Reads ranging from 19-15 nt are analyzed,Mapping against the human genome release hg19 and custom non-coding (ncRNA) RNA database is performed using BWA version 0.5.9, with paramters "-n 2 -t 12" against the ncRNA database, "-n 1 -t 12" against the human genome,Cutsom scripts are used to assign reads first by assigning reads by lowest error maping error, then by hierarchy accounting for relative biological abundance of ncRNA species as well as enrichment of 5'-p 3'-OH small RNA cDNA cloned according to protocol outlined above.,Genome_build: hg19, custom annotation database containing genbank defined ncRNAs and in-house miRNA definitions,Supplementary_files_format_and_content: first column contains the read with barcode and adapter removed, the second the read count, the third the annotated miRNA name or non-coding RNA type if applicable | TRizol extraction according to the manufacturer's protocol,small RNA cDNA library according to Hafner et al, Methods, 2012, and Hafner et al., RNA, 2011 | GSM1087024 | Illumina HiSeq 2000 | May 15 2019 | size fractionation | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX245348,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01924683 | GSM1087024 | GSE44568,GSE44616 | 0.3539 | HEK 293 cells inducibly expressing FLAG/HA tagged LIN28B; transgene expression not induced; mock transfected; replicate 2 | Public on Feb 26 2013 | Feb 22 2013 | 9606 | LIN28B_not_induced_rep2 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX245348 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01924683 |
|
1 | cell line: HEK293 | 1230 York Ave Box 186 | New York | USA | The Rockefeller University | Miguel,,Brown | Reads are assigned to their respective samples using custom perl scripts. Requirements are that the barcode in its entirety must be found, and the first 5 nt of the 3' adapter sequence allowing for one error (mismatch, indel). Reads ranging from 19-15 nt are analyzed,Mapping against the human genome release hg19 and custom non-coding (ncRNA) RNA database is performed using BWA version 0.5.9, with paramters "-n 2 -t 12" against the ncRNA database, "-n 1 -t 12" against the human genome,Cutsom scripts are used to assign reads first by assigning reads by lowest error maping error, then by hierarchy accounting for relative biological abundance of ncRNA species as well as enrichment of 5'-p 3'-OH small RNA cDNA cloned according to protocol outlined above.,Genome_build: hg19, custom annotation database containing genbank defined ncRNAs and in-house miRNA definitions,Supplementary_files_format_and_content: first column contains the read with barcode and adapter removed, the second the read count, the third the annotated miRNA name or non-coding RNA type if applicable | TRizol extraction according to the manufacturer's protocol,small RNA cDNA library according to Hafner et al, Methods, 2012, and Hafner et al., RNA, 2011 | GSM1087025 | Illumina HiSeq 2000 | May 15 2019 | size fractionation | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX245349,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01924684 | GSM1087025 | GSE44568,GSE44616 | 0.261906 | HEK 293 cells expressing FLAG/HA tagged LIN28B; transgene expression induced; mock transfected; replicate 1 | Public on Feb 26 2013 | Feb 22 2013 | 9606 | LIN28B_induced_rep1 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX245349 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01924684 |
|
1 | cell line: HEK293 | 1230 York Ave Box 186 | New York | USA | The Rockefeller University | Miguel,,Brown | Reads are assigned to their respective samples using custom perl scripts. Requirements are that the barcode in its entirety must be found, and the first 5 nt of the 3' adapter sequence allowing for one error (mismatch, indel). Reads ranging from 19-15 nt are analyzed,Mapping against the human genome release hg19 and custom non-coding (ncRNA) RNA database is performed using BWA version 0.5.9, with paramters "-n 2 -t 12" against the ncRNA database, "-n 1 -t 12" against the human genome,Cutsom scripts are used to assign reads first by assigning reads by lowest error maping error, then by hierarchy accounting for relative biological abundance of ncRNA