channel_count
int64 1
1
| characteristics_ch1
stringlengths 6
9.77k
| contact_address
stringlengths 1
229
| contact_city
stringlengths 1
47
| contact_country
stringclasses 71
values | contact_institute
stringlengths 2
128
| contact_name
stringlengths 4
74
| contact_zip
stringclasses 1
value | data_processing
stringlengths 4
10.6k
| extract_protocol_ch1
stringlengths 6
14.3k
| geo_accession
stringlengths 9
10
| instrument_model
stringclasses 13
values | last_update_date
stringlengths 11
11
| library_selection
stringclasses 6
values | library_source
stringclasses 5
values | library_strategy
stringclasses 1
value | molecule_ch1
stringclasses 7
values | organism_ch1
stringclasses 1
value | platform_id
stringclasses 13
values | relation
stringlengths 0
2.61k
| sample
stringlengths 9
10
| series_id
stringlengths 8
29
| singlecellprobability
float64 0
1
| source_name_ch1
stringlengths 1
253
| status
stringlengths 21
21
| submission_date
stringlengths 11
11
| taxid_ch1
stringclasses 1
value | title
stringlengths 1
120
| type
stringclasses 1
value | sra
stringlengths 47
49
⌀ | biosample
stringlengths 51
51
⌀ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
1 | tissue: bonemarrow | Otto-Stern-Weg 3 | Zuerich | Switzerland | ETH Zurich | Yannik,,Severin | Illumina adapters, sequences of poor quality as well as polyA and polyT sequences were removed from the raw reads using TrimGalore v.0.6.0 with cutadapt v.2.0 prior to alignment. Reads were then aligned to the human reference genome GRCh38, v93 (Ensembl) using STAR v. 2.5.3a. Read per genes were counted with featureCounts v1.5.0. Gene counts below a threshold of 20 raw counts were filtered and raw counts were normalized (DESeq2).,Assembly: GRCh38, v.93,Supplementary files format and content: AML_Severin_count_matrix_aggregated.csv | Cell pellets were lysed in TriZol and RNA was extracted Quick-RNA MiniPrep Kit by Zymo according to the manufacturers instructions.,CDNA libraries were obtained according to Picelli, S. et al. Genome Res. 24, 2033â2040 (2014). Illumina library was obtained via tagmentation using Illumina Nextera Kit. All samples were sequenced in a single run on a NovaSeq6000 (single read, 100bp, depth 20 Mio reads per sample) | GSM8409155 | Illumina NovaSeq 6000 | Jul 20 2024 | cDNA | transcriptomic | RNA-Seq | polyA RNA | Homo sapiens | GPL24676 | BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN42654400,SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX25392677 | GSM8409155 | GSE272681 | 0.002405 | bonemarrow | Public on Jul 20 2024 | Jul 19 2024 | 9606 | Patient AML041, bonemarrow, time point 2, Batch 3 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX25392677 | https://www.ncbi.nlm.nih.gov/biosample/SAMN42654400 |
|
1 | tissue: blood | Otto-Stern-Weg 3 | Zuerich | Switzerland | ETH Zurich | Yannik,,Severin | Illumina adapters, sequences of poor quality as well as polyA and polyT sequences were removed from the raw reads using TrimGalore v.0.6.0 with cutadapt v.2.0 prior to alignment. Reads were then aligned to the human reference genome GRCh38, v93 (Ensembl) using STAR v. 2.5.3a. Read per genes were counted with featureCounts v1.5.0. Gene counts below a threshold of 20 raw counts were filtered and raw counts were normalized (DESeq2).,Assembly: GRCh38, v.93,Supplementary files format and content: AML_Severin_count_matrix_aggregated.csv | Cell pellets were lysed in TriZol and RNA was extracted Quick-RNA MiniPrep Kit by Zymo according to the manufacturers instructions.,CDNA libraries were obtained according to Picelli, S. et al. Genome Res. 24, 2033â2040 (2014). Illumina library was obtained via tagmentation using Illumina Nextera Kit. All samples were sequenced in a single run on a NovaSeq6000 (single read, 100bp, depth 20 Mio reads per sample) | GSM8409156 | Illumina NovaSeq 6000 | Jul 20 2024 | cDNA | transcriptomic | RNA-Seq | polyA RNA | Homo sapiens | GPL24676 | BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN42654399,SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX25392678 | GSM8409156 | GSE272681 | 0.005289 | blood | Public on Jul 20 2024 | Jul 19 2024 | 9606 | Patient AML041, blood, time point 1, Batch 3 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX25392678 | https://www.ncbi.nlm.nih.gov/biosample/SAMN42654399 |
|
1 | tissue: bonemarrow | Otto-Stern-Weg 3 | Zuerich | Switzerland | ETH Zurich | Yannik,,Severin | Illumina adapters, sequences of poor quality as well as polyA and polyT sequences were removed from the raw reads using TrimGalore v.0.6.0 with cutadapt v.2.0 prior to alignment. Reads were then aligned to the human reference genome GRCh38, v93 (Ensembl) using STAR v. 2.5.3a. Read per genes were counted with featureCounts v1.5.0. Gene counts below a threshold of 20 raw counts were filtered and raw counts were normalized (DESeq2).,Assembly: GRCh38, v.93,Supplementary files format and content: AML_Severin_count_matrix_aggregated.csv | Cell pellets were lysed in TriZol and RNA was extracted Quick-RNA MiniPrep Kit by Zymo according to the manufacturers instructions.,CDNA libraries were obtained according to Picelli, S. et al. Genome Res. 24, 2033â2040 (2014). Illumina library was obtained via tagmentation using Illumina Nextera Kit. All samples were sequenced in a single run on a NovaSeq6000 (single read, 100bp, depth 20 Mio reads per sample) | GSM8409157 | Illumina NovaSeq 6000 | Jul 20 2024 | cDNA | transcriptomic | RNA-Seq | polyA RNA | Homo sapiens | GPL24676 | BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN42654398,SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX25392679 | GSM8409157 | GSE272681 | 0.000847 | bonemarrow | Public on Jul 20 2024 | Jul 19 2024 | 9606 | Patient AML042, bonemarrow, time point 2, Batch 3 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX25392679 | https://www.ncbi.nlm.nih.gov/biosample/SAMN42654398 |
|
1 | tissue: blood | Otto-Stern-Weg 3 | Zuerich | Switzerland | ETH Zurich | Yannik,,Severin | Illumina adapters, sequences of poor quality as well as polyA and polyT sequences were removed from the raw reads using TrimGalore v.0.6.0 with cutadapt v.2.0 prior to alignment. Reads were then aligned to the human reference genome GRCh38, v93 (Ensembl) using STAR v. 2.5.3a. Read per genes were counted with featureCounts v1.5.0. Gene counts below a threshold of 20 raw counts were filtered and raw counts were normalized (DESeq2).,Assembly: GRCh38, v.93,Supplementary files format and content: AML_Severin_count_matrix_aggregated.csv | Cell pellets were lysed in TriZol and RNA was extracted Quick-RNA MiniPrep Kit by Zymo according to the manufacturers instructions.,CDNA libraries were obtained according to Picelli, S. et al. Genome Res. 24, 2033â2040 (2014). Illumina library was obtained via tagmentation using Illumina Nextera Kit. All samples were sequenced in a single run on a NovaSeq6000 (single read, 100bp, depth 20 Mio reads per sample) | GSM8409159 | Illumina NovaSeq 6000 | Jul 20 2024 | cDNA | transcriptomic | RNA-Seq | polyA RNA | Homo sapiens | GPL24676 | BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN42654396,SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX25392681 | GSM8409159 | GSE272681 | 0.0044 | blood | Public on Jul 20 2024 | Jul 19 2024 | 9606 | Patient AML042, blood, time point 2, Batch 3 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX25392681 | https://www.ncbi.nlm.nih.gov/biosample/SAMN42654396 |
|
1 | tissue: blood | Otto-Stern-Weg 3 | Zuerich | Switzerland | ETH Zurich | Yannik,,Severin | Illumina adapters, sequences of poor quality as well as polyA and polyT sequences were removed from the raw reads using TrimGalore v.0.6.0 with cutadapt v.2.0 prior to alignment. Reads were then aligned to the human reference genome GRCh38, v93 (Ensembl) using STAR v. 2.5.3a. Read per genes were counted with featureCounts v1.5.0. Gene counts below a threshold of 20 raw counts were filtered and raw counts were normalized (DESeq2).,Assembly: GRCh38, v.93,Supplementary files format and content: AML_Severin_count_matrix_aggregated.csv | Cell pellets were lysed in TriZol and RNA was extracted Quick-RNA MiniPrep Kit by Zymo according to the manufacturers instructions.,CDNA libraries were obtained according to Picelli, S. et al. Genome Res. 24, 2033â2040 (2014). Illumina library was obtained via tagmentation using Illumina Nextera Kit. All samples were sequenced in a single run on a NovaSeq6000 (single read, 100bp, depth 20 Mio reads per sample) | GSM8409160 | Illumina NovaSeq 6000 | Jul 20 2024 | cDNA | transcriptomic | RNA-Seq | polyA RNA | Homo sapiens | GPL24676 | BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN42654395,SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX25392682 | GSM8409160 | GSE272681 | 0.003364 | blood | Public on Jul 20 2024 | Jul 19 2024 | 9606 | Patient AML042, blood, time point 3, Batch 3 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX25392682 | https://www.ncbi.nlm.nih.gov/biosample/SAMN42654395 |
|
1 | tissue: bonemarrow | Otto-Stern-Weg 3 | Zuerich | Switzerland | ETH Zurich | Yannik,,Severin | Illumina adapters, sequences of poor quality as well as polyA and polyT sequences were removed from the raw reads using TrimGalore v.0.6.0 with cutadapt v.2.0 prior to alignment. Reads were then aligned to the human reference genome GRCh38, v93 (Ensembl) using STAR v. 2.5.3a. Read per genes were counted with featureCounts v1.5.0. Gene counts below a threshold of 20 raw counts were filtered and raw counts were normalized (DESeq2).,Assembly: GRCh38, v.93,Supplementary files format and content: AML_Severin_count_matrix_aggregated.csv | Cell pellets were lysed in TriZol and RNA was extracted Quick-RNA MiniPrep Kit by Zymo according to the manufacturers instructions.,CDNA libraries were obtained according to Picelli, S. et al. Genome Res. 24, 2033â2040 (2014). Illumina library was obtained via tagmentation using Illumina Nextera Kit. All samples were sequenced in a single run on a NovaSeq6000 (single read, 100bp, depth 20 Mio reads per sample) | GSM8409161 | Illumina NovaSeq 6000 | Jul 20 2024 | cDNA | transcriptomic | RNA-Seq | polyA RNA | Homo sapiens | GPL24676 | BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN42654394,SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX25392683 | GSM8409161 | GSE272681 | 0.001201 | bonemarrow | Public on Jul 20 2024 | Jul 19 2024 | 9606 | Patient AML044, bonemarrow, time point 3, Batch 3 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX25392683 | https://www.ncbi.nlm.nih.gov/biosample/SAMN42654394 |
|
1 | tissue: blood | Otto-Stern-Weg 3 | Zuerich | Switzerland | ETH Zurich | Yannik,,Severin | Illumina adapters, sequences of poor quality as well as polyA and polyT sequences were removed from the raw reads using TrimGalore v.0.6.0 with cutadapt v.2.0 prior to alignment. Reads were then aligned to the human reference genome GRCh38, v93 (Ensembl) using STAR v. 2.5.3a. Read per genes were counted with featureCounts v1.5.0. Gene counts below a threshold of 20 raw counts were filtered and raw counts were normalized (DESeq2).,Assembly: GRCh38, v.93,Supplementary files format and content: AML_Severin_count_matrix_aggregated.csv | Cell pellets were lysed in TriZol and RNA was extracted Quick-RNA MiniPrep Kit by Zymo according to the manufacturers instructions.,CDNA libraries were obtained according to Picelli, S. et al. Genome Res. 24, 2033â2040 (2014). Illumina library was obtained via tagmentation using Illumina Nextera Kit. All samples were sequenced in a single run on a NovaSeq6000 (single read, 100bp, depth 20 Mio reads per sample) | GSM8409162 | Illumina NovaSeq 6000 | Jul 20 2024 | cDNA | transcriptomic | RNA-Seq | polyA RNA | Homo sapiens | GPL24676 | BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN42654393,SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX25392684 | GSM8409162 | GSE272681 | 0.001403 | blood | Public on Jul 20 2024 | Jul 19 2024 | 9606 | Patient AML044, blood, time point 2, Batch 3 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX25392684 | https://www.ncbi.nlm.nih.gov/biosample/SAMN42654393 |
|
1 | tissue: blood | Otto-Stern-Weg 3 | Zuerich | Switzerland | ETH Zurich | Yannik,,Severin | Illumina adapters, sequences of poor quality as well as polyA and polyT sequences were removed from the raw reads using TrimGalore v.0.6.0 with cutadapt v.2.0 prior to alignment. Reads were then aligned to the human reference genome GRCh38, v93 (Ensembl) using STAR v. 2.5.3a. Read per genes were counted with featureCounts v1.5.0. Gene counts below a threshold of 20 raw counts were filtered and raw counts were normalized (DESeq2).,Assembly: GRCh38, v.93,Supplementary files format and content: AML_Severin_count_matrix_aggregated.csv | Cell pellets were lysed in TriZol and RNA was extracted Quick-RNA MiniPrep Kit by Zymo according to the manufacturers instructions.,CDNA libraries were obtained according to Picelli, S. et al. Genome Res. 24, 2033â2040 (2014). Illumina library was obtained via tagmentation using Illumina Nextera Kit. All samples were sequenced in a single run on a NovaSeq6000 (single read, 100bp, depth 20 Mio reads per sample) | GSM8409163 | Illumina NovaSeq 6000 | Jul 20 2024 | cDNA | transcriptomic | RNA-Seq | polyA RNA | Homo sapiens | GPL24676 | BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN42654392,SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX25392685 | GSM8409163 | GSE272681 | 0.003719 | blood | Public on Jul 20 2024 | Jul 19 2024 | 9606 | Patient AML044, blood, time point 3, Batch 3 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX25392685 | https://www.ncbi.nlm.nih.gov/biosample/SAMN42654392 |
|
1 | tissue: bonemarrow | Otto-Stern-Weg 3 | Zuerich | Switzerland | ETH Zurich | Yannik,,Severin | Illumina adapters, sequences of poor quality as well as polyA and polyT sequences were removed from the raw reads using TrimGalore v.0.6.0 with cutadapt v.2.0 prior to alignment. Reads were then aligned to the human reference genome GRCh38, v93 (Ensembl) using STAR v. 2.5.3a. Read per genes were counted with featureCounts v1.5.0. Gene counts below a threshold of 20 raw counts were filtered and raw counts were normalized (DESeq2).,Assembly: GRCh38, v.93,Supplementary files format and content: AML_Severin_count_matrix_aggregated.csv | Cell pellets were lysed in TriZol and RNA was extracted Quick-RNA MiniPrep Kit by Zymo according to the manufacturers instructions.,CDNA libraries were obtained according to Picelli, S. et al. Genome Res. 24, 2033â2040 (2014). Illumina library was obtained via tagmentation using Illumina Nextera Kit. All samples were sequenced in a single run on a NovaSeq6000 (single read, 100bp, depth 20 Mio reads per sample) | GSM8409164 | Illumina NovaSeq 6000 | Jul 20 2024 | cDNA | transcriptomic | RNA-Seq | polyA RNA | Homo sapiens | GPL24676 | BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN42654391,SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX25392686 | GSM8409164 | GSE272681 | 0.001938 | bonemarrow | Public on Jul 20 2024 | Jul 19 2024 | 9606 | Patient AML045, bonemarrow, time point 1, Batch 3 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX25392686 | https://www.ncbi.nlm.nih.gov/biosample/SAMN42654391 |
|
1 | tissue: blood | Otto-Stern-Weg 3 | Zuerich | Switzerland | ETH Zurich | Yannik,,Severin | Illumina adapters, sequences of poor quality as well as polyA and polyT sequences were removed from the raw reads using TrimGalore v.0.6.0 with cutadapt v.2.0 prior to alignment. Reads were then aligned to the human reference genome GRCh38, v93 (Ensembl) using STAR v. 2.5.3a. Read per genes were counted with featureCounts v1.5.0. Gene counts below a threshold of 20 raw counts were filtered and raw counts were normalized (DESeq2).,Assembly: GRCh38, v.93,Supplementary files format and content: AML_Severin_count_matrix_aggregated.csv | Cell pellets were lysed in TriZol and RNA was extracted Quick-RNA MiniPrep Kit by Zymo according to the manufacturers instructions.,CDNA libraries were obtained according to Picelli, S. et al. Genome Res. 24, 2033â2040 (2014). Illumina library was obtained via tagmentation using Illumina Nextera Kit. All samples were sequenced in a single run on a NovaSeq6000 (single read, 100bp, depth 20 Mio reads per sample) | GSM8409165 | Illumina NovaSeq 6000 | Jul 20 2024 | cDNA | transcriptomic | RNA-Seq | polyA RNA | Homo sapiens | GPL24676 | BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN42654390,SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX25392687 | GSM8409165 | GSE272681 | 0.000831 | blood | Public on Jul 20 2024 | Jul 19 2024 | 9606 | Patient AML045, blood, time point 1, Batch 3 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX25392687 | https://www.ncbi.nlm.nih.gov/biosample/SAMN42654390 |
|
1 | tissue: bonemarrow | Otto-Stern-Weg 3 | Zuerich | Switzerland | ETH Zurich | Yannik,,Severin | Illumina adapters, sequences of poor quality as well as polyA and polyT sequences were removed from the raw reads using TrimGalore v.0.6.0 with cutadapt v.2.0 prior to alignment. Reads were then aligned to the human reference genome GRCh38, v93 (Ensembl) using STAR v. 2.5.3a. Read per genes were counted with featureCounts v1.5.0. Gene counts below a threshold of 20 raw counts were filtered and raw counts were normalized (DESeq2).,Assembly: GRCh38, v.93,Supplementary files format and content: AML_Severin_count_matrix_aggregated.csv | Cell pellets were lysed in TriZol and RNA was extracted Quick-RNA MiniPrep Kit by Zymo according to the manufacturers instructions.,CDNA libraries were obtained according to Picelli, S. et al. Genome Res. 24, 2033â2040 (2014). Illumina library was obtained via tagmentation using Illumina Nextera Kit. All samples were sequenced in a single run on a NovaSeq6000 (single read, 100bp, depth 20 Mio reads per sample) | GSM8409166 | Illumina NovaSeq 6000 | Jul 20 2024 | cDNA | transcriptomic | RNA-Seq | polyA RNA | Homo sapiens | GPL24676 | BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN42654389,SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX25392698 | GSM8409166 | GSE272681 | 0.002806 | bonemarrow | Public on Jul 20 2024 | Jul 19 2024 | 9606 | Patient AML046, bonemarrow, time point 2, Batch 3 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX25392698 | https://www.ncbi.nlm.nih.gov/biosample/SAMN42654389 |
|