species as well as enrichment of 5'-p 3'-OH small RNA cDNA cloned according to protocol outlined above.,Genome_build: hg19, custom annotation database containing genbank defined ncRNAs and in-house miRNA definitions,Supplementary_files_format_and_content: first column contains the read with barcode and adapter removed, the second the read count, the third the annotated miRNA name or non-coding RNA type if applicable | TRizol extraction according to the manufacturer's protocol,small RNA cDNA library according to Hafner et al, Methods, 2012, and Hafner et al., RNA, 2011 | GSM1087026 | Illumina HiSeq 2000 | May 15 2019 | size fractionation | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX245350,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01924685 | GSM1087026 | GSE44568,GSE44616 | 0.3539 | HEK 293 cells expressing FLAG/HA tagged LIN28B; transgene expression induced; mock transfected; replicate 2 | Public on Feb 26 2013 | Feb 22 2013 | 9606 | LIN28B_induced_rep2 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX245350 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01924685 |
|
1 | cell line: HEK293 | 1230 York Ave Box 186 | New York | USA | The Rockefeller University | Miguel,,Brown | Reads are assigned to their respective samples using custom perl scripts. Requirements are that the barcode in its entirety must be found, and the first 5 nt of the 3' adapter sequence allowing for one error (mismatch, indel). Reads ranging from 19-15 nt are analyzed,Mapping against the human genome release hg19 and custom non-coding (ncRNA) RNA database is performed using BWA version 0.5.9, with paramters "-n 2 -t 12" against the ncRNA database, "-n 1 -t 12" against the human genome,Cutsom scripts are used to assign reads first by assigning reads by lowest error maping error, then by hierarchy accounting for relative biological abundance of ncRNA species as well as enrichment of 5'-p 3'-OH small RNA cDNA cloned according to protocol outlined above.,Genome_build: hg19, custom annotation database containing genbank defined ncRNAs and in-house miRNA definitions,Supplementary_files_format_and_content: first column contains the read with barcode and adapter removed, the second the read count, the third the annotated miRNA name or non-coding RNA type if applicable | TRizol extraction according to the manufacturer's protocol,small RNA cDNA library according to Hafner et al, Methods, 2012, and Hafner et al., RNA, 2011 | GSM1087027 | Illumina HiSeq 2000 | May 15 2019 | size fractionation | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX245351,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01924686 | GSM1087027 | GSE44568,GSE44616 | 0.362547 | HEK 293 cells inducibly expressing FLAG/HA tagged LIN28B; transgene not induced; siRNA transfected; replicate 1 | Public on Feb 26 2013 | Feb 22 2013 | 9606 | LIN28B_knockdown_rep1 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX245351 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01924686 |
|
1 | cell line: HEK293 | 1230 York Ave Box 186 | New York | USA | The Rockefeller University | Miguel,,Brown | Reads are assigned to their respective samples using custom perl scripts. Requirements are that the barcode in its entirety must be found, and the first 5 nt of the 3' adapter sequence allowing for one error (mismatch, indel). Reads ranging from 19-15 nt are analyzed,Mapping against the human genome release hg19 and custom non-coding (ncRNA) RNA database is performed using BWA version 0.5.9, with paramters "-n 2 -t 12" against the ncRNA database, "-n 1 -t 12" against the human genome,Cutsom scripts are used to assign reads first by assigning reads by lowest error maping error, then by hierarchy accounting for relative biological abundance of ncRNA species as well as enrichment of 5'-p 3'-OH small RNA cDNA cloned according to protocol outlined above.,Genome_build: hg19, custom annotation database containing genbank defined ncRNAs and in-house miRNA definitions,Supplementary_files_format_and_content: first column contains the read with barcode and adapter removed, the second the read count, the third the annotated miRNA name or non-coding RNA type if applicable | TRizol extraction