1 | tissue: bonemarrow | Otto-Stern-Weg 3 | Zuerich | Switzerland | ETH Zurich | Yannik,,Severin | Illumina adapters, sequences of poor quality as well as polyA and polyT sequences were removed from the raw reads using TrimGalore v.0.6.0 with cutadapt v.2.0 prior to alignment. Reads were then aligned to the human reference genome GRCh38, v93 (Ensembl) using STAR v. 2.5.3a. Read per genes were counted with featureCounts v1.5.0. Gene counts below a threshold of 20 raw counts were filtered and raw counts were normalized (DESeq2).,Assembly: GRCh38, v.93,Supplementary files format and content: AML_Severin_count_matrix_aggregated.csv | Cell pellets were lysed in TriZol and RNA was extracted Quick-RNA MiniPrep Kit by Zymo according to the manufacturers instructions.,CDNA libraries were obtained according to Picelli, S. et al. Genome Res. 24, 2033â2040 (2014). Illumina library was obtained via tagmentation using Illumina Nextera Kit. All samples were sequenced in a single run on a NovaSeq6000 (single read, 100bp, depth 20 Mio reads per sample) | GSM8409168 | Illumina NovaSeq 6000 | Jul 20 2024 | cDNA | transcriptomic | RNA-Seq | polyA RNA | Homo sapiens | GPL24676 | BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN42654387,SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX25392689 | GSM8409168 | GSE272681 | 0.001805 | bonemarrow | Public on Jul 20 2024 | Jul 19 2024 | 9606 | Patient AML047, bonemarrow, time point 2, Batch 3 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX25392689 | https://www.ncbi.nlm.nih.gov/biosample/SAMN42654387 |
|
1 | tissue: blood | Otto-Stern-Weg 3 | Zuerich | Switzerland | ETH Zurich | Yannik,,Severin | Illumina adapters, sequences of poor quality as well as polyA and polyT sequences were removed from the raw reads using TrimGalore v.0.6.0 with cutadapt v.2.0 prior to alignment. Reads were then aligned to the human reference genome GRCh38, v93 (Ensembl) using STAR v. 2.5.3a. Read per genes were counted with featureCounts v1.5.0. Gene counts below a threshold of 20 raw counts were filtered and raw counts were normalized (DESeq2).,Assembly: GRCh38, v.93,Supplementary files format and content: AML_Severin_count_matrix_aggregated.csv | Cell pellets were lysed in TriZol and RNA was extracted Quick-RNA MiniPrep Kit by Zymo according to the manufacturers instructions.,CDNA libraries were obtained according to Picelli, S. et al. Genome Res. 24, 2033â2040 (2014). Illumina library was obtained via tagmentation using Illumina Nextera Kit. All samples were sequenced in a single run on a NovaSeq6000 (single read, 100bp, depth 20 Mio reads per sample) | GSM8409169 | Illumina NovaSeq 6000 | Jul 20 2024 | cDNA | transcriptomic | RNA-Seq | polyA RNA | Homo sapiens | GPL24676 | BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN42654386,SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX25392690 | GSM8409169 | GSE272681 | 0.00113 | blood | Public on Jul 20 2024 | Jul 19 2024 | 9606 | Patient AML047, blood, time point 1, Batch 3 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX25392690 | https://www.ncbi.nlm.nih.gov/biosample/SAMN42654386 |
|
1 | tissue: bonemarrow | Otto-Stern-Weg 3 | Zuerich | Switzerland | ETH Zurich | Yannik,,Severin | Illumina adapters, sequences of poor quality as well as polyA and polyT sequences were removed from the raw reads using TrimGalore v.0.6.0 with cutadapt v.2.0 prior to alignment. Reads were then aligned to the human reference genome GRCh38, v93 (Ensembl) using STAR v. 2.5.3a. Read per genes were counted with featureCounts v1.5.0. Gene counts below a threshold of 20 raw counts were filtered and raw counts were normalized (DESeq2).,Assembly: GRCh38, v.93,Supplementary files format and content: AML_Severin_count_matrix_aggregated.csv | Cell pellets were lysed in TriZol and RNA was extracted Quick-RNA MiniPrep Kit by Zymo according to the manufacturers instructions.,CDNA libraries were obtained according to Picelli, S. et al. Genome Res. 24, 2033â2040 (2014). Illumina library was obtained via tagmentation using Illumina Nextera Kit. All samples were sequenced in a single run on a NovaSeq6000 (single read, 100bp, depth 20 Mio reads per sample) | GSM8409171 | Illumina NovaSeq 6000 | Jul 20 2024 | cDNA | transcriptomic | RNA-Seq | polyA RNA | Homo sapiens | GPL24676 | BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN42654384,SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX25392692 | GSM8409171 | GSE272681 | 0.004238 | bonemarrow | Public on Jul 20 2024 | Jul 19 2024 | 9606 | Patient AML048, bonemarrow, time point 2, Batch 3 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX25392692 | https://www.ncbi.nlm.nih.gov/biosample/SAMN42654384 |
|
1 | tissue: blood | Otto-Stern-Weg 3 | Zuerich | Switzerland | ETH Zurich | Yannik,,Severin | Illumina adapters, sequences of poor quality as well as polyA and polyT sequences were removed from the raw reads using TrimGalore v.0.6.0 with cutadapt v.2.0 prior to alignment. Reads were then aligned to the human reference genome GRCh38, v93 (Ensembl) using STAR v. 2.5.3a. Read per genes were counted with featureCounts v1.5.0. Gene counts below a threshold of 20 raw counts were filtered and raw counts were normalized (DESeq2).,Assembly: GRCh38, v.93,Supplementary files format and content: AML_Severin_count_matrix_aggregated.csv | Cell pellets were lysed in TriZol and RNA was extracted Quick-RNA MiniPrep Kit by Zymo according to the manufacturers instructions.,CDNA libraries were obtained according to Picelli, S. et al. Genome Res. 24, 2033â2040 (2014). Illumina library was obtained via tagmentation using Illumina Nextera Kit. All samples were sequenced in a single run on a NovaSeq6000 (single read, 100bp, depth 20 Mio reads per sample) | GSM8409172 | Illumina NovaSeq 6000 | Jul 20 2024 | cDNA | transcriptomic | RNA-Seq | polyA RNA | Homo sapiens | GPL24676 | BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN42654383,SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX25392693 | GSM8409172 | GSE272681 | 0.010209 | blood | Public on Jul 20 2024 | Jul 19 2024 | 9606 | Patient AML048, blood, time point 2, Batch 3 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX25392693 | https://www.ncbi.nlm.nih.gov/biosample/SAMN42654383 |
|
1 | tissue: bonemarrow | Otto-Stern-Weg 3 | Zuerich | Switzerland | ETH Zurich | Yannik,,Severin | Illumina adapters, sequences of poor quality as well as polyA and polyT sequences were removed from the raw reads using TrimGalore v.0.6.0 with cutadapt v.2.0 prior to alignment. Reads were then aligned to the human reference genome GRCh38, v93 (Ensembl) using STAR v. 2.5.3a. Read per genes were counted with featureCounts v1.5.0. Gene counts below a threshold of 20 raw counts were filtered and raw counts were normalized (DESeq2).,Assembly: GRCh38, v.93,Supplementary files format and content: AML_Severin_count_matrix_aggregated.csv | Cell pellets were lysed in TriZol and RNA was extracted Quick-RNA MiniPrep Kit by Zymo according to the manufacturers instructions.,CDNA libraries were obtained according to Picelli, S. et al. Genome Res. 24, 2033â2040 (2014). Illumina library was obtained via tagmentation using Illumina Nextera Kit. All samples were sequenced in a single run on a NovaSeq6000 (single read, 100bp, depth 20 Mio reads per sample) | GSM8409173 | Illumina NovaSeq 6000 | Jul 20 2024 | cDNA | transcriptomic | RNA-Seq | polyA RNA | Homo sapiens | GPL24676 | BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN42654382,SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX25392694 | GSM8409173 | GSE272681 | 0.001919 | bonemarrow | Public on Jul 20 2024 | Jul 19 2024 | 9606 | Patient AML050, bonemarrow, time point 2, Batch 3 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX25392694 | https://www.ncbi.nlm.nih.gov/biosample/SAMN42654382 |
|
1 | tissue: bonemarrow | Otto-Stern-Weg 3 | Zuerich | Switzerland | ETH Zurich | Yannik,,Severin | Illumina adapters, sequences of poor quality as well as polyA and polyT sequences were removed from the raw reads using TrimGalore v.0.6.0 with cutadapt v.2.0 prior to alignment. Reads were then aligned to the human reference genome GRCh38, v93 (Ensembl) using STAR v. 2.5.3a. Read per genes were counted with featureCounts v1.5.0. Gene counts below a threshold of 20 raw counts were filtered and raw counts were normalized (DESeq2).,Assembly: GRCh38, v.93,Supplementary files format and content: AML_Severin_count_matrix_aggregated.csv | Cell pellets were lysed in TriZol and RNA was extracted Quick-RNA MiniPrep Kit by Zymo according to the manufacturers instructions.,CDNA libraries were obtained according to Picelli, S. et al. Genome Res. 24, 2033â2040 (2014). Illumina library was obtained via tagmentation using Illumina Nextera Kit. All samples were sequenced in a single run on a NovaSeq6000 (single read, 100bp, depth 20 Mio reads per sample) | GSM8409174 | Illumina NovaSeq 6000 | Jul 20 2024 | cDNA | transcriptomic | RNA-Seq | polyA RNA | Homo sapiens | GPL24676 | BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN42654381,SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX25392695 | GSM8409174 | GSE272681 | 0.004755 | bonemarrow | Public on Jul 20 2024 | Jul 19 2024 | 9606 | Patient AML050, bonemarrow, time point 3, Batch 3 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX25392695 | https://www.ncbi.nlm.nih.gov/biosample/SAMN42654381 |
|
1 | tissue: blood | Otto-Stern-Weg 3 | Zuerich | Switzerland | ETH Zurich | Yannik,,Severin | Illumina adapters, sequences of poor quality as well as polyA and polyT sequences were removed from the raw reads using TrimGalore v.0.6.0 with cutadapt v.2.0 prior to alignment. Reads were then aligned to the human reference genome GRCh38, v93 (Ensembl) using STAR v. 2.5.3a. Read per genes were counted with featureCounts v1.5.0. Gene counts below a threshold of 20 raw counts were filtered and raw counts were normalized (DESeq2).,Assembly: GRCh38, v.93,Supplementary files format and content: AML_Severin_count_matrix_aggregated.csv | Cell pellets were lysed in TriZol and RNA was extracted Quick-RNA MiniPrep Kit by Zymo according to the manufacturers instructions.,CDNA libraries were obtained according to Picelli, S. et al. Genome Res. 24, 2033â2040 (2014). Illumina library was obtained via tagmentation using Illumina Nextera Kit. All samples were sequenced in a single run on a NovaSeq6000 (single read, 100bp, depth 20 Mio reads per sample) | GSM8409175 | Illumina NovaSeq 6000 | Jul 20 2024 | cDNA | transcriptomic | RNA-Seq | polyA RNA | Homo sapiens | GPL24676 | BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN42654380,SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX25392696 | GSM8409175 | GSE272681 | 0.001201 | blood | Public on Jul 20 2024 | Jul 19 2024 | 9606 | Patient AML050, blood, time point 2, Batch 3 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX25392696 | https://www.ncbi.nlm.nih.gov/biosample/SAMN42654380 |
|
1 | tissue: blood | Otto-Stern-Weg 3 | Zuerich | Switzerland | ETH Zurich | Yannik,,Severin | Illumina adapters, sequences of poor quality as well as polyA and polyT sequences were removed from the raw reads using TrimGalore v.0.6.0 with cutadapt v.2.0 prior to alignment. Reads were then aligned to the human reference genome GRCh38, v93 (Ensembl) using STAR v. 2.5.3a. Read per genes were counted with featureCounts v1.5.0. Gene counts below a threshold of 20 raw counts were filtered and raw counts were normalized (DESeq2).,Assembly: GRCh38, v.93,Supplementary files format and content: AML_Severin_count_matrix_aggregated.csv | Cell pellets were lysed in TriZol and RNA was extracted Quick-RNA MiniPrep Kit by Zymo according to the manufacturers instructions.,CDNA libraries were obtained according to Picelli, S. et al. Genome Res. 24, 2033â2040 (2014). Illumina library was obtained via tagmentation using Illumina Nextera Kit. All samples were sequenced in a single run on a NovaSeq6000 (single read, 100bp, depth 20 Mio reads per sample) | GSM8409176 | Illumina NovaSeq 6000 | Jul 20 2024 | cDNA | transcriptomic | RNA-Seq | polyA RNA | Homo sapiens | GPL24676 | BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN42654379,SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX25392697 | GSM8409176 | GSE272681 | 0.004755 | blood | Public on Jul 20 2024 | Jul 19 2024 | 9606 | Patient AML050, blood, time point 3, Batch 3 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX25392697 | https://www.ncbi.nlm.nih.gov/biosample/SAMN42654379 |
|
1 | tissue: blood | Otto-Stern-Weg 3 | Zuerich | Switzerland | ETH Zurich | Yannik,,Severin | Illumina adapters, sequences of poor quality as well as polyA and polyT sequences were removed from the raw reads using TrimGalore v.0.6.0 with cutadapt v.2.0 prior to alignment. Reads were then aligned to the human reference genome GRCh38, v93 (Ensembl) using STAR v. 2.5.3a. Read per genes were counted with featureCounts v1.5.0. Gene counts below a threshold of 20 raw counts were filtered and raw counts were normalized (DESeq2).,Assembly: GRCh38, v.93,Supplementary files format and content: AML_Severin_count_matrix_aggregated.csv | Cell pellets were lysed in TriZol and RNA was extracted Quick-RNA MiniPrep Kit by Zymo according to the manufacturers instructions.,CDNA libraries were obtained according to Picelli, S. et al. Genome Res. 24, 2033â2040 (2014). Illumina library was obtained via tagmentation using Illumina Nextera Kit. All samples were sequenced in a single run on a NovaSeq6000 (single read, 100bp, depth 20 Mio reads per sample) | GSM8409177 | Illumina NovaSeq 6000 | Jul 20 2024 | cDNA | transcriptomic | RNA-Seq | polyA RNA | Homo sapiens | GPL24676 | BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN42654378,SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX25392699 | GSM8409177 | GSE272681 | 0.001403 | blood | Public on Jul 20 2024 | Jul 19 2024 | 9606 | Patient AML051, blood, time point 1, Batch 3 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX25392699 | https://www.ncbi.nlm.nih.gov/biosample/SAMN42654378 |
|
1 | cell type: immortalised chronic myelogenous leukemia (CML),cell line: K562,sample type: K-562 truseq 10000ng,average insert size: 229,std. dev. insert size: 172.945267 | 7 Cambridge Center | Cambridge | USA | Broad Institute ; Harvard University | Nataly,Moran,Cabili | All files were mapped against Hg19 using TopHat 1.1.4 | Illumina TruSeq RNA sample prep kit used with these changes: SuperScript III instead of SuperScript II & optimization of PCR cycle number,RNA purchased from Ambion/ABI | GSM854404 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX113647,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00769223 | GSM854404 | GSE34740 | 0.008433 | K-562 cell line | Public on Nov 14 2012 | Dec 27 2011 | 9606 | K-562 truseq 10000ng | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX113647 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00769223 |
|
1 | cell type: immortalised chronic myelogenous leukemia (CML),cell line: K562,sample type: K-562 truseq 3000ng,average insert size: 239,std. dev. insert size: 185.42764 | 7 Cambridge Center | Cambridge | USA | Broad Institute ; Harvard University | Nataly,Moran,Cabili | All files were mapped against Hg19 using TopHat 1.1.4 | Illumina TruSeq RNA sample prep kit used with these changes: SuperScript III instead of SuperScript II & optimization of PCR cycle number,RNA purchased from Ambion/ABI | GSM854405 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX113648,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00769224 | GSM854405 | GSE34740 | 0.031873 | K-562 cell line | Public on Nov 14 2012 | Dec 27 2011 | 9606 | K-562 truseq 3000ng | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX113648 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00769224 |
|
1 | cell type: immortalised chronic myelogenous leukemia (CML),cell line: K562,sample type: K-562 truseq 1000ng,average insert size: 229,std. dev. insert size: 173.245305 | 7 Cambridge Center | Cambridge | USA | Broad Institute ; Harvard University | Nataly,Moran,Cabili | All files were mapped against Hg19 using TopHat 1.1.4 | Illumina TruSeq RNA sample prep kit used with these changes: SuperScript III instead of SuperScript II & optimization of PCR cycle number,RNA purchased from Ambion/ABI | GSM854406 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX113649,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00769225 | GSM854406 | GSE34740 | 0.031537 | K-562 cell line | Public on Nov 14 2012 | Dec 27 2011 | 9606 | K-562 truseq 1000ng | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX113649 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00769225 |
|
1 | cell type: immortalised chronic myelogenous leukemia (CML),cell line: K562,sample type: K-562 truseq 500ng,average insert size: 268,std. dev. insert size: 227.16942 | 7 Cambridge Center | Cambridge | USA | Broad Institute ; Harvard University | Nataly,Moran,Cabili | All files were mapped against Hg19 using TopHat 1.1.4 | Illumina TruSeq RNA sample prep kit used with these changes: SuperScript III instead of SuperScript II & optimization of PCR cycle number,RNA purchased from Ambion/ABI | GSM854407 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX113650,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00769226 | GSM854407 | GSE34740 | 0.037985 | K-562 cell line | Public on Nov 14 2012 | Dec 27 2011 | 9606 | K-562 truseq 500ng | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX113650 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00769226 |
|
1 | cell type: immortalised chronic myelogenous leukemia (CML),cell line: K562,sample type: K-562 truseq 250ng,average insert size: 249,std. dev. insert size: 203.395985 | 7 Cambridge Center | Cambridge | USA | Broad Institute ; Harvard University | Nataly,Moran,Cabili | All files were mapped against Hg19 using TopHat 1.1.4 | Illumina TruSeq RNA sample prep kit used with these changes: SuperScript III instead of SuperScript II & optimization of PCR cycle number,RNA purchased from Ambion/ABI | GSM854408 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX113651,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00769227 | GSM854408 | GSE34740 | 0.030711 | K-562 cell line | Public on Nov 14 2012 | Dec 27 2011 | 9606 | K-562 truseq 250ng | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX113651 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00769227 |
|
1 | cell type: immortalised chronic myelogenous leukemia (CML),cell line: K562,sample type: K-562 truseq 100ng,average insert size: 237,std. dev. insert size: 179.351572 | 7 Cambridge Center | Cambridge | USA | Broad Institute ; Harvard University | Nataly,Moran,Cabili | All files were mapped against Hg19 using TopHat 1.1.4 | Illumina TruSeq RNA sample prep kit used with these changes: SuperScript III instead of SuperScript II & optimization of PCR cycle number,RNA purchased from Ambion/ABI | GSM854409 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX113652,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00769228 | GSM854409 | GSE34740 | 0.040873 | K-562 cell line | Public on Nov 14 2012 | Dec 27 2011 | 9606 | K-562 truseq 100ng | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX113652 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00769228 |
|
1 | cell type: immortalised chronic myelogenous leukemia (CML),cell line: K562,sample type: K-562 truseq 50ng,average insert size: 230,std. dev. insert size: 170.945188 | 7 Cambridge Center | Cambridge | USA | Broad Institute ; Harvard University | Nataly,Moran,Cabili | All files were mapped against Hg19 using TopHat 1.1.4 | Illumina TruSeq RNA sample prep kit used with these changes: SuperScript III instead of SuperScript II & optimization of PCR cycle number,RNA purchased from Ambion/ABI | GSM854410 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX113653,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00769229 | GSM854410 | GSE34740 | 0.030859 | K-562 cell line | Public on Nov 14 2012 | Dec 27 2011 | 9606 | K-562 truseq 50ng | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX113653 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00769229 |
|
1 | cell type: immortalised chronic myelogenous leukemia (CML),cell line: K562,sample type: K-562 truseq 30ng,average insert size: 235,std. dev. insert size: 173.524507 | 7 Cambridge Center | Cambridge | USA | Broad Institute ; Harvard University | Nataly,Moran,Cabili | All files were mapped against Hg19 using TopHat 1.1.4 | Illumina TruSeq RNA sample prep kit used with these changes: SuperScript III instead of SuperScript II & optimization of PCR cycle number,RNA purchased from Ambion/ABI | GSM854411 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX113654,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00769230 | GSM854411 | GSE34740 | 0.02132 | K-562 cell line | Public on Nov 14 2012 | Dec 27 2011 | 9606 | K-562 truseq 30ng | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX113654 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00769230 |
|
1 | cell line: hormone resistant LNCaP-abl,genotype/variation: Control knockdown (Control siRNA) | 9500 Gilman Dr. | La Jolla | USA | University of California, San Diego | Hai-Ri,,Li | The tags were mapped to the reference human genome( hg19) with Bowtie by allowing maximum 2 mismatches in the first 28 nt.,Genome Build:,LNCaP_abl_Control_KD_rep1.bed: hg19 | RNAs were extracted from LNCaP-abl cells using TRIzol Reagent (Life Technologies, cat# 15596-026) . The cDNAs were synthesized with biotinylated P7-dT(20) oligos by reverse transcription and captured to solid phase. The second strand cDNAs were made with Adpator-hexamer by extension using DNA polymerase. The second strand cDNAs were PCR amplified with P7 and P5-index-Adaptor primers. The PCR products were size-selected, pooled and subjected to Illumina sequencers, reading target sequences followed by reading index (Genomics. 2011:98;266) | GSM862352 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX116033,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00773622 | GSM862352 | GSE35126 | 0.09777 | prostate cancer | Public on Apr 04 2012 | Jan 16 2012 | 9606 | LNCaP_abl_Control_KD_rep1 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX116033 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00773622 |
|
1 | cell line: hormone resistant LNCaP-abl,genotype/variation: Control knockdown (Control siRNA) | 9500 Gilman Dr. | La Jolla | USA | University of California, San Diego | Hai-Ri,,Li | The tags were mapped to the reference human genome( hg19) with Bowtie by allowing maximum 2 mismatches in the first 28 nt.,Genome Build:,LNCaP_abl_Control_KD_rep2.bed: hg19 | RNAs were extracted from LNCaP-abl cells using TRIzol Reagent (Life Technologies, cat# 15596-026) . The cDNAs were synthesized with biotinylated P7-dT(20) oligos by reverse transcription and captured to solid phase. The second strand cDNAs were made with Adpator-hexamer by extension using DNA polymerase. The second strand cDNAs were PCR amplified with P7 and P5-index-Adaptor primers. The PCR products were size-selected, pooled and subjected to Illumina sequencers, reading target sequences followed by reading index (Genomics. 2011:98;266) | GSM862353 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX116034,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00773623 | GSM862353 | GSE35126 | 0.160743 | prostate cancer | Public on Apr 04 2012 | Jan 16 2012 | 9606 | LNCaP_abl_Control_KD_rep2 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX116034 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00773623 |
|
1 | cell line: hormone resistant LNCaP-abl,genotype/variation: Control knockdown (Control siRNA) | 9500 Gilman Dr. | La Jolla | USA | University of California, San Diego | Hai-Ri,,Li | The tags were mapped to the reference human genome( hg19) with Bowtie by allowing maximum 2 mismatches in the first 28 nt.,Genome Build:,LNCaP_abl_Control_KD_rep3.bed: hg19 | RNAs were extracted from LNCaP-abl cells using TRIzol Reagent (Life Technologies, cat# 15596-026) . The cDNAs were synthesized with biotinylated P7-dT(20) oligos by reverse transcription and captured to solid phase. The second strand cDNAs were made with Adpator-hexamer by extension using DNA polymerase. The second strand cDNAs were PCR amplified with P7 and P5-index-Adaptor primers. The PCR products were size-selected, pooled and subjected to Illumina sequencers, reading target sequences followed by reading index (Genomics. 2011:98;266) | GSM862354 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX116035,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00773624 | GSM862354 | GSE35126 | 0.065488 | prostate cancer | Public on Apr 04 2012 | Jan 16 2012 | 9606 | LNCaP_abl_Control_KD_rep3 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX116035 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00773624 |
|
1 | cell line: hormone resistant LNCaP-abl,genotype/variation: AR knockdown (AR siRNA) | 9500 Gilman Dr. | La Jolla | USA | University of California, San Diego | Hai-Ri,,Li | The tags were mapped to the reference human genome( hg19) with Bowtie by allowing maximum 2 mismatches in the first 28 nt.,Genome Build:,LNCaP_abl_AR_KD_rep1.bed: hg19 | RNAs were extracted from LNCaP-abl cells using TRIzol Reagent (Life Technologies, cat# 15596-026) . The cDNAs were synthesized with biotinylated P7-dT(20) oligos by reverse transcription and captured to solid phase. The second strand cDNAs were made with Adpator-hexamer by extension using DNA polymerase. The second strand cDNAs were PCR amplified with P7 and P5-index-Adaptor primers. The PCR products were size-selected, pooled and subjected to Illumina sequencers, reading target sequences followed by reading index (Genomics. 2011:98;266) | GSM862355 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX116036,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00773625 | GSM862355 | GSE35126 | 0.408604 | prostate cancer | Public on Apr 04 2012 | Jan 16 2012 | 9606 | LNCaP_abl_AR_KD_rep1 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX116036 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00773625 |
|
1 | cell line: hormone resistant LNCaP-abl,genotype/variation: AR knockdown (AR siRNA) | 9500 Gilman Dr. | La Jolla | USA | University of California, San Diego | Hai-Ri,,Li | The tags were mapped to the reference human genome( hg19) with Bowtie by allowing maximum 2 mismatches in the first 28 nt.,Genome Build:,LNCaP_abl_AR_KD_rep2.bed: hg19 | RNAs were extracted from LNCaP-abl cells using TRIzol Reagent (Life Technologies, cat# 15596-026) . The cDNAs were synthesized with biotinylated P7-dT(20) oligos by reverse transcription and captured to solid phase. The second strand cDNAs were made with Adpator-hexamer by extension using DNA polymerase. The second strand cDNAs were PCR amplified with P7 and P5-index-Adaptor primers. The PCR products were size-selected, pooled and subjected to Illumina sequencers, reading target sequences followed by reading index (Genomics. 2011:98;266) | GSM862356 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX116037,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00773626 | GSM862356 | GSE35126 | 0.329775 | prostate cancer | Public on Apr 04 2012 | Jan 16 2012 | 9606 | LNCaP_abl_AR_KD_rep2 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX116037 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00773626 |
|
1 | cell line: hormone resistant LNCaP-abl,genotype/variation: AR knockdown (AR siRNA) | 9500 Gilman Dr. | La Jolla | USA | University of California, San Diego | Hai-Ri,,Li | The tags were mapped to the reference human genome( hg19) with Bowtie by allowing maximum 2 mismatches in the first 28 nt.,Genome Build:,LNCaP_abl_AR_KD_rep3.bed: hg19 | RNAs were extracted from LNCaP-abl cells using TRIzol Reagent (Life Technologies, cat# 15596-026) . The cDNAs were synthesized with biotinylated P7-dT(20) oligos by reverse transcription and captured to solid phase. The second strand cDNAs were made with Adpator-hexamer by extension using DNA polymerase. The second strand cDNAs were PCR amplified with P7 and P5-index-Adaptor primers. The PCR products were size-selected, pooled and subjected to Illumina sequencers, reading target sequences followed by reading index (Genomics. 2011:98;266) | GSM862357 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX116038,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00773627 | GSM862357 | GSE35126 | 0.410823 | prostate cancer | Public on Apr 04 2012 | Jan 16 2012 | 9606 | LNCaP_abl_AR_KD_rep3 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX116038 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00773627 |
|
1 | cell type: primary keratinocytes,day of differentiation: d0 | 269 Campus Drive | Stanford | USA | Stanford | Douglas,,Porter | Reads in each sample were aligned to hg18 using TopHat and reference annotation based transcriptome assembly was performed with Cufflinks. Differential expression analysis was performed with the Cuffdiff module of Cufflinks.,Genome Build:,d0_kc_diff.bw: hg18 | Illumina PE RNA seq library prep protocol | GSM869033 | Illumina HiSeq 2000 | Oct 11 2022 | cDNA | transcriptomic | RNA-Seq | polyA RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX118281,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00779914 | GSM869033 | GSE35468,GSE58161 | 0.005385 | Primary human keratinocytes | Public on Feb 02 2012 | Feb 01 2012 | 9606 | d0_kc_diff_1 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX118281 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00779914 |
|
1 | cell type: primary keratinocytes,day of differentiation: d6 | 269 Campus Drive | Stanford | USA | Stanford | Douglas,,Porter | Reads in each sample were aligned to hg18 using TopHat and reference annotation based transcriptome assembly was performed with Cufflinks. Differential expression analysis was performed with the Cuffdiff module of Cufflinks.,Genome Build:,d6_kc_diff.bw: hg18 | Illumina PE RNA seq library prep protocol | GSM869035 | Illumina HiSeq 2000 | Oct 11 2022 | cDNA | transcriptomic | RNA-Seq | polyA RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX118283,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00779916 | GSM869035 | GSE35468,GSE58161 | 0.010884 | Primary human keratinocytes | Public on Feb 02 2012 | Feb 01 2012 | 9606 | d6_kc_diff_1 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX118283 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00779916 |
|
1 | cell line: A549,infected with: none (uninfected),time post infection: 0h,antibody: anti-deoxyBrU,molecule type: Nuclear-Run On RNA | 1230 York Avenue | new york | USA | rockefeller univeristy | ivan,,marazzi | ChIP-Seq libraries were aligned to hg18 using bowtie, allowing 2 mismatches to the reference and no ambiguously mapping reads. RNA-Seq libraries were processed using TopHat/Cufflinks against hg18, allowing 20 max hits to the reference per read.,GRO-Seq libraries were aligned to hg18 after being trimmed of 5' and 3' adapters, using bowtie, allowing 2 mismatches for trimmed reads and 3 for untrimmed reads. These were merged and processed in a strand-specific manner for integrated profiling,Genome Build:,GroSeq_sample1_rmdup_merged.bam.bed: hg18 | Lysates were clarified from sonicated nuclei and histone-DNA complexes were isolated with antibody. Libraries were prepared according to Illumina's instructions | GSM874647 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX119647,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00788781 | GSM874647 | GSE35268,GSE35774 | 0 | A549 cells | Public on Jul 01 2013 | Feb 13 2012 | 9606 | GRO-Seq 0h | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX119647 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00788781 |
|
1 | cell line: A549,infected with: Flag-NS1 virus,time post infection: 12h,antibody: anti-deoxyBrU,molecule type: Nuclear-Run On RNA | 1230 York Avenue | new york | USA | rockefeller univeristy | ivan,,marazzi | ChIP-Seq libraries were aligned to hg18 using bowtie, allowing 2 mismatches to the reference and no ambiguously mapping reads. RNA-Seq libraries were processed using TopHat/Cufflinks against hg18, allowing 20 max hits to the reference per read.,GRO-Seq libraries were aligned to hg18 after being trimmed of 5' and 3' adapters, using bowtie, allowing 2 mismatches for trimmed reads and 3 for untrimmed reads. These were merged and processed in a strand-specific manner for integrated profiling,Genome Build:,GroSeq_sample4_rmdup_merged.bam.bed: hg18 | Lysates were clarified from sonicated nuclei and histone-DNA complexes were isolated with antibody. Libraries were prepared according to Illumina's instructions | GSM874648 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX119648,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00788782 | GSM874648 | GSE35268,GSE35774 | 0 | A549 cells | Public on Jul 01 2013 | Feb 13 2012 | 9606 | GRO-Seq 12h WT | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX119648 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00788782 |
|
1 | cell line: A549,infected with: Flag-âPAF virus,time post infection: 12h,antibody: anti-deoxyBrU,molecule type: Nuclear-Run On RNA | 1230 York Avenue | new york | USA | rockefeller univeristy | ivan,,marazzi | ChIP-Seq libraries were aligned to hg18 using bowtie, allowing 2 mismatches to the reference and no ambiguously mapping reads. RNA-Seq libraries were processed using TopHat/Cufflinks against hg18, allowing 20 max hits to the reference per read.,GRO-Seq libraries were aligned to hg18 after being trimmed of 5' and 3' adapters, using bowtie, allowing 2 mismatches for trimmed reads and 3 for untrimmed reads. These were merged and processed in a strand-specific manner for integrated profiling,Genome Build:,GroSeq_sample5_rmdup_merged.bam.bed: hg18 | Lysates were clarified from sonicated nuclei and histone-DNA complexes were isolated with antibody. Libraries were prepared according to Illumina's instructions | GSM874649 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX119649,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00788783 | GSM874649 | GSE35268,GSE35774 | 0 | A549 cells | Public on Jul 01 2013 | Feb 13 2012 | 9606 | GRO-Seq 12h delta-PAF | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX119649 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00788783 |
|
1 | cell type: human preimplantation blastomere (Oocyte),developmental stage: early blastomere,tissue: human preimplantation embryos | 5 Yiheyuan Road | Beijing | China | Peking University | Mingyu,,Yang | Reads mapping:We used Burrows-Wheeler Aligner (BWA, Version 0.5.9-r16) to align the clean reads to the hg19 Refseq, with the options "aln -o 1 -e 60 -i 15 -q 10 -t 8". [Ref: Li H. and Durbin R. (2009) Fast and accurate short read alignment with Burrows-Wheeler Transform. Bioinformatics, 25:1754-60],Expression level analysis : The gene expression level was calculated by using RPKM method, We used all genes with RPKM ⥠0.1 as expressed genes in the following analysis.,Use BEDTools(Version-2.16.2) to transform *.bam files into *.bed files.[Ref: Aaron R. Quinlan and Ira M. Hall. (2010) BEDTools: a flexible suite of utilities for comparing genomic features,Bioinformatics (2010), 26: 841-842],Merge the *.bed files from samples in the same stage [available on Series records],Use IGVtools to transform the merged *.bed files into *.tdf files for visualization [available on Series records],Genome_build: hg19,Sample_M21.expression.txt: hg19 | Amplied single cell cDNAs were further amplied for another ten cycles of PCR. Then it was sonicated into 200~500bp fragments ,then the standard TruSeq DNA library preparation kit was used following the manufacturer suggestion protocol | GSM896803 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX129997,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00828830 | GSM896803 | GSE36552 | 0.245065 | cDNAs of individual cells of preimplantation embryos | Public on Aug 10 2013 | Mar 16 2012 | 9606 | Oocyte #1 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX129997 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00828830 |
|
1 | cell type: human preimplantation blastomere (Oocyte),developmental stage: early blastomere,tissue: human preimplantation embryos | 5 Yiheyuan Road | Beijing | China | Peking University | Mingyu,,Yang | Reads mapping:We used Burrows-Wheeler Aligner (BWA, Version 0.5.9-r16) [1] to align the clean reads to the hg19 Refseq, with the options "aln -o 1 -e 60 -i 15 -q 10 -t 8". [1]. Li H. and Durbin R. (2009) Fast and accurate short read alignment with Burrows-Wheeler Transform. Bioinformatics, 25:1754-60.,Expression level analysis : The gene expression level was calculated by using RPKM method, We used all genes with RPKM ⥠0.1 as expressed genes in the following analysis.,Use BEDTools(Version-2.16.2) to transform *.bam files into *.bed files.[Ref: Aaron R. Quinlan and Ira M. Hall. (2010) BEDTools: a flexible suite of utilities for comparing genomic features,Bioinformatics (2010), 26: 841-842],Merge the *.bed files from samples in the same stage [available on Series records],Use IGVtools to transform the merged *.bed files into *.tdf files for visualization [available on Series records],Genome_build: hg19,Sample_M22.expression.txt: hg19 | Amplied single cell cDNAs were further amplied for another ten cycles of PCR. Then it was sonicated into 200~500bp fragments ,then the standard TruSeq DNA library preparation kit was used following the manufacturer suggestion protocol | GSM896804 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX129998,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00828831 | GSM896804 | GSE36552 | 0.199835 | cDNAs of individual cells of preimplantation embryos | Public on Aug 10 2013 | Mar 16 2012 | 9606 | Oocyte #2 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX129998 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00828831 |
|