according to the manufacturer's protocol,small RNA cDNA library according to Hafner et al, Methods, 2012, and Hafner et al., RNA, 2011 | GSM1087028 | Illumina HiSeq 2000 | May 15 2019 | size fractionation | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX245352,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01924687 | GSM1087028 | GSE44568,GSE44616 | 0.3539 | HEK 293 cells inducibly expressing FLAG/HA tagged LIN28B; transgene not induced; siRNA transfected; replicate 2 | Public on Feb 26 2013 | Feb 22 2013 | 9606 | LIN28B_knockdown_rep2 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX245352 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01924687 |
|
1 | shRNA: scrambled control,plasmid: empty pcDNA3.1 vector,cell line: NB1 | Nobels väg 3 | Stockholm | Sweden | Karolinska Institutet | Daniel,,Ramsköld | Alignment by bowtie version 0.12.7 (option --best) to genome (excluding small contigs in _random files) and exon-exon junctions (http://sandberg.cmb.ki.se/media/data/rnaseq/hg19_junctions_100.fa.gz),Conversion of junction coordinates to genome coordinates for reads overlapping a junction,Gene expression values from rpkmforgenes (http://sandberg.cmb.ki.se/rnaseq/) version 3 May 2011,Genome_build: hg19,Supplementary_files_format_and_content: BED (aligned reads) and tab-delimited text (gene expression values) | RNeasy Mini Kit (Qiagen),Illumina TruSeq | GSM1087257 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | polyA RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX244311,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01924440 | GSM1087257 | GSE44585 | 0.007599 | NB1 cell line | Public on Feb 05 2014 | Feb 22 2013 | 9606 | NB1 shSCR controlplasmid biol repl A | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX244311 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01924440 |
|
1 | shRNA: scrambled control,plasmid: empty pcDNA3.1 vector,cell line: NB1 | Nobels väg 3 | Stockholm | Sweden | Karolinska Institutet | Daniel,,Ramsköld | Alignment by bowtie version 0.12.7 (option --best) to genome (excluding small contigs in _random files) and exon-exon junctions (http://sandberg.cmb.ki.se/media/data/rnaseq/hg19_junctions_100.fa.gz),Conversion of junction coordinates to genome coordinates for reads overlapping a junction,Gene expression values from rpkmforgenes (http://sandberg.cmb.ki.se/rnaseq/) version 3 May 2011,Genome_build: hg19,Supplementary_files_format_and_content: BED (aligned reads) and tab-delimited text (gene expression values) | RNeasy Mini Kit (Qiagen),Illumina TruSeq | GSM1087258 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | polyA RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX244312,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01924441 | GSM1087258 | GSE44585 | 0.008355 | NB1 cell line | Public on Feb 05 2014 | Feb 22 2013 | 9606 | NB1 shSCR controlplasmid biol repl B | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX244312 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01924441 |
|
1 | shRNA: scrambled control,plasmid: empty pcDNA3.1 vector,cell line: NB1 | Nobels väg 3 | Stockholm | Sweden | Karolinska Institutet | Daniel,,Ramsköld | Alignment by bowtie version 0.12.7 (option --best) to genome (excluding small contigs in _random files) and exon-exon junctions (http://sandberg.cmb.ki.se/media/data/rnaseq/hg19_junctions_100.fa.gz),Conversion of junction coordinates to genome coordinates for reads overlapping a junction,Gene expression values from rpkmforgenes (http://sandberg.cmb.ki.se/rnaseq/) version 3 May 2011,Genome_build: hg19,Supplementary_files_format_and_content: BED (aligned reads) and tab-delimited text (gene expression values) | RNeasy Mini Kit (Qiagen),Illumina TruSeq | GSM1087259 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | polyA RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX244313,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01924442 | GSM1087259 | GSE44585 | 0.015958 | NB1 cell line | Public on Feb 05 2014 | Feb 22 2013 | 9606 | NB1 shSCR controlplasmid biol repl C | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX244313 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01924442 |
|
1 | shRNA: scrambled control,plasmid: KIF1Bbeta(600-1400),cell line: NB1 | Nobels väg 3 | Stockholm | Sweden | Karolinska Institutet | Daniel,,Ramsköld | Alignment by bowtie version 0.12.7 (option --best) to genome (excluding small contigs in _random files) and exon-exon junctions (http://sandberg.cmb.ki.se/media/data/rnaseq/hg19_junctions_100.fa.gz),Conversion of junction coordinates to genome coordinates for reads overlapping a junction,Gene expression values from rpkmforgenes (http://sandberg.cmb.ki.se/rnaseq/) version 3 May 2011,Genome_build: hg19,Supplementary_files_format_and_content: BED (aligned reads) and tab-delimited text (gene expression values) | RNeasy Mini Kit (Qiagen),Illumina TruSeq | GSM1087260 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | polyA RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX244314,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01924443 | GSM1087260 | GSE44585 | 0.015033 | NB1 cell line | Public on Feb 05 2014 | Feb 22 2013 | 9606 | NB1 shSCR KIF1Bbeta biol repl A | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX244314 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01924443 |
|
1 | shRNA: scrambled control,plasmid: KIF1Bbeta(600-1400),cell line: NB1 | Nobels väg 3 | Stockholm | Sweden | Karolinska Institutet | Daniel,,Ramsköld | Alignment by bowtie version 0.12.7 (option --best) to genome (excluding small contigs in _random files) and exon-exon junctions (http://sandberg.cmb.ki.se/media/data/rnaseq/hg19_junctions_100.fa.gz),Conversion of junction coordinates to genome coordinates for reads overlapping a junction,Gene expression values from rpkmforgenes (http://sandberg.cmb.ki.se/rnaseq/) version 3 May 2011,Genome_build: hg19,Supplementary_files_format_and_content: BED (aligned reads) and tab-delimited text (gene expression values) | RNeasy Mini Kit (Qiagen),Illumina TruSeq | GSM1087261 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | polyA RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX244315,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01924444 | GSM1087261 | GSE44585 | 0.007599 | NB1 cell line | Public on Feb 05 2014 | Feb 22 2013 | 9606 | NB1 shSCR KIF1Bbeta biol repl B | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX244315 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01924444 |
|
1 | shRNA: scrambled control,plasmid: KIF1Bbeta(600-1400),cell line: NB1 | Nobels väg 3 | Stockholm | Sweden | Karolinska Institutet | Daniel,,Ramsköld | Alignment by bowtie version 0.12.7 (option --best) to genome (excluding small contigs in _random files) and exon-exon junctions (http://sandberg.cmb.ki.se/media/data/rnaseq/hg19_junctions_100.fa.gz),Conversion of junction coordinates to genome coordinates for reads overlapping a junction,Gene expression values from rpkmforgenes (http://sandberg.cmb.ki.se/rnaseq/) version 3 May 2011,Genome_build: hg19,Supplementary_files_format_and_content: BED (aligned reads) and tab-delimited text (gene expression values) | RNeasy Mini Kit (Qiagen),Illumina TruSeq | GSM1087262 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | polyA RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX244316,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01924445 | GSM1087262 | GSE44585 | 0.010719 | NB1 cell line | Public on Feb 05 2014 | Feb 22 2013 | 9606 | NB1 shSCR KIF1Bbeta biol repl C | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX244316 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01924445 |
|
1 | shRNA: DHX9,plasmid: empty pcDNA3.1 vector,cell line: NB1 | Nobels väg 3 | Stockholm | Sweden | Karolinska Institutet | Daniel,,Ramsköld | Alignment by bowtie version 0.12.7 (option --best) to genome (excluding small contigs in _random files) and exon-exon junctions (http://sandberg.cmb.ki.se/media/data/rnaseq/hg19_junctions_100.fa.gz),Conversion of junction coordinates to genome coordinates for reads overlapping a junction,Gene expression values from rpkmforgenes (http://sandberg.cmb.ki.se/rnaseq/) version 3 May 2011,Genome_build: hg19,Supplementary_files_format_and_content: BED (aligned reads) and tab-delimited text (gene expression values) | RNeasy Mini Kit (Qiagen),Illumina TruSeq | GSM1087263 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | polyA RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX244317,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01924446 | GSM1087263 | GSE44585 | 0.007028 | NB1 cell line | Public on Feb 05 2014 | Feb 22 2013 | 9606 | NB1 shDHX9 controlplasmid biol repl A | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX244317 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01924446 |