1 | cell type: human preimplantation blastomere (Oocyte),developmental stage: early blastomere,tissue: human preimplantation embryos | 5 Yiheyuan Road | Beijing | China | Peking University | Mingyu,,Yang | Reads mapping:We used Burrows-Wheeler Aligner (BWA, Version 0.5.9-r16) [1] to align the clean reads to the hg19 Refseq, with the options "aln -o 1 -e 60 -i 15 -q 10 -t 8". [1]. Li H. and Durbin R. (2009) Fast and accurate short read alignment with Burrows-Wheeler Transform. Bioinformatics, 25:1754-60.,Expression level analysis : The gene expression level was calculated by using RPKM method, We used all genes with RPKM ⥠0.1 as expressed genes in the following analysis.,Use BEDTools(Version-2.16.2) to transform *.bam files into *.bed files.[Ref: Aaron R. Quinlan and Ira M. Hall. (2010) BEDTools: a flexible suite of utilities for comparing genomic features,Bioinformatics (2010), 26: 841-842],Merge the *.bed files from samples in the same stage [available on Series records],Use IGVtools to transform the merged *.bed files into *.tdf files for visualization [available on Series records],Genome_build: hg19,Sample_M23.expression.txt: hg19 | Amplied single cell cDNAs were further amplied for another ten cycles of PCR. Then it was sonicated into 200~500bp fragments ,then the standard TruSeq DNA library preparation kit was used following the manufacturer suggestion protocol | GSM896805 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX129999,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00828832 | GSM896805 | GSE36552 | 0.209247 | cDNAs of individual cells of preimplantation embryos | Public on Aug 10 2013 | Mar 16 2012 | 9606 | Oocyte #3 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX129999 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00828832 |
|
1 | cell type: human preimplantation blastomere (zygote),developmental stage: early blastomere,tissue: human preimplantation embryos | 5 Yiheyuan Road | Beijing | China | Peking University | Mingyu,,Yang | Reads mapping:We used Burrows-Wheeler Aligner (BWA, Version 0.5.9-r16) [1] to align the clean reads to the hg19 Refseq, with the options "aln -o 1 -e 60 -i 15 -q 10 -t 8". [1]. Li H. and Durbin R. (2009) Fast and accurate short read alignment with Burrows-Wheeler Transform. Bioinformatics, 25:1754-60.,Expression level analysis : The gene expression level was calculated by using RPKM method, We used all genes with RPKM ⥠0.1 as expressed genes in the following analysis.,Use BEDTools(Version-2.16.2) to transform *.bam files into *.bed files.[Ref: Aaron R. Quinlan and Ira M. Hall. (2010) BEDTools: a flexible suite of utilities for comparing genomic features,Bioinformatics (2010), 26: 841-842],Merge the *.bed files from samples in the same stage [available on Series records],Use IGVtools to transform the merged *.bed files into *.tdf files for visualization [available on Series records],Genome_build: hg19,Sample_C1.expression.txt: hg19 | Amplied single cell cDNAs were further amplied for another ten cycles of PCR. Then it was sonicated into 200~500bp fragments ,then the standard TruSeq DNA library preparation kit was used following the manufacturer suggestion protocol | GSM896806 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX130000,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00828833 | GSM896806 | GSE36552 | 0.226397 | cDNAs of individual cells of preimplantation embryos | Public on Aug 10 2013 | Mar 16 2012 | 9606 | Zygote #1 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX130000 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00828833 |
|
1 | cell type: human preimplantation blastomere (zygote),developmental stage: early blastomere,tissue: human preimplantation embryos | 5 Yiheyuan Road | Beijing | China | Peking University | Mingyu,,Yang | Reads mapping:We used Burrows-Wheeler Aligner (BWA, Version 0.5.9-r16) [1] to align the clean reads to the hg19 Refseq, with the options "aln -o 1 -e 60 -i 15 -q 10 -t 8". [1]. Li H. and Durbin R. (2009) Fast and accurate short read alignment with Burrows-Wheeler Transform. Bioinformatics, 25:1754-60.,Expression level analysis : The gene expression level was calculated by using RPKM method, We used all genes with RPKM ⥠0.1 as expressed genes in the following analysis.,Use BEDTools(Version-2.16.2) to transform *.bam files into *.bed files.[Ref: Aaron R. Quinlan and Ira M. Hall. (2010) BEDTools: a flexible suite of utilities for comparing genomic features,Bioinformatics (2010), 26: 841-842],Merge the *.bed files from samples in the same stage [available on Series records],Use IGVtools to transform the merged *.bed files into *.tdf files for visualization [available on Series records],Genome_build: hg19,Sample_C2.expression.txt: hg19 | Amplied single cell cDNAs were further amplied for another ten cycles of PCR. Then it was sonicated into 200~500bp fragments ,then the standard TruSeq DNA library preparation kit was used following the manufacturer suggestion protocol | GSM896807 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX130001,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00828834 | GSM896807 | GSE36552 | 0.242811 | cDNAs of individual cells of preimplantation embryos | Public on Aug 10 2013 | Mar 16 2012 | 9606 | Zygote #2 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX130001 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00828834 |
|
1 | cell type: human preimplantation blastomere (zygote),developmental stage: early blastomere,tissue: human preimplantation embryos | 5 Yiheyuan Road | Beijing | China | Peking University | Mingyu,,Yang | Reads mapping:We used Burrows-Wheeler Aligner (BWA, Version 0.5.9-r16) [1] to align the clean reads to the hg19 Refseq, with the options "aln -o 1 -e 60 -i 15 -q 10 -t 8". [1]. Li H. and Durbin R. (2009) Fast and accurate short read alignment with Burrows-Wheeler Transform. Bioinformatics, 25:1754-60.,Expression level analysis : The gene expression level was calculated by using RPKM method, We used all genes with RPKM ⥠0.1 as expressed genes in the following analysis.,Use BEDTools(Version-2.16.2) to transform *.bam files into *.bed files.[Ref: Aaron R. Quinlan and Ira M. Hall. (2010) BEDTools: a flexible suite of utilities for comparing genomic features,Bioinformatics (2010), 26: 841-842],Merge the *.bed files from samples in the same stage [available on Series records],Use IGVtools to transform the merged *.bed files into *.tdf files for visualization [available on Series records],Genome_build: hg19,Sample_C3.expression.txt: hg19 | Amplied single cell cDNAs were further amplied for another ten cycles of PCR. Then it was sonicated into 200~500bp fragments ,then the standard TruSeq DNA library preparation kit was used following the manufacturer suggestion protocol | GSM896808 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX130002,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00828835 | GSM896808 | GSE36552 | 0.154649 | cDNAs of individual cells of preimplantation embryos | Public on Aug 10 2013 | Mar 16 2012 | 9606 | Zygote #3 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX130002 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00828835 |
|
1 | cell type: human preimplantation blastomere (2-cell),developmental stage: early blastomere,tissue: human preimplantation embryos | 5 Yiheyuan Road | Beijing | China | Peking University | Mingyu,,Yang | Reads mapping:We used Burrows-Wheeler Aligner (BWA, Version 0.5.9-r16) [1] to align the clean reads to the hg19 Refseq, with the options "aln -o 1 -e 60 -i 15 -q 10 -t 8". [1]. Li H. and Durbin R. (2009) Fast and accurate short read alignment with Burrows-Wheeler Transform. Bioinformatics, 25:1754-60.,Expression level analysis : The gene expression level was calculated by using RPKM method, We used all genes with RPKM ⥠0.1 as expressed genes in the following analysis.,Use BEDTools(Version-2.16.2) to transform *.bam files into *.bed files.[Ref: Aaron R. Quinlan and Ira M. Hall. (2010) BEDTools: a flexible suite of utilities for comparing genomic features,Bioinformatics (2010), 26: 841-842],Merge the *.bed files from samples in the same stage [available on Series records],Use IGVtools to transform the merged *.bed files into *.tdf files for visualization [available on Series records],Genome_build: hg19,Sample_B1.expression.txt: hg19 | Amplied single cell cDNAs were further amplied for another ten cycles of PCR. Then it was sonicated into 200~500bp fragments ,then the standard TruSeq DNA library preparation kit was used following the manufacturer suggestion protocol | GSM896809 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX130003,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00828836 | GSM896809 | GSE36552 | 0.355378 | cDNAs of individual cells of preimplantation embryos | Public on Aug 10 2013 | Mar 16 2012 | 9606 | 2-cell embryo#1 -Cell#1 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX130003 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00828836 |
|
1 | cell type: human preimplantation blastomere (2-cell),developmental stage: early blastomere,tissue: human preimplantation embryos | 5 Yiheyuan Road | Beijing | China | Peking University | Mingyu,,Yang | Reads mapping:We used Burrows-Wheeler Aligner (BWA, Version 0.5.9-r16) [1] to align the clean reads to the hg19 Refseq, with the options "aln -o 1 -e 60 -i 15 -q 10 -t 8". [1]. Li H. and Durbin R. (2009) Fast and accurate short read alignment with Burrows-Wheeler Transform. Bioinformatics, 25:1754-60.,Expression level analysis : The gene expression level was calculated by using RPKM method, We used all genes with RPKM ⥠0.1 as expressed genes in the following analysis.,Use BEDTools(Version-2.16.2) to transform *.bam files into *.bed files.[Ref: Aaron R. Quinlan and Ira M. Hall. (2010) BEDTools: a flexible suite of utilities for comparing genomic features,Bioinformatics (2010), 26: 841-842],Merge the *.bed files from samples in the same stage [available on Series records],Use IGVtools to transform the merged *.bed files into *.tdf files for visualization [available on Series records],Genome_build: hg19,Sample_B2.expression.txt: hg19 | Amplied single cell cDNAs were further amplied for another ten cycles of PCR. Then it was sonicated into 200~500bp fragments ,then the standard TruSeq DNA library preparation kit was used following the manufacturer suggestion protocol | GSM896810 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX130004,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00828837 | GSM896810 | GSE36552 | 0.3871 | cDNAs of individual cells of preimplantation embryos | Public on Aug 10 2013 | Mar 16 2012 | 9606 | 2-cell embryo#1 -Cell#2 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX130004 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00828837 |
|
1 | cell type: human preimplantation blastomere (2-cell),developmental stage: early blastomere,tissue: human preimplantation embryos | 5 Yiheyuan Road | Beijing | China | Peking University | Mingyu,,Yang | Reads mapping:We used Burrows-Wheeler Aligner (BWA, Version 0.5.9-r16) [1] to align the clean reads to the hg19 Refseq, with the options "aln -o 1 -e 60 -i 15 -q 10 -t 8". [1]. Li H. and Durbin R. (2009) Fast and accurate short read alignment with Burrows-Wheeler Transform. Bioinformatics, 25:1754-60.,Expression level analysis : The gene expression level was calculated by using RPKM method, We used all genes with RPKM ⥠0.1 as expressed genes in the following analysis.,Use BEDTools(Version-2.16.2) to transform *.bam files into *.bed files.[Ref: Aaron R. Quinlan and Ira M. Hall. (2010) BEDTools: a flexible suite of utilities for comparing genomic features,Bioinformatics (2010), 26: 841-842],Merge the *.bed files from samples in the same stage [available on Series records],Use IGVtools to transform the merged *.bed files into *.tdf files for visualization [available on Series records],Genome_build: hg19,Sample_B3.expression.txt: hg19 | Amplied single cell cDNAs were further amplied for another ten cycles of PCR. Then it was sonicated into 200~500bp fragments ,then the standard TruSeq DNA library preparation kit was used following the manufacturer suggestion protocol | GSM896811 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX130005,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00828838 | GSM896811 | GSE36552 | 0.31831 | cDNAs of individual cells of preimplantation embryos | Public on Aug 10 2013 | Mar 16 2012 | 9606 | 2-cell embryo#2 -Cell#1 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX130005 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00828838 |
|
1 | cell type: human preimplantation blastomere (2-cell),developmental stage: early blastomere,tissue: human preimplantation embryos | 5 Yiheyuan Road | Beijing | China | Peking University | Mingyu,,Yang | Reads mapping:We used Burrows-Wheeler Aligner (BWA, Version 0.5.9-r16) [1] to align the clean reads to the hg19 Refseq, with the options "aln -o 1 -e 60 -i 15 -q 10 -t 8". [1]. Li H. and Durbin R. (2009) Fast and accurate short read alignment with Burrows-Wheeler Transform. Bioinformatics, 25:1754-60.,Expression level analysis : The gene expression level was calculated by using RPKM method, We used all genes with RPKM ⥠0.1 as expressed genes in the following analysis.,Use BEDTools(Version-2.16.2) to transform *.bam files into *.bed files.[Ref: Aaron R. Quinlan and Ira M. Hall. (2010) BEDTools: a flexible suite of utilities for comparing genomic features,Bioinformatics (2010), 26: 841-842],Merge the *.bed files from samples in the same stage [available on Series records],Use IGVtools to transform the merged *.bed files into *.tdf files for visualization [available on Series records],Genome_build: hg19,Sample_B4.expression.txt: hg19 | Amplied single cell cDNAs were further amplied for another ten cycles of PCR. Then it was sonicated into 200~500bp fragments ,then the standard TruSeq DNA library preparation kit was used following the manufacturer suggestion protocol | GSM896812 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX130006,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00828839 | GSM896812 | GSE36552 | 0.267554 | cDNAs of individual cells of preimplantation embryos | Public on Aug 10 2013 | Mar 16 2012 | 9606 | 2-cell embryo#2 -Cell#2 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX130006 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00828839 |
|
1 | cell type: human preimplantation blastomere (2-cell),developmental stage: early blastomere,tissue: human preimplantation embryos | 5 Yiheyuan Road | Beijing | China | Peking University | Mingyu,,Yang | Reads mapping:We used Burrows-Wheeler Aligner (BWA, Version 0.5.9-r16) [1] to align the clean reads to the hg19 Refseq, with the options "aln -o 1 -e 60 -i 15 -q 10 -t 8". [1]. Li H. and Durbin R. (2009) Fast and accurate short read alignment with Burrows-Wheeler Transform. Bioinformatics, 25:1754-60.,Expression level analysis : The gene expression level was calculated by using RPKM method, We used all genes with RPKM ⥠0.1 as expressed genes in the following analysis.,Use BEDTools(Version-2.16.2) to transform *.bam files into *.bed files.[Ref: Aaron R. Quinlan and Ira M. Hall. (2010) BEDTools: a flexible suite of utilities for comparing genomic features,Bioinformatics (2010), 26: 841-842],Merge the *.bed files from samples in the same stage [available on Series records],Use IGVtools to transform the merged *.bed files into *.tdf files for visualization [available on Series records],Genome_build: hg19,Sample_B5.expression.txt: hg19 | Amplied single cell cDNAs were further amplied for another ten cycles of PCR. Then it was sonicated into 200~500bp fragments ,then the standard TruSeq DNA library preparation kit was used following the manufacturer suggestion protocol | GSM896813 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX130007,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00828840 | GSM896813 | GSE36552 | 0.327973 | cDNAs of individual cells of preimplantation embryos | Public on Aug 10 2013 | Mar 16 2012 | 9606 | 2-cell embryo#3 -Cell#1 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX130007 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00828840 |
|
1 | cell type: human preimplantation blastomere (2-cell),developmental stage: early blastomere,tissue: human preimplantation embryos | 5 Yiheyuan Road | Beijing | China | Peking University | Mingyu,,Yang | Reads mapping:We used Burrows-Wheeler Aligner (BWA, Version 0.5.9-r16) [1] to align the clean reads to the hg19 Refseq, with the options "aln -o 1 -e 60 -i 15 -q 10 -t 8". [1]. Li H. and Durbin R. (2009) Fast and accurate short read alignment with Burrows-Wheeler Transform. Bioinformatics, 25:1754-60.,Expression level analysis : The gene expression level was calculated by using RPKM method, We used all genes with RPKM ⥠0.1 as expressed genes in the following analysis.,Use BEDTools(Version-2.16.2) to transform *.bam files into *.bed files.[Ref: Aaron R. Quinlan and Ira M. Hall. (2010) BEDTools: a flexible suite of utilities for comparing genomic features,Bioinformatics (2010), 26: 841-842],Merge the *.bed files from samples in the same stage [available on Series records],Use IGVtools to transform the merged *.bed files into *.tdf files for visualization [available on Series records],Genome_build: hg19,Sample_B6.expression.txt: hg19 | Amplied single cell cDNAs were further amplied for another ten cycles of PCR. Then it was sonicated into 200~500bp fragments ,then the standard TruSeq DNA library preparation kit was used following the manufacturer suggestion protocol | GSM896814 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX130008,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00828841 | GSM896814 | GSE36552 | 0.220969 | cDNAs of individual cells of preimplantation embryos | Public on Aug 10 2013 | Mar 16 2012 | 9606 | 2-cell embryo#3 -Cell#2 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX130008 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00828841 |
|
1 | cell type: human embryonic stem cell,developmental stage: peri-implantation stem cells,tissue: human embryonic stem cell line | 5 Yiheyuan Road | Beijing | China | Peking University | Mingyu,,Yang | Reads mapping:We used Burrows-Wheeler Aligner (BWA, Version 0.5.9-r16) [1] to align the clean reads to the hg19 Refseq, with the options "aln -o 1 -e 60 -i 15 -q 10 -t 8". [1]. Li H. and Durbin R. (2009) Fast and accurate short read alignment with Burrows-Wheeler Transform. Bioinformatics, 25:1754-60.,Expression level analysis : The gene expression level was calculated by using RPKM method, We used all genes with RPKM ⥠0.1 as expressed genes in the following analysis.,Use BEDTools(Version-2.16.2) to transform *.bam files into *.bed files.[Ref: Aaron R. Quinlan and Ira M. Hall. (2010) BEDTools: a flexible suite of utilities for comparing genomic features,Bioinformatics (2010), 26: 841-842],Merge the *.bed files from samples in the same stage [available on Series records],Use IGVtools to transform the merged *.bed files into *.tdf files for visualization [available on Series records],Genome_build: hg19,Sample_M1.expression.txt: hg19 | Amplied single cell cDNAs were further amplied for another ten cycles of PCR. Then it was sonicated into 200~500bp fragments ,then the standard TruSeq DNA library preparation kit was used following the manufacturer suggestion protocol | GSM896815 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX130009,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00828842 | GSM896815 | GSE36552 | 0.189824 | cDNAs of individual cell of human embryonic stem cells | Public on Aug 10 2013 | Mar 16 2012 | 9606 | hESC passage#0 -Cell#1 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX130009 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00828842 |
|