|
1 | shRNA: DHX9,plasmid: empty pcDNA3.1 vector,cell line: NB1 | Nobels väg 3 | Stockholm | Sweden | Karolinska Institutet | Daniel,,Ramsköld | Alignment by bowtie version 0.12.7 (option --best) to genome (excluding small contigs in _random files) and exon-exon junctions (http://sandberg.cmb.ki.se/media/data/rnaseq/hg19_junctions_100.fa.gz),Conversion of junction coordinates to genome coordinates for reads overlapping a junction,Gene expression values from rpkmforgenes (http://sandberg.cmb.ki.se/rnaseq/) version 3 May 2011,Genome_build: hg19,Supplementary_files_format_and_content: BED (aligned reads) and tab-delimited text (gene expression values) | RNeasy Mini Kit (Qiagen),Illumina TruSeq | GSM1087264 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | polyA RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX244318,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01924447 | GSM1087264 | GSE44585 | 0.007599 | NB1 cell line | Public on Feb 05 2014 | Feb 22 2013 | 9606 | NB1 shDHX9 controlplasmid biol repl B | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX244318 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01924447 |
|
1 | shRNA: DHX9,plasmid: empty pcDNA3.1 vector,cell line: NB1 | Nobels väg 3 | Stockholm | Sweden | Karolinska Institutet | Daniel,,Ramsköld | Alignment by bowtie version 0.12.7 (option --best) to genome (excluding small contigs in _random files) and exon-exon junctions (http://sandberg.cmb.ki.se/media/data/rnaseq/hg19_junctions_100.fa.gz),Conversion of junction coordinates to genome coordinates for reads overlapping a junction,Gene expression values from rpkmforgenes (http://sandberg.cmb.ki.se/rnaseq/) version 3 May 2011,Genome_build: hg19,Supplementary_files_format_and_content: BED (aligned reads) and tab-delimited text (gene expression values) | RNeasy Mini Kit (Qiagen),Illumina TruSeq | GSM1087265 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | polyA RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX244319,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01924448 | GSM1087265 | GSE44585 | 0.007028 | NB1 cell line | Public on Feb 05 2014 | Feb 22 2013 | 9606 | NB1 shDHX9 controlplasmid biol repl C | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX244319 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01924448 |
|
1 | shRNA: DHX9,plasmid: KIF1Bbeta(600-1400),cell line: NB1 | Nobels väg 3 | Stockholm | Sweden | Karolinska Institutet | Daniel,,Ramsköld | Alignment by bowtie version 0.12.7 (option --best) to genome (excluding small contigs in _random files) and exon-exon junctions (http://sandberg.cmb.ki.se/media/data/rnaseq/hg19_junctions_100.fa.gz),Conversion of junction coordinates to genome coordinates for reads overlapping a junction,Gene expression values from rpkmforgenes (http://sandberg.cmb.ki.se/rnaseq/) version 3 May 2011,Genome_build: hg19,Supplementary_files_format_and_content: BED (aligned reads) and tab-delimited text (gene expression values) | RNeasy Mini Kit (Qiagen),Illumina TruSeq | GSM1087266 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | polyA RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX244320,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01924449 | GSM1087266 | GSE44585 | 0.007599 | NB1 cell line | Public on Feb 05 2014 | Feb 22 2013 | 9606 | NB1 shDHX9 KIF1Bbeta biol repl A | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX244320 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01924449 |
|
1 | shRNA: DHX9,plasmid: KIF1Bbeta(600-1400),cell line: NB1 | Nobels väg 3 | Stockholm | Sweden | Karolinska Institutet | Daniel,,Ramsköld | Alignment by bowtie version 0.12.7 (option --best) to genome (excluding small contigs in _random files) and exon-exon junctions (http://sandberg.cmb.ki.se/media/data/rnaseq/hg19_junctions_100.fa.gz),Conversion of junction coordinates to genome coordinates for reads overlapping a junction,Gene expression values from rpkmforgenes (http://sandberg.cmb.ki.se/rnaseq/) version 3 May 2011,Genome_build: hg19,Supplementary_files_format_and_content: BED (aligned reads) and tab-delimited text (gene expression values) | RNeasy Mini Kit (Qiagen),Illumina TruSeq | GSM1087267 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | polyA RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX244321,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01924450 | GSM1087267 | GSE44585 | 0.040666 | NB1 cell line | Public on Feb 05 2014 | Feb 22 2013 | 9606 | NB1 shDHX9 KIF1Bbeta biol repl B | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX244321 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01924450 |
|
1 | shRNA: DHX9,plasmid: KIF1Bbeta(600-1400),cell line: NB1 | Nobels väg 3 | Stockholm | Sweden | Karolinska Institutet | Daniel,,Ramsköld | Alignment by bowtie version 0.12.7 (option --best) to genome (excluding small contigs in _random files) and exon-exon junctions (http://sandberg.cmb.ki.se/media/data/rnaseq/hg19_junctions_100.fa.gz),Conversion of junction coordinates to genome coordinates for reads overlapping a junction,Gene expression values from rpkmforgenes (http://sandberg.cmb.ki.se/rnaseq/) version 3 May 2011,Genome_build: hg19,Supplementary_files_format_and_content: BED (aligned reads) and tab-delimited text (gene expression values) | RNeasy Mini Kit (Qiagen),Illumina TruSeq | GSM1087268 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | polyA RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX244322,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01924451 | GSM1087268 | GSE44585 | 0.008471 | NB1 cell line | Public on Feb 05 2014 | Feb 22 2013 | 9606 | NB1 shDHX9 KIF1Bbeta biol repl C | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX244322 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01924451 |
|
1 | crosslinker and crosslinking wavelength: 4-SU / 365 nm,antibody: Flag M2,immunoprecipitated protein: LIN28A | 1230 York Ave Box 186 | New York | USA | The Rockefeller University | Miguel,,Brown | Mapping Reads: The reads from the LIN28A and B PAR-CLIP deep sequencing library were stripped of the 3â adapter sequence using the FASTX toolkit (http://hannonlab.cshl.edu/fastx_toolkit/). Reads that were less than 20 nt in length or contained an ambiguous nucleotide were discarded. The remaining reads were aligned to the human genome (hg19), with up to 1 mismatch allowed, by the Bowtie algorithm (Langmead et al., 2009). Mapped locations were only reported for those with the minimum number of observed mismatches for each read. All T to C mismatches between the RNA fragment and the genome were subtracted from the mismatch count for each mapped location. After subtraction only reads that mapped to a single genomic location at the minimum number of mismatches were used for further analysis. The location that a read mapped, relative to a known transcript, was determined based on the ENSEMBL v57 database 1(Hubbard et al., 2007). If a read mapped to a location representing multiple categories, it was reported to belong to the category based on the following order of preference: 3âUTR, coding sequence, 5âUTR, intron, non-coding RNA, intergenic. Defining HuR binding sites by PARalyzer: Overlapping reads were grouped together for further analysis. A group must have contained â¥5 reads with T-to-C conversions at two or more locations and at least 25% of mapped sequence reads. PARalyzer is available at http://www.genome.duke.edu/labs/ohler/research/PARalyzer,Genome_build: hg19 | The pellets of cells crosslinked with UV 365 nm were resuspended in NP40 lysis buffer and incubated on ice for 10 min. The cell lysate was cleared by centrifugation at 13,000g. RNase T1 (Fermentas) was added to the cleared cell lysates and the reaction mixture was incubated at 22ºC for 15 min and subsequently cooled for 5 min on ice before addition of antibody-conjugated magnetic beads. The recovered RNA was carried through a cDNA library preparation protocol originally described for cloning of small regulatory