1 | cell type: human embryonic stem cell,developmental stage: peri-implantation stem cells,tissue: human embryonic stem cell line | 5 Yiheyuan Road | Beijing | China | Peking University | Mingyu,,Yang | Reads mapping:We used Burrows-Wheeler Aligner (BWA, Version 0.5.9-r16) [1] to align the clean reads to the hg19 Refseq, with the options "aln -o 1 -e 60 -i 15 -q 10 -t 8". [1]. Li H. and Durbin R. (2009) Fast and accurate short read alignment with Burrows-Wheeler Transform. Bioinformatics, 25:1754-60.,Expression level analysis : The gene expression level was calculated by using RPKM method, We used all genes with RPKM ⥠0.1 as expressed genes in the following analysis.,Use BEDTools(Version-2.16.2) to transform *.bam files into *.bed files.[Ref: Aaron R. Quinlan and Ira M. Hall. (2010) BEDTools: a flexible suite of utilities for comparing genomic features,Bioinformatics (2010), 26: 841-842],Merge the *.bed files from samples in the same stage [available on Series records],Use IGVtools to transform the merged *.bed files into *.tdf files for visualization [available on Series records],Genome_build: hg19,Sample_M2.expression.txt: hg19 | Amplied single cell cDNAs were further amplied for another ten cycles of PCR. Then it was sonicated into 200~500bp fragments ,then the standard TruSeq DNA library preparation kit was used following the manufacturer suggestion protocol | GSM896816 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX130010,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00828843 | GSM896816 | GSE36552 | 0.305934 | cDNAs of individual cell of human embryonic stem cells | Public on Aug 10 2013 | Mar 16 2012 | 9606 | hESC passage#0 -Cell#2 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX130010 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00828843 |
|
1 | biomaterial_type: immortalized cell line,line: MCF-7,datatype: RnaSeq,datatype description: Sequencing analysis of RNA expression,rnaextract: shortTotal,rnaextract description: Rna shorter than 200 nt that has not been seperated based on Poly Adenalyation,biorep: 089WC,090WC,089WC,090WC,labexpid: LID47160,LID47161,LID47161,LID47160,labversion: iIDR,readtype: 1x101,readtype description: Single 101 nt reads,replicate: 1,2,localization: cell,localization description: Whole cell,protocol: TAP-Only,protocol description: This kind of library was made from RNA < 200 nucleotides that were pre-treated with Tobacco Acid Pyrophosphatase to remove any 5' caps that would preclude cloning. Hence, both capped and 5' monophosphate RNAs will be cloned.,rnaextract: shortTotal,rnaextract description: Rna shorter than 200 nt that has not been seperated based on Poly Adenalyation,biorep: 015WC,016WC,labexpid: LID20743,LID20744,labversion: iIDR,readtype: 1x36,readtype description: Single 36 nt reads | 300 Pasteur Dr | Stanford | USA | ENCODE DCC | ENCODE,,DCC | http://genome.ucsc.edu/cgi-bin/hgTrackUi?db=hg19&g=wgEncodeCshlShortRnaSeq | http://genome.ucsc.edu/cgi-bin/hgTrackUi?db=hg19&g=wgEncodeCshlShortRnaSeq | GSM897081 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX130232,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00829018,Named Annotation: NA000015768.1 (GSM897081_hg19_wgEncodeCshlShortRnaSeqMcf7CellShorttotalTapMinusRawRep1.bigWig),Named Annotation: NA000015769.1 (GSM897081_hg19_wgEncodeCshlShortRnaSeqMcf7CellShorttotalTapMinusRawRep2.bigWig),Named Annotation: NA000015770.1 (GSM897081_hg19_wgEncodeCshlShortRnaSeqMcf7CellShorttotalTapMinusRawRep3.bigWig),Named Annotation: NA000015771.1 (GSM897081_hg19_wgEncodeCshlShortRnaSeqMcf7CellShorttotalTapMinusRawRep4.bigWig),Named Annotation: NA000015772.1 (GSM897081_hg19_wgEncodeCshlShortRnaSeqMcf7CellShorttotalTapPlusRawRep1.bigWig),Named Annotation: NA000015773.1 (GSM897081_hg19_wgEncodeCshlShortRnaSeqMcf7CellShorttotalTapPlusRawRep2.bigWig),Named Annotation: NA000015774.1 (GSM897081_hg19_wgEncodeCshlShortRnaSeqMcf7CellShorttotalTapPlusRawRep3.bigWig),Named Annotation: NA000015775.1 (GSM897081_hg19_wgEncodeCshlShortRnaSeqMcf7CellShorttotalTapPlusRawRep4.bigWig) | GSM897081 | GSE24565 | 0.189287 | MCF-7 | Public on Mar 16 2012 | Mar 16 2012 | 9606 | CSHL_RnaSeq_MCF-7_cell_TAP-Only_shortTotal | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX130232 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00829018 |
|
1 | datatype: RnaSeq,datatype description: Sequencing analysis of RNA expression,rnaextract: shortTotal,rnaextract description: Rna shorter than 200 nt that has not been seperated based on Poly Adenalyation,biorep: 087WC,088WC,087WC,088WC,labexpid: LID47039,LID47039,LID47040,LID47040,labversion: iIDR,readtype: 1x101,readtype description: Single 101 nt reads,replicate: 1,2,localization: cell,localization description: Whole cell,protocol: TAP-Only,protocol description: This kind of library was made from RNA < 200 nucleotides that were pre-treated with Tobacco Acid Pyrophosphatase to remove any 5' caps that would preclude cloning. Hence, both capped and 5' monophosphate RNAs will be cloned.,rnaextract: shortTotal,rnaextract description: Rna shorter than 200 nt that has not been seperated based on Poly Adenalyation,biorep: 021WC,labexpid: LID20749,readtype: 1x36,readtype description: Single 36 nt reads,replicate: 1 | 300 Pasteur Dr | Stanford | USA | ENCODE DCC | ENCODE,,DCC | http://genome.ucsc.edu/cgi-bin/hgTrackUi?db=hg19&g=wgEncodeCshlShortRnaSeq | http://genome.ucsc.edu/cgi-bin/hgTrackUi?db=hg19&g=wgEncodeCshlShortRnaSeq | GSM897083 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX130234,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00829020,Named Annotation: NA000015780.1 (GSM897083_hg19_wgEncodeCshlShortRnaSeqA549CellShorttotalTapMinusRawRep1.bigWig),Named Annotation: NA000015781.1 (GSM897083_hg19_wgEncodeCshlShortRnaSeqA549CellShorttotalTapMinusRawRep2.bigWig),Named Annotation: NA000015782.1 (GSM897083_hg19_wgEncodeCshlShortRnaSeqA549CellShorttotalTapMinusRawRep3.bigWig),Named Annotation: NA000015783.1 (GSM897083_hg19_wgEncodeCshlShortRnaSeqA549CellShorttotalTapMinusRawRep4.bigWig),Named Annotation: NA000015784.1 (GSM897083_hg19_wgEncodeCshlShortRnaSeqA549CellShorttotalTapPlusRawRep1.bigWig),Named Annotation: NA000015785.1 (GSM897083_hg19_wgEncodeCshlShortRnaSeqA549CellShorttotalTapPlusRawRep2.bigWig),Named Annotation: NA000015786.1 (GSM897083_hg19_wgEncodeCshlShortRnaSeqA549CellShorttotalTapPlusRawRep3.bigWig),Named Annotation: NA000015787.1 (GSM897083_hg19_wgEncodeCshlShortRnaSeqA549CellShorttotalTapPlusRawRep4.bigWig) | GSM897083 | GSE24565 | 0.018879 | A549 | Public on Mar 16 2012 | Mar 16 2012 | 9606 | CSHL_RnaSeq_A549_cell_TAP-Only_shortTotal | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX130234 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00829020 |
|
1 | donor: 1,cell type: M1 macrophages (classically activated) | Carl Troll str. 31 | Bonn | Germany | Life and Medical Sciences institute | Andrea ,,Nino Castro | Illumina Casava1.8 software used for basecalling.,Sequenced reads were demultiplexed, then mapped to hg19 whole genome using Casava1.8.,Reads Per Kilobase of exon per Megabase of library size (RPKM) were calculated using Casava1.8. In short, exons from all isoforms of a gene were merged to create one meta-transcript. The number of reads falling in the exons of this meta-transcript were counted and normalized by the size of the meta-transcript and by the size of the library.,All analysis concerning differential expression of total transcripts were calculated using the values from Casava 1.8.,We only used TopHat/Cufflinks for analyzing the transcript variants, etc. and these tables/results are part of the manuscript.,Genome_build: hg19,Supplementary_files_format_and_content: RPKM.txt file includes RPKM values for each Sample. | Macrophages were harvested and directly lyzed using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit (Cat#FC-122-1001) was used with 1 ug of total RNA for the construction of sequencing libraries.,instrument name: Illumina HiScanSQ | GSM907013 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX134852,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00848520 | GSM907013 | GSE36952 | 0.012663 | human monocyte derived macrophages | Public on Oct 01 2012 | Mar 30 2012 | 9606 | M1_1 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX134852 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00848520 |
|
1 | donor: 2,cell type: M1 macrophages (classically activated) | Carl Troll str. 31 | Bonn | Germany | Life and Medical Sciences institute | Andrea ,,Nino Castro | Illumina Casava1.8 software used for basecalling.,Sequenced reads were demultiplexed, then mapped to hg19 whole genome using Casava1.8.,Reads Per Kilobase of exon per Megabase of library size (RPKM) were calculated using Casava1.8. In short, exons from all isoforms of a gene were merged to create one meta-transcript. The number of reads falling in the exons of this meta-transcript were counted and normalized by the size of the meta-transcript and by the size of the library.,All analysis concerning differential expression of total transcripts were calculated using the values from Casava 1.8.,We only used TopHat/Cufflinks for analyzing the transcript variants, etc. and these tables/results are part of the manuscript.,Genome_build: hg19,Supplementary_files_format_and_content: RPKM.txt file includes RPKM values for each Sample. | Macrophages were harvested and directly lyzed using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit (Cat#FC-122-1001) was used with 1 ug of total RNA for the construction of sequencing libraries.,instrument name: Illumina HiScanSQ | GSM907014 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX134853,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00848521 | GSM907014 | GSE36952 | 0.009937 | human monocyte derived macrophages | Public on Oct 01 2012 | Mar 30 2012 | 9606 | M1_2 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX134853 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00848521 |
|
1 | donor: 3,cell type: M1 macrophages (classically activated) | Carl Troll str. 31 | Bonn | Germany | Life and Medical Sciences institute | Andrea ,,Nino Castro | Illumina Casava1.8 software used for basecalling.,Sequenced reads were demultiplexed, then mapped to hg19 whole genome using Casava1.8.,Reads Per Kilobase of exon per Megabase of library size (RPKM) were calculated using Casava1.8. In short, exons from all isoforms of a gene were merged to create one meta-transcript. The number of reads falling in the exons of this meta-transcript were counted and normalized by the size of the meta-transcript and by the size of the library.,All analysis concerning differential expression of total transcripts were calculated using the values from Casava 1.8.,We only used TopHat/Cufflinks for analyzing the transcript variants, etc. and these tables/results are part of the manuscript.,Genome_build: hg19,Supplementary_files_format_and_content: RPKM.txt file includes RPKM values for each Sample. | Macrophages were harvested and directly lyzed using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit (Cat#FC-122-1001) was used with 1 ug of total RNA for the construction of sequencing libraries.,instrument name: Illumina HiScanSQ | GSM907015 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX134854,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00848522 | GSM907015 | GSE36952 | 0.008007 | human monocyte derived macrophages | Public on Oct 01 2012 | Mar 30 2012 | 9606 | M1_3 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX134854 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00848522 |
|
1 | donor: 1,cell type: M2 macrophages (alternatively activated) | Carl Troll str. 31 | Bonn | Germany | Life and Medical Sciences institute | Andrea ,,Nino Castro | Illumina Casava1.8 software used for basecalling.,Sequenced reads were demultiplexed, then mapped to hg19 whole genome using Casava1.8.,Reads Per Kilobase of exon per Megabase of library size (RPKM) were calculated using Casava1.8. In short, exons from all isoforms of a gene were merged to create one meta-transcript. The number of reads falling in the exons of this meta-transcript were counted and normalized by the size of the meta-transcript and by the size of the library.,All analysis concerning differential expression of total transcripts were calculated using the values from Casava 1.8.,We only used TopHat/Cufflinks for analyzing the transcript variants, etc. and these tables/results are part of the manuscript.,Genome_build: hg19,Supplementary_files_format_and_content: RPKM.txt file includes RPKM values for each Sample. | Macrophages were harvested and directly lyzed using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit (Cat#FC-122-1001) was used with 1 ug of total RNA for the construction of sequencing libraries.,instrument name: Illumina HiScanSQ | GSM907016 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX134855,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00848523 | GSM907016 | GSE36952 | 0.012846 | human monocyte derived macrophages | Public on Oct 01 2012 | Mar 30 2012 | 9606 | M2_1 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX134855 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00848523 |
|
1 | donor: 2,cell type: M2 macrophages (alternatively activated) | Carl Troll str. 31 | Bonn | Germany | Life and Medical Sciences institute | Andrea ,,Nino Castro | Illumina Casava1.8 software used for basecalling.,Sequenced reads were demultiplexed, then mapped to hg19 whole genome using Casava1.8.,Reads Per Kilobase of exon per Megabase of library size (RPKM) were calculated using Casava1.8. In short, exons from all isoforms of a gene were merged to create one meta-transcript. The number of reads falling in the exons of this meta-transcript were counted and normalized by the size of the meta-transcript and by the size of the library.,All analysis concerning differential expression of total transcripts were calculated using the values from Casava 1.8.,We only used TopHat/Cufflinks for analyzing the transcript variants, etc. and these tables/results are part of the manuscript.,Genome_build: hg19,Supplementary_files_format_and_content: RPKM.txt file includes RPKM values for each Sample. | Macrophages were harvested and directly lyzed using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit (Cat#FC-122-1001) was used with 1 ug of total RNA for the construction of sequencing libraries.,instrument name: Illumina HiScanSQ | GSM907017 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX134856,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00848524 | GSM907017 | GSE36952 | 0.00434 | human monocyte derived macrophages | Public on Oct 01 2012 | Mar 30 2012 | 9606 | M2_2 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX134856 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00848524 |
|
1 | donor: 3,cell type: M2 macrophages (alternatively activated) | Carl Troll str. 31 | Bonn | Germany | Life and Medical Sciences institute | Andrea ,,Nino Castro | Illumina Casava1.8 software used for basecalling.,Sequenced reads were demultiplexed, then mapped to hg19 whole genome using Casava1.8.,Reads Per Kilobase of exon per Megabase of library size (RPKM) were calculated using Casava1.8. In short, exons from all isoforms of a gene were merged to create one meta-transcript. The number of reads falling in the exons of this meta-transcript were counted and normalized by the size of the meta-transcript and by the size of the library.,All analysis concerning differential expression of total transcripts were calculated using the values from Casava 1.8.,We only used TopHat/Cufflinks for analyzing the transcript variants, etc. and these tables/results are part of the manuscript.,Genome_build: hg19,Supplementary_files_format_and_content: RPKM.txt file includes RPKM values for each Sample. | Macrophages were harvested and directly lyzed using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit (Cat#FC-122-1001) was used with 1 ug of total RNA for the construction of sequencing libraries.,instrument name: Illumina HiScanSQ | GSM907018 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX134857,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00848525 | GSM907018 | GSE36952 | 0.005088 | human monocyte derived macrophages | Public on Oct 01 2012 | Mar 30 2012 | 9606 | M2_3 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX134857 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00848525 |
|
1 | cell line: HEK293,sirna: none | Klingelbergstrasse 50-70 | Basel | Switzerland | University of Basel | Andreas,R,Gruber | A-seq reads were pre-processed to remove the six diagnostic adenosines derived from the poly(A) tail as well as the 3' adaptor sequence and then were mapped to the human genome (hg19) and annotated using the CLIPZ server. For the construction of the set of 3' end cleavage sites, we only used reads that had the adaptor removed, mapped uniquely to genomic regions and whose annotation was "mRNA", "repeat", "miscRNA", or "unknown". Based on the precise mapping of the 3' ends of these reads we computed putative cleavage sites with their associated abundance. To minimize the frequency of internal priming sites in our data set, we discarded those that in the eight-nucleotide-region immediately downstream of the putative cleavage site had at least seven A nucleotides.,The raw reads were processed on the CLIPZ server (http://http://www.clipz.unibas.ch; Khorshid et al., Nucleic Acids Research 2011, 39:D245).,Genome_build: hg19, GRCh37 Genome Reference Consortium Human Reference 37,Supplementary_files_format_and_content: BED file containing inferred 3' ends | A-seq protocol: A-seq starts with selection of the poly(A)-containing RNAs on oligo-(dT)25 Dynabeads, followed by partial digestion with RNase I that cleaves after any nucleotide. The 5' ends are then phosphorylated, the 3' ends blocked by 3'dATP and an RNA primer is ligated to the 5' end of the RNA fragments. Our reverse transcription (RT) primer features an anchor nucleotide (A, C or G) designed to align to the first nucleotide upstream of the poly(A) tail, followed by six dTs that anneal to the first six nucleotides (nt) of the poly(A) tail. Following are a stem-loop containing the 3' adaptor sense strand (needed for priming the subsequent PCR reaction), its complement, and finally a stretch of 18 dTs, which together with the 6 dTs after the anchor nucleotide form a 24 nucleotide(nt)-long contiguous oligo dT stretch that aligns to the poly(A) tail. The products of RT and PCR are therefore expected to have 6 As preceding the 3' adaptor (AAAAAATGGAATTCTCGGGTGCCAAGG). | GSM909242 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX135568,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00849554 | GSM909242 | GSE37037,GSE37401 | 0.096398 | HEK293 | Public on May 15 2012 | Apr 04 2012 | 9606 | A-seq no siRNA | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX135568 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00849554 |
|
1 | cell line: HEK293,sirna: scrambled-A | Klingelbergstrasse 50-70 | Basel | Switzerland | University of Basel | Andreas,R,Gruber | A-seq reads were pre-processed to remove the six diagnostic adenosines derived from the poly(A) tail as well as the 3' adaptor sequence and then were mapped to the human genome (hg19) and annotated using the CLIPZ server. For the construction of the set of 3' end cleavage sites, we only used reads that had the adaptor removed, mapped uniquely to genomic regions and whose annotation was "mRNA", "repeat", "miscRNA", or "unknown". Based on the precise mapping of the 3' ends of these reads we computed putative cleavage sites with their associated abundance. To minimize the frequency of internal priming sites in our data set, we discarded those that in the eight-nucleotide-region immediately downstream of the putative cleavage site had at least seven A nucleotides.,The raw reads were processed on the CLIPZ server (http://http://www.clipz.unibas.ch; Khorshid et al., Nucleic Acids Research 2011, 39:D245).,Genome_build: hg19, GRCh37 Genome Reference Consortium Human Reference 37,Supplementary_files_format_and_content: BED file containing inferred 3' ends | A-seq protocol: A-seq starts with selection of the poly(A)-containing RNAs on oligo-(dT)25 Dynabeads, followed by partial digestion with RNase I that cleaves after any nucleotide. The 5' ends are then phosphorylated, the 3' ends blocked by 3'dATP and an RNA primer is ligated to the 5' end of the RNA fragments. Our reverse transcription (RT) primer features an anchor nucleotide (A, C or G) designed to align to the first nucleotide upstream of the poly(A) tail, followed by six dTs that anneal to the first six nucleotides (nt) of the poly(A) tail. Following are a stem-loop containing the 3' adaptor sense strand (needed for priming the subsequent PCR reaction), its complement, and finally a stretch of 18 dTs, which together with the 6 dTs after the anchor nucleotide form a 24 nucleotide(nt)-long contiguous oligo dT stretch that aligns to the poly(A) tail. The products of RT and PCR are therefore expected to have 6 As preceding the 3' adaptor (AAAAAATGGAATTCTCGGGTGCCAAGG). | GSM909243 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX135569,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00849555 | GSM909243 | GSE37037,GSE37401 | 0.015192 | HEK293 | Public on May 15 2012 | Apr 04 2012 | 9606 | A-seq siRNA Ctrl | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX135569 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00849555 |
|
1 | cell line: HEK293,sirna: 5'-NNCCUGAAUG GGCGCGAAUUC-3' dsRNA oligo from Dharmacon | Klingelbergstrasse 50-70 | Basel | Switzerland | University of Basel | Andreas,R,Gruber | A-seq reads were pre-processed to remove the six diagnostic adenosines derived from the poly(A) tail as well as the 3' adaptor sequence and then were mapped to the human genome (hg19) and annotated using the CLIPZ server. For the construction of the set of 3' end cleavage sites, we only used reads that had the adaptor removed, mapped uniquely to genomic regions and whose annotation was "mRNA", "repeat", "miscRNA", or "unknown". Based on the precise mapping of the 3' ends of these reads we computed putative cleavage sites with their associated abundance. To minimize the frequency of internal priming sites in our data set, we discarded those that in the eight-nucleotide-region immediately downstream of the putative cleavage site had at least seven A nucleotides.,The raw reads were processed on the CLIPZ server (http://http://www.clipz.unibas.ch; Khorshid et al., Nucleic Acids Research 2011, 39:D245).,Genome_build: hg19, GRCh37 Genome Reference Consortium Human Reference 37,Supplementary_files_format_and_content: BED file containing inferred 3' ends | A-seq protocol: A-seq starts with selection of the poly(A)-containing RNAs on oligo-(dT)25 Dynabeads, followed by partial digestion with RNase I that cleaves after any nucleotide. The 5' ends are then phosphorylated, the 3' ends blocked by 3'dATP and an RNA primer is ligated to the 5' end of the RNA fragments. Our reverse transcription (RT) primer features an anchor nucleotide (A, C or G) designed to align to the first nucleotide upstream of the poly(A) tail, followed by six dTs that anneal to the first six nucleotides (nt) of the poly(A) tail. Following are a stem-loop containing the 3' adaptor sense strand (needed for priming the subsequent PCR reaction), its complement, and finally a stretch of 18 dTs, which together with the 6 dTs after the anchor nucleotide form a 24 nucleotide(nt)-long contiguous oligo dT stretch that aligns to the poly(A) tail. The products of RT and PCR are therefore expected to have 6 As preceding the 3' adaptor (AAAAAATGGAATTCTCGGGTGCCAAGG). | GSM909244 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX135570,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00849556 | GSM909244 | GSE37037,GSE37401 | 0.437809 | HEK293 | Public on May 15 2012 | Apr 04 2012 | 9606 | A-seq siRNA CstF-64 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX135570 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00849556 |
|
1 | cell line: HEK293,sirna: 5'-NNGACCGAGA UUACAUGGAUA-3' dsRNA oligo from Dharmacon | Klingelbergstrasse 50-70 | Basel | Switzerland | University of Basel | Andreas,R,Gruber | A-seq reads were pre-processed to remove the six diagnostic adenosines derived from the poly(A) tail as well as the 3' adaptor sequence and then were mapped to the human genome (hg19) and annotated using the CLIPZ server. For the construction of the set of 3' end cleavage sites, we only used reads that had the adaptor removed, mapped uniquely to genomic regions and whose annotation was "mRNA", "repeat", "miscRNA", or "unknown". Based on the precise mapping of the 3' ends of these reads we computed putative cleavage sites with their associated abundance. To minimize the frequency of internal priming sites in our data set, we discarded those that in the eight-nucleotide-region immediately downstream of the putative cleavage site had at least seven A nucleotides.,The raw reads were processed on the CLIPZ server (http://http://www.clipz.unibas.ch; Khorshid et al., Nucleic Acids Research 2011, 39:D245).,Genome_build: hg19, GRCh37 Genome Reference Consortium Human Reference 37,Supplementary_files_format_and_content: BED file containing inferred 3' ends | A-seq protocol: A-seq starts with selection of the poly(A)-containing RNAs on oligo-(dT)25 Dynabeads, followed by partial digestion with RNase I that cleaves after any nucleotide. The 5' ends are then phosphorylated, the 3' ends blocked by 3'dATP and an RNA primer is ligated to the 5' end of the RNA fragments. Our reverse transcription (RT) primer features an anchor nucleotide (A, C or G) designed to align to the first nucleotide upstream of the poly(A) tail, followed by six dTs that anneal to the first six nucleotides (nt) of the poly(A) tail. Following are a stem-loop containing the 3' adaptor sense strand (needed for priming the subsequent PCR reaction), its complement, and finally a stretch of 18 dTs, which together with the 6 dTs after the anchor nucleotide form a 24 nucleotide(nt)-long contiguous oligo dT stretch that aligns to the poly(A) tail. The products of RT and PCR are therefore expected to have 6 As preceding the 3' adaptor (AAAAAATGGAATTCTCGGGTGCCAAGG). | GSM909245 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX135571,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00849557 | GSM909245 | GSE37037,GSE37401 | 0.282899 | HEK293 | Public on May 15 2012 | Apr 04 2012 | 9606 | A-seq siRNA CF Im68 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX135571 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00849557 |
|
1 | patient: 1,tissue: Parathyroid tumor,agent: Control,time: 24h | Tomtebodav. 23A | Solna | Sweden | Science for Life Laboratory Stockholm | Mikael,,Huss | Base-calling was done with Illumina's Offline Base Caller (OLB) v.1.9.,Alignment to reference genome was done with TopHat v1.0.14.,Duplicates were removed using Picard (v. 1.29) MarkDuplicates.,Read counts per gene were calculated with HTSeq v. 0.5.1.,FPKM values for genes and transcripts were calculated with Cufflinks v. 1.0.3.,Differential expression analysis was performed using the edgeR package and subsequent custom filtering,Genome_build: hg19,Supplementary_files_format_and_content: count_table.txt: tab separated text file (read counts per ENSEMBL gene),Supplementary_files_format_and_content: fpkm_table.txt: tab separated text file (FPKM per ENSEMBL gene) | Illumina TruSeq RNA | GSM913873 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX140503,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00854909 | GSM913873 | GSE37211 | 0.001687 | Parathyroid adenoma | Public on Sep 19 2012 | Apr 12 2012 | 9606 | Control 24h - Adenoma 1 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX140503 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00854909 |
|
1 | patient: 1,tissue: Parathyroid tumor,agent: Control,time: 48h | Tomtebodav. 23A | Solna | Sweden | Science for Life Laboratory Stockholm | Mikael,,Huss | Base-calling was done with Illumina's Offline Base Caller (OLB) v.1.9.,Alignment to reference genome was done with TopHat v1.0.14.,Duplicates were removed using Picard (v. 1.29) MarkDuplicates.,Read counts per gene were calculated with HTSeq v. 0.5.1.,FPKM values for genes and transcripts were calculated with Cufflinks v. 1.0.3.,Differential expression analysis was performed using the edgeR package and subsequent custom filtering,Genome_build: hg19,Supplementary_files_format_and_content: count_table.txt: tab separated text file (read counts per ENSEMBL gene),Supplementary_files_format_and_content: fpkm_table.txt: tab separated text file (FPKM per ENSEMBL gene) | Illumina TruSeq RNA | GSM913874 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX140504,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00854910 | GSM913874 | GSE37211 | 0.00366 | Parathyroid adenoma | Public on Sep 19 2012 | Apr 12 2012 | 9606 | Control 48h - Adenoma 1 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX140504 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00854910 |
|
1 | patient: 1,tissue: Parathyroid tumor,agent: DPN,time: 24h | Tomtebodav. 23A | Solna | Sweden | Science for Life Laboratory Stockholm | Mikael,,Huss | Base-calling was done with Illumina's Offline Base Caller (OLB) v.1.9.,Alignment to reference genome was done with TopHat v1.0.14.,Duplicates were removed using Picard (v. 1.29) MarkDuplicates.,Read counts per gene were calculated with HTSeq v. 0.5.1.,FPKM values for genes and transcripts were calculated with Cufflinks v. 1.0.3.,Differential expression analysis was performed using the edgeR package and subsequent custom filtering,Genome_build: hg19,Supplementary_files_format_and_content: count_table.txt: tab separated text file (read counts per ENSEMBL gene),Supplementary_files_format_and_content: fpkm_table.txt: tab separated text file (FPKM per ENSEMBL gene) | Illumina TruSeq RNA | GSM913875 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX140505,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00854911 | GSM913875 | GSE37211 | 0.003561 | Parathyroid adenoma | Public on Sep 19 2012 | Apr 12 2012 | 9606 | DPN 24h - Adenoma 1 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX140505 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00854911 |
|
1 | patient: 1,tissue: Parathyroid tumor,agent: DPN,time: 48h | Tomtebodav. 23A | Solna | Sweden | Science for Life Laboratory Stockholm | Mikael,,Huss | Base-calling was done with Illumina's Offline Base Caller (OLB) v.1.9.,Alignment to reference genome was done with TopHat v1.0.14.,Duplicates were removed using Picard (v. 1.29) MarkDuplicates.,Read counts per gene were calculated with HTSeq v. 0.5.1.,FPKM values for genes and transcripts were calculated with Cufflinks v. 1.0.3.,Differential expression analysis was performed using the edgeR package and subsequent custom filtering,Genome_build: hg19,Supplementary_files_format_and_content: count_table.txt: tab separated text file (read counts per ENSEMBL gene),Supplementary_files_format_and_content: fpkm_table.txt: tab separated text file (FPKM per ENSEMBL gene) | Illumina TruSeq RNA | GSM913876 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX140506,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00854912 | GSM913876 | GSE37211 | 0.00383 | Parathyroid adenoma | Public on Sep 19 2012 | Apr 12 2012 | 9606 | DPN 48h - Adenoma 1 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX140506 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00854912 |
|
1 | patient: 1,tissue: Parathyroid tumor,agent: OHT,time: 24h | Tomtebodav. 23A | Solna | Sweden | Science for Life Laboratory Stockholm | Mikael,,Huss | Base-calling was done with Illumina's Offline Base Caller (OLB) v.1.9.,Alignment to reference genome was done with TopHat v1.0.14.,Duplicates were removed using Picard (v. 1.29) MarkDuplicates.,Read counts per gene were calculated with HTSeq v. 0.5.1.,FPKM values for genes and transcripts were calculated with Cufflinks v. 1.0.3.,Differential expression analysis was performed using the edgeR package and subsequent custom filtering,Genome_build: hg19,Supplementary_files_format_and_content: count_table.txt: tab separated text file (read counts per ENSEMBL gene),Supplementary_files_format_and_content: fpkm_table.txt: tab separated text file (FPKM per ENSEMBL gene) | Illumina TruSeq RNA | GSM913877 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX140507,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00854913 | GSM913877 | GSE37211 | 0.002358 | Parathyroid adenoma | Public on Sep 19 2012 | Apr 12 2012 | 9606 | OHT 24h - Adenoma 1 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX140507 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00854913 |
|
1 | patient: 1,tissue: Parathyroid tumor,agent: OHT,time: 48h | Tomtebodav. 23A | Solna | Sweden | Science for Life Laboratory Stockholm | Mikael,,Huss | Base-calling was done with Illumina's Offline Base Caller (OLB) v.1.9.,Alignment to reference genome was done with TopHat v1.0.14.,Duplicates were removed using Picard (v. 1.29) MarkDuplicates.,Read counts per gene were calculated with HTSeq v. 0.5.1.,FPKM values for genes and transcripts were calculated with Cufflinks v. 1.0.3.,Differential expression analysis was performed using the edgeR package and subsequent custom filtering,Genome_build: hg19,Supplementary_files_format_and_content: count_table.txt: tab separated text file (read counts per ENSEMBL gene),Supplementary_files_format_and_content: fpkm_table.txt: tab separated text file (FPKM per ENSEMBL gene) | Illumina TruSeq RNA | GSM913878 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX140508,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00854914 | GSM913878 | GSE37211 | 0.003143 | Parathyroid adenoma | Public on Sep 19 2012 | Apr 12 2012 | 9606 | OHT 48h - Adenoma 1 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX140508 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00854914 |
|
1 | patient: 2,tissue: Parathyroid tumor,agent: Control,time: 24h | Tomtebodav. 23A | Solna | Sweden | Science for Life Laboratory Stockholm | Mikael,,Huss | Base-calling was done with Illumina's Offline Base Caller (OLB) v.1.9.,Alignment to reference genome was done with TopHat v1.0.14.,Duplicates were removed using Picard (v. 1.29) MarkDuplicates.,Read counts per gene were calculated with HTSeq v. 0.5.1.,FPKM values for genes and transcripts were calculated with Cufflinks v. 1.0.3.,Differential expression analysis was performed using the edgeR package and subsequent custom filtering,Genome_build: hg19,Supplementary_files_format_and_content: count_table.txt: tab separated text file (read counts per ENSEMBL gene),Supplementary_files_format_and_content: fpkm_table.txt: tab separated text file (FPKM per ENSEMBL gene) | Illumina TruSeq RNA | GSM913879 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX140509,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00854915 | GSM913879 | GSE37211 | 0.001936 | Parathyroid adenoma | Public on Sep 19 2012 | Apr 12 2012 | 9606 | Control 24h - Adenoma 2 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX140509 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00854915 |
|
1 | patient: 2,tissue: Parathyroid tumor,agent: Control,time: 48h | Tomtebodav. 23A | Solna | Sweden | Science for Life Laboratory Stockholm | Mikael,,Huss | Base-calling was done with Illumina's Offline Base Caller (OLB) v.1.9.,Alignment to reference genome was done with TopHat v1.0.14.,Duplicates were removed using Picard (v. 1.29) MarkDuplicates.,Read counts per gene were calculated with HTSeq v. 0.5.1.,FPKM values for genes and transcripts were calculated with Cufflinks v. 1.0.3.,Differential expression analysis was performed using the edgeR package and subsequent custom filtering,Genome_build: hg19,Supplementary_files_format_and_content: count_table.txt: tab separated text file (read counts per ENSEMBL gene),Supplementary_files_format_and_content: fpkm_table.txt: tab separated text file (FPKM per ENSEMBL gene) | Illumina TruSeq RNA | GSM913880 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX140510,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00854916 | GSM913880 | GSE37211 | 0.003815 | Parathyroid adenoma | Public on Sep 19 2012 | Apr 12 2012 | 9606 | Control 48h - Adenoma 2 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX140510 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00854916 |
|
1 | patient: 2,tissue: Parathyroid tumor,agent: DPN,time: 24h | Tomtebodav. 23A | Solna | Sweden | Science for Life Laboratory Stockholm | Mikael,,Huss | Base-calling was done with Illumina's Offline Base Caller (OLB) v.1.9.,Alignment to reference genome was done with TopHat v1.0.14.,Duplicates were removed using Picard (v. 1.29) MarkDuplicates.,Read counts per gene were calculated with HTSeq v. 0.5.1.,FPKM values for genes and transcripts were calculated with Cufflinks v. 1.0.3.,Differential expression analysis was performed using the edgeR package and subsequent custom filtering,Genome_build: hg19,Supplementary_files_format_and_content: count_table.txt: tab separated text file (read counts per ENSEMBL gene),Supplementary_files_format_and_content: fpkm_table.txt: tab separated text file (FPKM per ENSEMBL gene) | Illumina TruSeq RNA | GSM913881 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX140511,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00854917 | GSM913881 | GSE37211 | 0.003466 | Parathyroid adenoma | Public on Sep 19 2012 | Apr 12 2012 | 9606 | DPN 24h - Adenoma 2 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX140511 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00854917 |
|