RNAs (Hafner et al., 2008). The first step, 3' adapter ligation, was carried out as described on a 20 ul scale using 10.5 ul of the recovered RNA. UV 365 nm crosslinked sample RNAs were processed using Solexa sequencing adapter sets. Depending on the amount of RNA recovered, 5'-adapter-3'-adapter products without inserts may be detected after amplification of the cDNA as additional PCR bands. In such case, the longer PCR product of expected size was excised from a 3% NuSieve low-melting point agarose gel, eluted from the gel pieces with the Illustra GFX-PCR purification kit (GE Healthcare) and Solexa sequenced. | GSM1087848 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX245353,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01924688 | GSM1087848 | GSE44615,GSE44616 | 0.315776 | HEK 293 | Public on Feb 26 2013 | Feb 25 2013 | 9606 | LIN28A PAR-CLIP | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX245353 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01924688 |
|
1 | crosslinker and crosslinking wavelength: 4-SU / 365 nm,antibody: Flag M2,immunoprecipitated protein: LIN28B | 1230 York Ave Box 186 | New York | USA | The Rockefeller University | Miguel,,Brown | Mapping Reads: The reads from the LIN28A and B PAR-CLIP deep sequencing library were stripped of the 3â adapter sequence using the FASTX toolkit (http://hannonlab.cshl.edu/fastx_toolkit/). Reads that were less than 20 nt in length or contained an ambiguous nucleotide were discarded. The remaining reads were aligned to the human genome (hg19), with up to 1 mismatch allowed, by the Bowtie algorithm (Langmead et al., 2009). Mapped locations were only reported for those with the minimum number of observed mismatches for each read. All T to C mismatches between the RNA fragment and the genome were subtracted from the mismatch count for each mapped location. After subtraction only reads that mapped to a single genomic location at the minimum number of mismatches were used for further analysis. The location that a read mapped, relative to a known transcript, was determined based on the ENSEMBL v57 database 1(Hubbard et al., 2007). If a read mapped to a location representing multiple categories, it was reported to belong to the category based on the following order of preference: 3âUTR, coding sequence, 5âUTR, intron, non-coding RNA, intergenic. Defining HuR binding sites by PARalyzer: Overlapping reads were grouped together for further analysis. A group must have contained â¥5 reads with T-to-C conversions at two or more locations and at least 25% of mapped sequence reads. PARalyzer is available at http://www.genome.duke.edu/labs/ohler/research/PARalyzer,Genome_build: hg19 | The pellets of cells crosslinked with UV 365 nm were resuspended in NP40 lysis buffer and incubated on ice for 10 min. The cell lysate was cleared by centrifugation at 13,000g. RNase T1 (Fermentas) was added to the cleared cell lysates and the reaction mixture was incubated at 22ºC for 15 min and subsequently cooled for 5 min on ice before addition of antibody-conjugated magnetic beads. The recovered RNA was carried through a cDNA library preparation protocol originally described for cloning of small regulatory RNAs (Hafner et al., 2008). The first step, 3' adapter ligation, was carried out as described on a 20 ul scale using 10.5 ul of the recovered RNA. UV 365 nm crosslinked sample RNAs were processed using Solexa sequencing adapter sets. Depending on the amount of RNA recovered, 5'-adapter-3'-adapter products without inserts may be detected after amplification of the cDNA as additional PCR bands. In such case, the longer PCR product of expected size was excised from a 3% NuSieve low-melting point agarose gel, eluted from the gel pieces with the Illustra GFX-PCR purification kit (GE Healthcare) and Solexa sequenced. | GSM1087851 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX245356,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN01924691 | GSM1087851 | GSE44615,GSE44616 | 0.520003 | HEK 293 | Public on Feb 26 2013 | Feb 25 2013 | 9606 | LIN28B_rep3 PAR-CLIP | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX245356 | https://www.ncbi.nlm.nih.gov/biosample/SAMN01924691 |