1 | patient: 2,tissue: Parathyroid tumor,agent: DPN,time: 48h | Tomtebodav. 23A | Solna | Sweden | Science for Life Laboratory Stockholm | Mikael,,Huss | Base-calling was done with Illumina's Offline Base Caller (OLB) v.1.9.,Alignment to reference genome was done with TopHat v1.0.14.,Duplicates were removed using Picard (v. 1.29) MarkDuplicates.,Read counts per gene were calculated with HTSeq v. 0.5.1.,FPKM values for genes and transcripts were calculated with Cufflinks v. 1.0.3.,Differential expression analysis was performed using the edgeR package and subsequent custom filtering,Genome_build: hg19,Supplementary_files_format_and_content: count_table.txt: tab separated text file (read counts per ENSEMBL gene),Supplementary_files_format_and_content: fpkm_table.txt: tab separated text file (FPKM per ENSEMBL gene) | Illumina TruSeq RNA | GSM913882 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX140512,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00854918 | GSM913882 | GSE37211 | 0.007355 | Parathyroid adenoma | Public on Sep 19 2012 | Apr 12 2012 | 9606 | DPN 48h - Adenoma 2 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX140512 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00854918 |
|
1 | patient: 2,tissue: Parathyroid tumor,agent: OHT,time: 24h | Tomtebodav. 23A | Solna | Sweden | Science for Life Laboratory Stockholm | Mikael,,Huss | Base-calling was done with Illumina's Offline Base Caller (OLB) v.1.9.,Alignment to reference genome was done with TopHat v1.0.14.,Duplicates were removed using Picard (v. 1.29) MarkDuplicates.,Read counts per gene were calculated with HTSeq v. 0.5.1.,FPKM values for genes and transcripts were calculated with Cufflinks v. 1.0.3.,Differential expression analysis was performed using the edgeR package and subsequent custom filtering,Genome_build: hg19,Supplementary_files_format_and_content: count_table.txt: tab separated text file (read counts per ENSEMBL gene),Supplementary_files_format_and_content: fpkm_table.txt: tab separated text file (FPKM per ENSEMBL gene) | Illumina TruSeq RNA | GSM913883 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX140513,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00854919 | GSM913883 | GSE37211 | 0.002124 | Parathyroid adenoma | Public on Sep 19 2012 | Apr 12 2012 | 9606 | OHT 24h - Adenoma 2 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX140513 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00854919 |
|
1 | patient: 2,tissue: Parathyroid tumor,agent: OHT,time: 48h | Tomtebodav. 23A | Solna | Sweden | Science for Life Laboratory Stockholm | Mikael,,Huss | Base-calling was done with Illumina's Offline Base Caller (OLB) v.1.9.,Alignment to reference genome was done with TopHat v1.0.14.,Duplicates were removed using Picard (v. 1.29) MarkDuplicates.,Read counts per gene were calculated with HTSeq v. 0.5.1.,FPKM values for genes and transcripts were calculated with Cufflinks v. 1.0.3.,Differential expression analysis was performed using the edgeR package and subsequent custom filtering,Genome_build: hg19,Supplementary_files_format_and_content: count_table.txt: tab separated text file (read counts per ENSEMBL gene),Supplementary_files_format_and_content: fpkm_table.txt: tab separated text file (FPKM per ENSEMBL gene) | Illumina TruSeq RNA | GSM913884 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX140514,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00854920 | GSM913884 | GSE37211 | 0.001519 | Parathyroid adenoma | Public on Sep 19 2012 | Apr 12 2012 | 9606 | OHT 48h - Adenoma 2 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX140514 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00854920 |
|
1 | patient: 3,tissue: Parathyroid tumor,agent: Control,time: 24h | Tomtebodav. 23A | Solna | Sweden | Science for Life Laboratory Stockholm | Mikael,,Huss | Base-calling was done with Illumina's Offline Base Caller (OLB) v.1.9.,Alignment to reference genome was done with TopHat v1.0.14.,Duplicates were removed using Picard (v. 1.29) MarkDuplicates.,Read counts per gene were calculated with HTSeq v. 0.5.1.,FPKM values for genes and transcripts were calculated with Cufflinks v. 1.0.3.,Differential expression analysis was performed using the edgeR package and subsequent custom filtering,Genome_build: hg19,Supplementary_files_format_and_content: count_table.txt: tab separated text file (read counts per ENSEMBL gene),Supplementary_files_format_and_content: fpkm_table.txt: tab separated text file (FPKM per ENSEMBL gene) | Illumina TruSeq RNA | GSM913885 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX140515,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00854921 | GSM913885 | GSE37211 | 0.009626 | Parathyroid adenoma | Public on Sep 19 2012 | Apr 12 2012 | 9606 | Control 24h - Adenoma 3 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX140515 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00854921 |
|
1 | patient: 3,tissue: Parathyroid tumor,agent: Control,time: 48h | Tomtebodav. 23A | Solna | Sweden | Science for Life Laboratory Stockholm | Mikael,,Huss | Base-calling was done with Illumina's Offline Base Caller (OLB) v.1.9.,Alignment to reference genome was done with TopHat v1.0.14.,Duplicates were removed using Picard (v. 1.29) MarkDuplicates.,Read counts per gene were calculated with HTSeq v. 0.5.1.,FPKM values for genes and transcripts were calculated with Cufflinks v. 1.0.3.,Differential expression analysis was performed using the edgeR package and subsequent custom filtering,Genome_build: hg19,Supplementary_files_format_and_content: count_table.txt: tab separated text file (read counts per ENSEMBL gene),Supplementary_files_format_and_content: fpkm_table.txt: tab separated text file (FPKM per ENSEMBL gene) | Illumina TruSeq RNA | GSM913886 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX140516,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00854922 | GSM913886 | GSE37211 | 0.008103 | Parathyroid adenoma | Public on Sep 19 2012 | Apr 12 2012 | 9606 | Control 48h - Adenoma 3 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX140516 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00854922 |
|
1 | patient: 3,tissue: Parathyroid tumor,agent: DPN,time: 24h | Tomtebodav. 23A | Solna | Sweden | Science for Life Laboratory Stockholm | Mikael,,Huss | Base-calling was done with Illumina's Offline Base Caller (OLB) v.1.9.,Alignment to reference genome was done with TopHat v1.0.14.,Duplicates were removed using Picard (v. 1.29) MarkDuplicates.,Read counts per gene were calculated with HTSeq v. 0.5.1.,FPKM values for genes and transcripts were calculated with Cufflinks v. 1.0.3.,Differential expression analysis was performed using the edgeR package and subsequent custom filtering,Genome_build: hg19,Supplementary_files_format_and_content: count_table.txt: tab separated text file (read counts per ENSEMBL gene),Supplementary_files_format_and_content: fpkm_table.txt: tab separated text file (FPKM per ENSEMBL gene) | Illumina TruSeq RNA | GSM913887 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX140517,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00854923 | GSM913887 | GSE37211 | 0.010781 | Parathyroid adenoma | Public on Sep 19 2012 | Apr 12 2012 | 9606 | DPN 24h - Adenoma 3 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX140517 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00854923 |
|
1 | patient: 3,tissue: Parathyroid tumor,agent: DPN,time: 48h | Tomtebodav. 23A | Solna | Sweden | Science for Life Laboratory Stockholm | Mikael,,Huss | Base-calling was done with Illumina's Offline Base Caller (OLB) v.1.9.,Alignment to reference genome was done with TopHat v1.0.14.,Duplicates were removed using Picard (v. 1.29) MarkDuplicates.,Read counts per gene were calculated with HTSeq v. 0.5.1.,FPKM values for genes and transcripts were calculated with Cufflinks v. 1.0.3.,Differential expression analysis was performed using the edgeR package and subsequent custom filtering,Genome_build: hg19,Supplementary_files_format_and_content: count_table.txt: tab separated text file (read counts per ENSEMBL gene),Supplementary_files_format_and_content: fpkm_table.txt: tab separated text file (FPKM per ENSEMBL gene) | Illumina TruSeq RNA | GSM913888 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX140518,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00854924 | GSM913888 | GSE37211 | 0.009617 | Parathyroid adenoma | Public on Sep 19 2012 | Apr 12 2012 | 9606 | DPN 48h - Adenoma 3 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX140518 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00854924 |
|
1 | patient: 3,tissue: Parathyroid tumor,agent: OHT,time: 48h | Tomtebodav. 23A | Solna | Sweden | Science for Life Laboratory Stockholm | Mikael,,Huss | Base-calling was done with Illumina's Offline Base Caller (OLB) v.1.9.,Alignment to reference genome was done with TopHat v1.0.14.,Duplicates were removed using Picard (v. 1.29) MarkDuplicates.,Read counts per gene were calculated with HTSeq v. 0.5.1.,FPKM values for genes and transcripts were calculated with Cufflinks v. 1.0.3.,Differential expression analysis was performed using the edgeR package and subsequent custom filtering,Genome_build: hg19,Supplementary_files_format_and_content: count_table.txt: tab separated text file (read counts per ENSEMBL gene),Supplementary_files_format_and_content: fpkm_table.txt: tab separated text file (FPKM per ENSEMBL gene) | Illumina TruSeq RNA | GSM913890 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX140520,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00854926 | GSM913890 | GSE37211 | 0.009784 | Parathyroid adenoma | Public on Sep 19 2012 | Apr 12 2012 | 9606 | OHT 48h - Adenoma 3 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX140520 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00854926 |
|
1 | patient: 4,tissue: Parathyroid tumor,agent: Control,time: 48h | Tomtebodav. 23A | Solna | Sweden | Science for Life Laboratory Stockholm | Mikael,,Huss | Base-calling was done with Illumina's Offline Base Caller (OLB) v.1.9.,Alignment to reference genome was done with TopHat v1.0.14.,Duplicates were removed using Picard (v. 1.29) MarkDuplicates.,Read counts per gene were calculated with HTSeq v. 0.5.1.,FPKM values for genes and transcripts were calculated with Cufflinks v. 1.0.3.,Differential expression analysis was performed using the edgeR package and subsequent custom filtering,Genome_build: hg19,Supplementary_files_format_and_content: count_table.txt: tab separated text file (read counts per ENSEMBL gene),Supplementary_files_format_and_content: fpkm_table.txt: tab separated text file (FPKM per ENSEMBL gene) | Illumina TruSeq RNA | GSM913891 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX140521,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00854927 | GSM913891 | GSE37211 | 0.005054 | Parathyroid adenoma | Public on Sep 19 2012 | Apr 12 2012 | 9606 | Control 48h - Adenoma 4 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX140521 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00854927 |
|
1 | patient: 4,tissue: Parathyroid tumor,agent: DPN,time: 24h | Tomtebodav. 23A | Solna | Sweden | Science for Life Laboratory Stockholm | Mikael,,Huss | Base-calling was done with Illumina's Offline Base Caller (OLB) v.1.9.,Alignment to reference genome was done with TopHat v1.0.14.,Duplicates were removed using Picard (v. 1.29) MarkDuplicates.,Read counts per gene were calculated with HTSeq v. 0.5.1.,FPKM values for genes and transcripts were calculated with Cufflinks v. 1.0.3.,Differential expression analysis was performed using the edgeR package and subsequent custom filtering,Genome_build: hg19,Supplementary_files_format_and_content: count_table.txt: tab separated text file (read counts per ENSEMBL gene),Supplementary_files_format_and_content: fpkm_table.txt: tab separated text file (FPKM per ENSEMBL gene) | Illumina TruSeq RNA | GSM913892 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX140522,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00854928 | GSM913892 | GSE37211 | 0 | Parathyroid adenoma | Public on Sep 19 2012 | Apr 12 2012 | 9606 | DPN 24h - Adenoma 4 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX140522 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00854928 |
|
1 | patient: 4,tissue: Parathyroid tumor,agent: DPN,time: 48h | Tomtebodav. 23A | Solna | Sweden | Science for Life Laboratory Stockholm | Mikael,,Huss | Base-calling was done with Illumina's Offline Base Caller (OLB) v.1.9.,Alignment to reference genome was done with TopHat v1.0.14.,Duplicates were removed using Picard (v. 1.29) MarkDuplicates.,Read counts per gene were calculated with HTSeq v. 0.5.1.,FPKM values for genes and transcripts were calculated with Cufflinks v. 1.0.3.,Differential expression analysis was performed using the edgeR package and subsequent custom filtering,Genome_build: hg19,Supplementary_files_format_and_content: count_table.txt: tab separated text file (read counts per ENSEMBL gene),Supplementary_files_format_and_content: fpkm_table.txt: tab separated text file (FPKM per ENSEMBL gene) | Illumina TruSeq RNA | GSM913893 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX140523,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00854929 | GSM913893 | GSE37211 | 0.005823 | Parathyroid adenoma | Public on Sep 19 2012 | Apr 12 2012 | 9606 | DPN 48h - Adenoma 4 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX140523 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00854929 |
|
1 | patient: 4,tissue: Parathyroid tumor,agent: OHT,time: 24h | Tomtebodav. 23A | Solna | Sweden | Science for Life Laboratory Stockholm | Mikael,,Huss | Base-calling was done with Illumina's Offline Base Caller (OLB) v.1.9.,Alignment to reference genome was done with TopHat v1.0.14.,Duplicates were removed using Picard (v. 1.29) MarkDuplicates.,Read counts per gene were calculated with HTSeq v. 0.5.1.,FPKM values for genes and transcripts were calculated with Cufflinks v. 1.0.3.,Differential expression analysis was performed using the edgeR package and subsequent custom filtering,Genome_build: hg19,Supplementary_files_format_and_content: count_table.txt: tab separated text file (read counts per ENSEMBL gene),Supplementary_files_format_and_content: fpkm_table.txt: tab separated text file (FPKM per ENSEMBL gene) | Illumina TruSeq RNA | GSM913894 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX140524,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00854930 | GSM913894 | GSE37211 | 0.00385 | Parathyroid adenoma | Public on Sep 19 2012 | Apr 12 2012 | 9606 | OHT 24h - Adenoma 4 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX140524 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00854930 |
|
1 | patient: 4,tissue: Parathyroid tumor,agent: OHT,time: 48h | Tomtebodav. 23A | Solna | Sweden | Science for Life Laboratory Stockholm | Mikael,,Huss | Base-calling was done with Illumina's Offline Base Caller (OLB) v.1.9.,Alignment to reference genome was done with TopHat v1.0.14.,Duplicates were removed using Picard (v. 1.29) MarkDuplicates.,Read counts per gene were calculated with HTSeq v. 0.5.1.,FPKM values for genes and transcripts were calculated with Cufflinks v. 1.0.3.,Differential expression analysis was performed using the edgeR package and subsequent custom filtering,Genome_build: hg19,Supplementary_files_format_and_content: count_table.txt: tab separated text file (read counts per ENSEMBL gene),Supplementary_files_format_and_content: fpkm_table.txt: tab separated text file (FPKM per ENSEMBL gene) | Illumina TruSeq RNA | GSM913895 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX140525,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00854931 | GSM913895 | GSE37211 | 0.004141 | Parathyroid adenoma | Public on Sep 19 2012 | Apr 12 2012 | 9606 | OHT 48h - Adenoma 4 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX140525 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00854931 |
|
1 | cell line: HEK293 | Mattenstrasse | Basel | Switzerland | ETH Zurich | Cem,,Sievers | quality filtering according to the Illumina quality filter,Bowtie alignment using the following parameter setting:--best --chunkmbs 512 -S -M 100 -p 8 -k 1,Aligned reads were used to compute the relative substitution frequency at positions with coverage of at least 20,Genome_build: hg19,Supplementary_files_format_and_content: The final file contains information about read substitutions with respect to the reference genome at specific genomic positions. Each row specificies one substitution. The columns contain information regarding chromosome, genomic position (zero offset), strand, substitution, coverage at position and number of specified substitions at the position | Nuclei were extracted from cells treated with 4SU overnight. Nuclear RNA was extracted using TRIzol (Invitrogen) and reverse transcribed using random hexamer, and sequenced using Illumina Hi-Seq | GSM921129 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX144164,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00862541 | GSM921129 | GSE37524 | 0.017409 | HEK293 4SU nuclear RNA-seq | Public on Aug 07 2012 | Apr 23 2012 | 9606 | HEK293 4SU nuclear RNA-seq | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX144164 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00862541 |
|
1 | cell type: human preimplantation blastomere,developmental stage: early blastomere,tissue: human preimplantation embryos | 5 Yiheyuan Road | Beijing | China | Peking University | Mingyu,,Yang | Reads mapping: We used Burrows-Wheeler Aligner (BWA, Version 0.5.9-r16) to align the clean reads to the hg19 Refseq, with the options "aln -o 1 -e 60 -i 15 -q 10 -t 8" [Li H. and Durbin R. (2009) Fast and accurate short read alignment with Burrows-Wheeler Transform. Bioinformatics, 25:1754-60],Expression level analysis : The gene expression level was calculated by using RPKM method, We used all genes with RPKM ⥠0.1 as expressed genes in the following analysis,Use BEDTools(Version-2.16.2) to transform *.bam files into *.bed files.[Ref: Aaron R. Quinlan and Ira M. Hall. (2010) BEDTools: a flexible suite of utilities for comparing genomic features,Bioinformatics (2010), 26: 841-842],Merge the *.bed files from samples in the same stage [available on Series records],Use IGVtools to transform the merged *.bed files into *.tdf files for visualization [available on Series records],Genome_build: hg19,Sample_C4.expression.txt: hg19 | Amplied single cell cDNAs were further amplied for another ten cycles of PCR.Then it was sonicated into 200~500bp fragments ,then the standard TruSeq DNA library preparation kit was used following the manualfactory suggestion protocol | GSM922146 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX144340,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00989115 | GSM922146 | GSE36552 | 0.557416 | 4-cell embryo#1 | Public on Aug 10 2013 | Apr 25 2012 | 9606 | 4-cell embryo#1 -Cell#1 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX144340 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00989115 |
|
1 | cell type: human preimplantation blastomere,developmental stage: early blastomere,tissue: human preimplantation embryos | 5 Yiheyuan Road | Beijing | China | Peking University | Mingyu,,Yang | Reads mapping: We used Burrows-Wheeler Aligner (BWA, Version 0.5.9-r16) to align the clean reads to the hg19 Refseq, with the options "aln -o 1 -e 60 -i 15 -q 10 -t 8" [Li H. and Durbin R. (2009) Fast and accurate short read alignment with Burrows-Wheeler Transform. Bioinformatics, 25:1754-60],Expression level analysis : The gene expression level was calculated by using RPKM method, We used all genes with RPKM ⥠0.1 as expressed genes in the following analysis,Use BEDTools(Version-2.16.2) to transform *.bam files into *.bed files.[Ref: Aaron R. Quinlan and Ira M. Hall. (2010) BEDTools: a flexible suite of utilities for comparing genomic features,Bioinformatics (2010), 26: 841-842],Merge the *.bed files from samples in the same stage [available on Series records],Use IGVtools to transform the merged *.bed files into *.tdf files for visualization [available on Series records],Genome_build: hg19,Sample_C5.expression.txt: hg19 | Amplied single cell cDNAs were further amplied for another ten cycles of PCR.Then it was sonicated into 200~500bp fragments ,then the standard TruSeq DNA library preparation kit was used following the manualfactory suggestion protocol | GSM922147 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX144341,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00989116 | GSM922147 | GSE36552 | 0.53047 | 4-cell embryo#1 | Public on Aug 10 2013 | Apr 25 2012 | 9606 | 4-cell embryo#1 -Cell#2 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX144341 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00989116 |
|
1 | cell type: human preimplantation blastomere,developmental stage: early blastomere,tissue: human preimplantation embryos | 5 Yiheyuan Road | Beijing | China | Peking University | Mingyu,,Yang | Reads mapping: We used Burrows-Wheeler Aligner (BWA, Version 0.5.9-r16) to align the clean reads to the hg19 Refseq, with the options "aln -o 1 -e 60 -i 15 -q 10 -t 8" [Li H. and Durbin R. (2009) Fast and accurate short read alignment with Burrows-Wheeler Transform. Bioinformatics, 25:1754-60],Expression level analysis : The gene expression level was calculated by using RPKM method, We used all genes with RPKM ⥠0.1 as expressed genes in the following analysis,Use BEDTools(Version-2.16.2) to transform *.bam files into *.bed files.[Ref: Aaron R. Quinlan and Ira M. Hall. (2010) BEDTools: a flexible suite of utilities for comparing genomic features,Bioinformatics (2010), 26: 841-842],Merge the *.bed files from samples in the same stage [available on Series records],Use IGVtools to transform the merged *.bed files into *.tdf files for visualization [available on Series records],Genome_build: hg19,Sample_C6.expression.txt: hg19 | Amplied single cell cDNAs were further amplied for another ten cycles of PCR.Then it was sonicated into 200~500bp fragments ,then the standard TruSeq DNA library preparation kit was used following the manualfactory suggestion protocol | GSM922148 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX144342,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00989117 | GSM922148 | GSE36552 | 0.740351 | 4-cell embryo#1 | Public on Aug 10 2013 | Apr 25 2012 | 9606 | 4-cell embryo#1 -Cell#3 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX144342 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00989117 |
|
1 | cell type: human preimplantation blastomere,developmental stage: early blastomere,tissue: human preimplantation embryos | 5 Yiheyuan Road | Beijing | China | Peking University | Mingyu,,Yang | Reads mapping: We used Burrows-Wheeler Aligner (BWA, Version 0.5.9-r16) to align the clean reads to the hg19 Refseq, with the options "aln -o 1 -e 60 -i 15 -q 10 -t 8" [Li H. and Durbin R. (2009) Fast and accurate short read alignment with Burrows-Wheeler Transform. Bioinformatics, 25:1754-60],Expression level analysis : The gene expression level was calculated by using RPKM method, We used all genes with RPKM ⥠0.1 as expressed genes in the following analysis,Use BEDTools(Version-2.16.2) to transform *.bam files into *.bed files.[Ref: Aaron R. Quinlan and Ira M. Hall. (2010) BEDTools: a flexible suite of utilities for comparing genomic features,Bioinformatics (2010), 26: 841-842],Merge the *.bed files from samples in the same stage [available on Series records],Use IGVtools to transform the merged *.bed files into *.tdf files for visualization [available on Series records],Genome_build: hg19,Sample_C7.expression.txt: hg19 | Amplied single cell cDNAs were further amplied for another ten cycles of PCR.Then it was sonicated into 200~500bp fragments ,then the standard TruSeq DNA library preparation kit was used following the manualfactory suggestion protocol | GSM922149 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX144343,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00989118 | GSM922149 | GSE36552 | 0.75218 | 4-cell embryo#1 | Public on Aug 10 2013 | Apr 25 2012 | 9606 | 4-cell embryo#1 -Cell#4 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX144343 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00989118 |
|
1 | cell type: human preimplantation blastomere,developmental stage: early blastomere,tissue: human preimplantation embryos | 5 Yiheyuan Road | Beijing | China | Peking University | Mingyu,,Yang | Reads mapping: We used Burrows-Wheeler Aligner (BWA, Version 0.5.9-r16) to align the clean reads to the hg19 Refseq, with the options "aln -o 1 -e 60 -i 15 -q 10 -t 8" [Li H. and Durbin R. (2009) Fast and accurate short read alignment with Burrows-Wheeler Transform. Bioinformatics, 25:1754-60],Expression level analysis : The gene expression level was calculated by using RPKM method, We used all genes with RPKM ⥠0.1 as expressed genes in the following analysis,Use BEDTools(Version-2.16.2) to transform *.bam files into *.bed files.[Ref: Aaron R. Quinlan and Ira M. Hall. (2010) BEDTools: a flexible suite of utilities for comparing genomic features,Bioinformatics (2010), 26: 841-842],Merge the *.bed files from samples in the same stage [available on Series records],Use IGVtools to transform the merged *.bed files into *.tdf files for visualization [available on Series records],Genome_build: hg19,Sample_L2.expression.txt: hg19 | Amplied single cell cDNAs were further amplied for another ten cycles of PCR.Then it was sonicated into 200~500bp fragments ,then the standard TruSeq DNA library preparation kit was used following the manualfactory suggestion protocol | GSM922151 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX144345,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00989120 | GSM922151 | GSE36552 | 0.423524 | 4-cell embryo#2 | Public on Aug 10 2013 | Apr 25 2012 | 9606 | 4-cell embryo#2 -Cell#2 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX144345 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00989120 |
|
1 | cell type: human preimplantation blastomere,developmental stage: early blastomere,tissue: human preimplantation embryos | 5 Yiheyuan Road | Beijing | China | Peking University | Mingyu,,Yang | Reads mapping: We used Burrows-Wheeler Aligner (BWA, Version 0.5.9-r16) to align the clean reads to the hg19 Refseq, with the options "aln -o 1 -e 60 -i 15 -q 10 -t 8" [Li H. and Durbin R. (2009) Fast and accurate short read alignment with Burrows-Wheeler Transform. Bioinformatics, 25:1754-60],Expression level analysis : The gene expression level was calculated by using RPKM method, We used all genes with RPKM ⥠0.1 as expressed genes in the following analysis,Use BEDTools(Version-2.16.2) to transform *.bam files into *.bed files.[Ref: Aaron R. Quinlan and Ira M. Hall. (2010) BEDTools: a flexible suite of utilities for comparing genomic features,Bioinformatics (2010), 26: 841-842],Merge the *.bed files from samples in the same stage [available on Series records],Use IGVtools to transform the merged *.bed files into *.tdf files for visualization [available on Series records],Genome_build: hg19,Sample_L4.expression.txt: hg19 | Amplied single cell cDNAs were further amplied for another ten cycles of PCR.Then it was sonicated into 200~500bp fragments ,then the standard TruSeq DNA library preparation kit was used following the manualfactory suggestion protocol | GSM922153 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX144347,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00989122 | GSM922153 | GSE36552 | 0.408986 | 4-cell embryo#2 | Public on Aug 10 2013 | Apr 25 2012 | 9606 | 4-cell embryo#2 -Cell#4 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX144347 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00989122 |
|
1 | cell type: human preimplantation blastomere,developmental stage: early blastomere,tissue: human preimplantation embryos | 5 Yiheyuan Road | Beijing | China | Peking University | Mingyu,,Yang | Reads mapping: We used Burrows-Wheeler Aligner (BWA, Version 0.5.9-r16) to align the clean reads to the hg19 Refseq, with the options "aln -o 1 -e 60 -i 15 -q 10 -t 8" [Li H. and Durbin R. (2009) Fast and accurate short read alignment with Burrows-Wheeler Transform. Bioinformatics, 25:1754-60],Expression level analysis : The gene expression level was calculated by using RPKM method, We used all genes with RPKM ⥠0.1 as expressed genes in the following analysis,Use BEDTools(Version-2.16.2) to transform *.bam files into *.bed files.[Ref: Aaron R. Quinlan and Ira M. Hall. (2010) BEDTools: a flexible suite of utilities for comparing genomic features,Bioinformatics (2010), 26: 841-842],Merge the *.bed files from samples in the same stage [available on Series records],Use IGVtools to transform the merged *.bed files into *.tdf files for visualization [available on Series records],Genome_build: hg19,Sample_L7.expression.txt: hg19 | Amplied single cell cDNAs were further amplied for another ten cycles of PCR.Then it was sonicated into 200~500bp fragments ,then the standard TruSeq DNA library preparation kit was used following the manualfactory suggestion protocol | GSM922156 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX144350,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00989125 | GSM922156 | GSE36552 | 0.260106 | 4-cell embryo#3 | Public on Aug 10 2013 | Apr 25 2012 | 9606 | 4-cell embryo#3 -Cell#3 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX144350 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00989125 |
|
1 | cell type: human preimplantation blastomere,developmental stage: early blastomere,tissue: human preimplantation embryos | 5 Yiheyuan Road | Beijing | China | Peking University | Mingyu,,Yang | Reads mapping: We used Burrows-Wheeler Aligner (BWA, Version 0.5.9-r16) to align the clean reads to the hg19 Refseq, with the options "aln -o 1 -e 60 -i 15 -q 10 -t 8" [Li H. and Durbin R. (2009) Fast and accurate short read alignment with Burrows-Wheeler Transform. Bioinformatics, 25:1754-60],Expression level analysis : The gene expression level was calculated by using RPKM method, We used all genes with RPKM ⥠0.1 as expressed genes in the following analysis,Use BEDTools(Version-2.16.2) to transform *.bam files into *.bed files.[Ref: Aaron R. Quinlan and Ira M. Hall. (2010) BEDTools: a flexible suite of utilities for comparing genomic features,Bioinformatics (2010), 26: 841-842],Merge the *.bed files from samples in the same stage [available on Series records],Use IGVtools to transform the merged *.bed files into *.tdf files for visualization [available on Series records],Genome_build: hg19,Sample_L8.expression.txt: hg19 | Amplied single cell cDNAs were further amplied for another ten cycles of PCR.Then it was sonicated into 200~500bp fragments ,then the standard TruSeq DNA library preparation kit was used following the manualfactory suggestion protocol | GSM922157 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX144351,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00989126 | GSM922157 | GSE36552 | 0.184498 | 4-cell embryo#3 | Public on Aug 10 2013 | Apr 25 2012 | 9606 | 4-cell embryo#3 -Cell#4 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX144351 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00989126 |
|
1 | cell type: human preimplantation blastomere,developmental stage: early blastomere,tissue: human preimplantation embryos | 5 Yiheyuan Road | Beijing | China | Peking University | Mingyu,,Yang | Reads mapping: We used Burrows-Wheeler Aligner (BWA, Version 0.5.9-r16) to align the clean reads to the hg19 Refseq, with the options "aln -o 1 -e 60 -i 15 -q 10 -t 8" [Li H. and Durbin R. (2009) Fast and accurate short read alignment with Burrows-Wheeler Transform. Bioinformatics, 25:1754-60],Expression level analysis : The gene expression level was calculated by using RPKM method, We used all genes with RPKM ⥠0.1 as expressed genes in the following analysis,Use BEDTools(Version-2.16.2) to transform *.bam files into *.bed files.[Ref: Aaron R. Quinlan and Ira M. Hall. (2010) BEDTools: a flexible suite of utilities for comparing genomic features,Bioinformatics (2010), 26: 841-842],Merge the *.bed files from samples in the same stage [available on Series records],Use IGVtools to transform the merged *.bed files into *.tdf files for visualization [available on Series records],Genome_build: hg19,Sample_A1.expression.txt: hg19 | Amplied single cell cDNAs were further amplied for another ten cycles of PCR.Then it was sonicated into 200~500bp fragments ,then the standard TruSeq DNA library preparation kit was used following the manualfactory suggestion protocol | GSM922158 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX144352,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00989127 | GSM922158 | GSE36552 | 0.515598 | 8-cell embryo#1 | Public on Aug 10 2013 | Apr 25 2012 | 9606 | 8-cell embryo#1 -Cell#1 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX144352 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00989127 |
|
1 | cell type: human preimplantation blastomere,developmental stage: early blastomere,tissue: human preimplantation embryos | 5 Yiheyuan Road | Beijing | China | Peking University | Mingyu,,Yang | Reads mapping: We used Burrows-Wheeler Aligner (BWA, Version 0.5.9-r16) to align the clean reads to the hg19 Refseq, with the options "aln -o 1 -e 60 -i 15 -q 10 -t 8" [Li H. and Durbin R. (2009) Fast and accurate short read alignment with Burrows-Wheeler Transform. Bioinformatics, 25:1754-60],Expression level analysis : The gene expression level was calculated by using RPKM method, We used all genes with RPKM ⥠0.1 as expressed genes in the following analysis,Use BEDTools(Version-2.16.2) to transform *.bam files into *.bed files.[Ref: Aaron R. Quinlan and Ira M. Hall. (2010) BEDTools: a flexible suite of utilities for comparing genomic features,Bioinformatics (2010), 26: 841-842],Merge the *.bed files from samples in the same stage [available on Series records],Use IGVtools to transform the merged *.bed files into *.tdf files for visualization [available on Series records],Genome_build: hg19,Sample_A2.expression.txt: hg19 | Amplied single cell cDNAs were further amplied for another ten cycles of PCR.Then it was sonicated into 200~500bp fragments ,then the standard TruSeq DNA library preparation kit was used following the manualfactory suggestion protocol | GSM922159 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX144353,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00989128 | GSM922159 | GSE36552 | 0.392959 | 8-cell embryo#1 | Public on Aug 10 2013 | Apr 25 2012 | 9606 | 8-cell embryo#1 -Cell#2 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX144353 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00989128 |
|
1 | cell type: human preimplantation blastomere,developmental stage: early blastomere,tissue: human preimplantation embryos | 5 Yiheyuan Road | Beijing | China | Peking University | Mingyu,,Yang | Reads mapping: We used Burrows-Wheeler Aligner (BWA, Version 0.5.9-r16) to align the clean reads to the hg19 Refseq, with the options "aln -o 1 -e 60 -i 15 -q 10 -t 8" [Li H. and Durbin R. (2009) Fast and accurate short read alignment with Burrows-Wheeler Transform. Bioinformatics, 25:1754-60],Expression level analysis : The gene expression level was calculated by using RPKM method, We used all genes with RPKM ⥠0.1 as expressed genes in the following analysis,Use BEDTools(Version-2.16.2) to transform *.bam files into *.bed files.[Ref: Aaron R. Quinlan and Ira M. Hall. (2010) BEDTools: a flexible suite of utilities for comparing genomic features,Bioinformatics (2010), 26: 841-842],Merge the *.bed files from samples in the same stage [available on Series records],Use IGVtools to transform the merged *.bed files into *.tdf files for visualization [available on Series records],Genome_build: hg19,Sample_A3.expression.txt: hg19 | Amplied single cell cDNAs were further amplied for another ten cycles of PCR.Then it was sonicated into 200~500bp fragments ,then the standard TruSeq DNA library preparation kit was used following the manualfactory suggestion protocol | GSM922160 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX144354,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00989129 | GSM922160 | GSE36552 | 0.640292 | 8-cell embryo#1 | Public on Aug 10 2013 | Apr 25 2012 | 9606 | 8-cell embryo#1 -Cell#3 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX144354 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00989129 |
|
1 | cell type: human preimplantation blastomere,developmental stage: early blastomere,tissue: human preimplantation embryos | 5 Yiheyuan Road | Beijing | China | Peking University | Mingyu,,Yang | Reads mapping: We used Burrows-Wheeler Aligner (BWA, Version 0.5.9-r16) to align the clean reads to the hg19 Refseq, with the options "aln -o 1 -e 60 -i 15 -q 10 -t 8" [Li H. and Durbin R. (2009) Fast and accurate short read alignment with Burrows-Wheeler Transform. Bioinformatics, 25:1754-60],Expression level analysis : The gene expression level was calculated by using RPKM method, We used all genes with RPKM ⥠0.1 as expressed genes in the following analysis,Use BEDTools(Version-2.16.2) to transform *.bam files into *.bed files.[Ref: Aaron R. Quinlan and Ira M. Hall. (2010) BEDTools: a flexible suite of utilities for comparing genomic features,Bioinformatics (2010), 26: 841-842],Merge the *.bed files from samples in the same stage [available on Series records],Use IGVtools to transform the merged *.bed files into *.tdf files for visualization [available on Series records],Genome_build: hg19,Sample_A4.expression.txt: hg19 | Amplied single cell cDNAs were further amplied for another ten cycles of PCR.Then it was sonicated into 200~500bp fragments ,then the standard TruSeq DNA library preparation kit was used following the manualfactory suggestion protocol | GSM922161 | Illumina HiSeq 2000 | May 15 2019 | cDNA | transcriptomic | RNA-Seq | total RNA | Homo sapiens | GPL11154 | SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRX144355,BioSample: https://www.ncbi.nlm.nih.gov/biosample/SAMN00989130 | GSM922161 | GSE36552 | 0.752467 | 8-cell embryo#1 | Public on Aug 10 2013 | Apr 25 2012 | 9606 | 8-cell embryo#1 -Cell#4 | SRA | https://www.ncbi.nlm.nih.gov/sra?term=SRX144355 | https://www.ncbi.nlm.nih.gov/biosample/SAMN00989130 |